ID: 1147900115

View in Genome Browser
Species Human (GRCh38)
Location 17:43778518-43778540
Sequence GGTCCCAGCCGCCACCCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147900115_1147900119 -5 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900119 17:43778536-43778558 GGACCCGGGCAGGCGCCACCCGG 0: 1
1: 0
2: 0
3: 16
4: 177
1147900115_1147900120 -4 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900120 17:43778537-43778559 GACCCGGGCAGGCGCCACCCