ID: 1147900114

View in Genome Browser
Species Human (GRCh38)
Location 17:43778517-43778539
Sequence GTCCCAGCCGCCACCCGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147900114_1147900128 19 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900128 17:43778559-43778581 GCTCCGTGCACCCCGCCACGGGG 0: 1
1: 0
2: 1
3: 3
4: 70
1147900114_1147900130 23 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900114_1147900131 24 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900114_1147900126 17 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900126 17:43778557-43778579 GGGCTCCGTGCACCCCGCCACGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147900114_1147900119 -4 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900119 17:43778536-43778558 GGACCCGGGCAGGCGCCACCCGG 0: 1
1: 0
2: 0
3: 16
4: 177
1147900114_1147900120 -3 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900120 17:43778537-43778559 GACCCGGGCAGGCGCCACCCGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1147900114_1147900127 18 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900127 17:43778558-43778580 GGCTCCGTGCACCCCGCCACGGG 0: 1
1: 0
2: 2
3: 3
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147900114 Original CRISPR GTCCCAGCCGCCACCCGCTT GGG (reversed) Intronic
901316335 1:8312303-8312325 GTCCCAGCCAACATCTGCTTGGG - Intergenic
901666659 1:10830159-10830181 GGCCCACCCGCCACCCACTCCGG + Intergenic
905042094 1:34968196-34968218 TTCCCAGCCGCCACCCCATCTGG - Intergenic
905137133 1:35808367-35808389 GTCCCCGGCGCCTCCCGCTCCGG - Exonic
905286141 1:36881613-36881635 GTCCAAGCCGCCATCATCTTTGG + Intronic
907278689 1:53330946-53330968 CTCTCAGCCTCCACCCACTTTGG + Intergenic
911351883 1:96763165-96763187 TGCCCAGCCGCCACCCCGTTTGG - Intronic
915517431 1:156421450-156421472 GGCCGAGCCCCCACCCTCTTCGG - Intronic
921066528 1:211626829-211626851 GTCCCAGCCACGAACCCCTTAGG + Intergenic
922460101 1:225809294-225809316 GCCCCAGCAACCACCCGCCTGGG + Intergenic
922644802 1:227276010-227276032 TGCCCAGCCGCCACCCCCTCTGG + Intronic
922851798 1:228738994-228739016 GTCCCAGCCACCAGCCACTCAGG + Intronic
924428888 1:243979559-243979581 GCCCCACCCGCCACCCTCGTGGG - Intergenic
924428960 1:243979739-243979761 GCCCCACCCGCCACCCTCGTGGG - Intergenic
1068673308 10:59744581-59744603 TGCCCAGCCGCCACCCGGTCTGG + Intergenic
1069676905 10:70255044-70255066 GGCCCGGCCGCCTCCCGCTGCGG - Exonic
1069802990 10:71093793-71093815 GTGCCAGCAGCCAGCAGCTTCGG + Intergenic
1073529971 10:104221953-104221975 GTCCCAGACCCCACCAGCCTGGG + Intronic
1074195708 10:111182912-111182934 TTCCCAGGCGCCACCAGCCTGGG - Intergenic
1076114264 10:127884524-127884546 TTCCCAGCCGCCTCCAGCGTTGG - Intronic
1077391141 11:2301146-2301168 GGCCCAGCTGCCGCCCGCTCAGG - Intronic
1077404461 11:2377046-2377068 GGCCCTGCTGCCACCCCCTTGGG + Intronic
1078101311 11:8331958-8331980 GTCCTTCCCACCACCCGCTTAGG + Intergenic
1081968939 11:47185579-47185601 GGCCCTGCCTCCTCCCGCTTTGG - Intronic
1082280637 11:50267969-50267991 GTCCCAGCCGCCCCTCGCGGGGG + Intergenic
1084001028 11:66295509-66295531 GCCCCAGCGGCCCCCCGCTCAGG - Exonic
1084430054 11:69106007-69106029 TTCCCCGCTGCCACCCGCCTTGG + Intergenic
1085716665 11:78879300-78879322 TGCCCAGCCGCCACCCGATCTGG + Intronic
1091004566 11:131941333-131941355 GCCCCAGCCACCACCCTTTTGGG + Intronic
1097089452 12:56494149-56494171 TGCCCAGCCGCCACCCCCTCTGG - Intergenic
1098302880 12:69071880-69071902 GTCCCAGCCCCCAGCCACTGGGG + Intergenic
1111165060 13:84447683-84447705 GACCCAGCCTCCACCTGCTCTGG - Intergenic
1113654725 13:112061048-112061070 CTCCCAGCCGGCAGCCGCTCTGG + Intergenic
1113916134 13:113875148-113875170 GTCTCAGACGACACCTGCTTGGG - Intergenic
1118584608 14:67341082-67341104 TGCCCAGCCGCCACCCGGTCTGG + Intronic
1128743137 15:70096880-70096902 TTCCCGGCCGCCCCCCGCTCGGG - Exonic
1131777053 15:95814353-95814375 TTCCCAGCCCCCACCACCTTAGG + Intergenic
1137401176 16:48155665-48155687 GTCCCTGCTGCCTCCCACTTGGG + Intronic
1140403521 16:74691575-74691597 GCCCCAGCCACCACCAGCTCTGG - Intronic
1141722173 16:85762528-85762550 CTCCCAGCGGCCACCCTGTTTGG - Intergenic
1141869182 16:86772999-86773021 GTCCCTCCCGCCACCCTCTGGGG - Intergenic
1142695196 17:1629347-1629369 GTCCCCGCCGCCTCGGGCTTTGG + Intergenic
1145010150 17:19363305-19363327 GTGCCAGGCGCCGCCCGCTGCGG - Intronic
1145397344 17:22506310-22506332 GCCCCTGCCGCCTCCCGCTCAGG - Intergenic
1145997385 17:29112431-29112453 GCCCCAGCCTCTACCCGTTTTGG - Intronic
1147315399 17:39617910-39617932 CTCCCCGCGGCCTCCCGCTTGGG + Intergenic
1147710168 17:42458046-42458068 GTCCTGGCCTCCACCCGCCTCGG - Intergenic
1147900114 17:43778517-43778539 GTCCCAGCCGCCACCCGCTTGGG - Intronic
1148986033 17:51622177-51622199 GTCCCAGCCGTCATCCTCTTTGG - Intergenic
1150894560 17:69196082-69196104 TGCCCAGCCGCCACCCGCTCTGG - Intronic
1151413597 17:73947393-73947415 TTCCCAGCCGCCACCTTCTCAGG - Intergenic
1151658941 17:75508538-75508560 GTCCCACCCCCCGCCCTCTTTGG - Intronic
1152073101 17:78143845-78143867 GTCCCAGCCACCCCCAGCCTTGG + Intergenic
1155362572 18:25016896-25016918 TTCCCAGCCACCGCCTGCTTCGG + Intergenic
1156481161 18:37437263-37437285 CTCCCAGCAGCCTCCAGCTTGGG - Intronic
1157305025 18:46510682-46510704 GTCTCAGCCGCCATCAGCTATGG - Intronic
1157488997 18:48109159-48109181 GTGACAGCCGCCACCAGCCTGGG - Intronic
1158601555 18:58860197-58860219 AGCCCAACCCCCACCCGCTTCGG + Intergenic
1161455083 19:4365988-4366010 GTCCCTTCCGCTGCCCGCTTGGG + Intronic
1161527348 19:4764820-4764842 GACCCAGCCGTCACCCTCCTAGG + Intergenic
1161801118 19:6417209-6417231 CTCCCAGCCTCCACTCGCTCAGG + Intronic
1162069117 19:8143082-8143104 GTCCCTGACGCCACCCACTCCGG + Intronic
1162758570 19:12874736-12874758 GTCCCACCCGCATCCCTCTTGGG + Exonic
1162940660 19:14006993-14007015 ATCCCAGCTCCCACCCGCTGGGG + Intronic
1163755595 19:19104629-19104651 GTCCCAGCCTCCAGGCACTTGGG - Intronic
1166528134 19:43526159-43526181 GTCCAGGCCACCACCCTCTTGGG + Intronic
1166698828 19:44870182-44870204 GTCTCTGCCTCCACCCACTTTGG - Intronic
1168632513 19:57968402-57968424 GTCCCAGCTTCCATCCTCTTAGG - Intronic
926204816 2:10828557-10828579 GTCCCAGCTGCCATCTGCATGGG - Intronic
927188076 2:20496948-20496970 GTCCCATCCGCCACCCAGCTGGG - Intergenic
934506115 2:94895843-94895865 CTCCCCGCCGCCACCATCTTTGG + Intergenic
937428597 2:121819637-121819659 CTCCCAGCCTCCTCCCGCTCAGG + Intergenic
1172701740 20:36857574-36857596 GTCCCAGCCGCAGCCTCCTTGGG - Intronic
1172997356 20:39081037-39081059 GTCCCAGCCAACAACCGCTAAGG + Intergenic
1173475364 20:43355337-43355359 GTCCCAGCAGGCACCTCCTTGGG - Intergenic
1175905715 20:62378432-62378454 GTCCCAGCCGCCTTCCTCTGGGG + Intergenic
1176166876 20:63679057-63679079 GTCCCAGCCACCACCTCTTTTGG + Intronic
1181764599 22:25082196-25082218 GTGCCAGCCACCACCCCCTCTGG + Intronic
1183687300 22:39368493-39368515 GCCCCAGCAGACACCCGCCTCGG - Intronic
1184916776 22:47574794-47574816 GTCCCAGCAGCAACCCCGTTGGG - Intergenic
1185391471 22:50563607-50563629 GGCCCCGTCGCCACCCGCCTCGG - Intergenic
949248250 3:1950788-1950810 ATCCCAGCAGCTACCAGCTTAGG - Intergenic
952646440 3:35664668-35664690 GCCCCCGCCGCCACCTGCTCCGG - Intronic
953307075 3:41841091-41841113 TGCCCAGCCGCCACCCGTCTGGG + Intronic
954407767 3:50355054-50355076 GTCCCTGCAGCCACTTGCTTGGG + Exonic
961217325 3:125169797-125169819 GTCACAACTGCCACCCACTTGGG + Intronic
961451019 3:127002336-127002358 CTCCCAGCCGACAGCCTCTTTGG + Intronic
961780280 3:129316810-129316832 CTCCCATCCGCCATCCCCTTTGG - Intergenic
968684408 4:1947324-1947346 GTCCTTGCTGCCACCTGCTTGGG + Intronic
969099777 4:4760193-4760215 GCCCCAGCCTCCTCCGGCTTGGG + Intergenic
970035041 4:11723668-11723690 GACCCAGCGGCAACCCGCTTGGG - Intergenic
972396765 4:38664499-38664521 GTCCCTGCCGCCCCCCTCCTCGG + Intronic
989579725 5:43020632-43020654 GCCCCAGCCTCCACCTGCTCTGG + Intergenic
992391732 5:76336324-76336346 TTCCCAGCCGCCATCCCCTCTGG - Intronic
995236294 5:109833141-109833163 TTCCCAGCCGCCATCCCCTCTGG - Intronic
997678138 5:135730403-135730425 TTGCCTGCCGCCACCCACTTAGG + Intergenic
998200265 5:140113481-140113503 GGCCCACCCGCCACCCGGCTGGG - Intronic
999382418 5:151130953-151130975 GTCCGAGCCGCCAACCCATTTGG + Intronic
1001924202 5:175624422-175624444 GTCCCAGCAGCCACACCCCTAGG - Intergenic
1005135926 6:22569934-22569956 GTCGCCGCCGCCACCAGCGTGGG - Exonic
1009869129 6:69433150-69433172 TGCCCAGCCGCCACCCTCTCTGG - Intergenic
1017698273 6:157041176-157041198 GTCCCAGCAGCCACCAACATGGG + Intronic
1017738360 6:157382517-157382539 GTCCCATCCGCCACCTGGATTGG - Intronic
1019298524 7:291245-291267 GTCCGAGCCGCCCGCCGCTCAGG + Intergenic
1023040965 7:36172943-36172965 GTACCAGACCCCACCCACTTGGG - Intronic
1023164045 7:37325314-37325336 GGCCCAGCAGCCACGCGCCTGGG - Intronic
1023805202 7:43868193-43868215 GTCACAGCCTTCTCCCGCTTAGG + Intronic
1026013551 7:66654932-66654954 TTCCCGGCCGCCTCCCTCTTCGG + Intronic
1028535719 7:91887940-91887962 TTCCCAGCCGCCACCCTGTCTGG + Intergenic
1029284393 7:99455925-99455947 GTCCCAGCCTCCCCTCCCTTGGG - Intronic
1033119102 7:138651151-138651173 GTCCCAGCTGCTACCCCTTTAGG - Intronic
1034251313 7:149692888-149692910 GTCACAGCCCCCACCAGCTCCGG + Intergenic
1036083819 8:5590762-5590784 GTCCCAGACATCACCAGCTTTGG + Intergenic
1036694176 8:10964003-10964025 GTCCCTGCCACCACCCTCTGCGG - Intronic
1049109554 8:140635006-140635028 GACCCGGCCTCCACCCGCTCAGG + Intronic
1049552478 8:143267010-143267032 GTCCCCCCCGCCGCCCTCTTGGG - Intronic
1057211970 9:93205399-93205421 GTGCCAGCCTCCACCCACTGGGG - Intronic
1062519841 9:136953081-136953103 GTCCCAGCCGCCAGTGGCTCAGG + Intronic
1192320799 X:70089065-70089087 GTCCCAGCAGCCACCTGGTTTGG - Intergenic
1196949309 X:120860710-120860732 TTCCCAGCCTCCACCCTCTTAGG + Intergenic
1200653341 Y:5868428-5868450 TTCCCAGCTTCCTCCCGCTTCGG + Intergenic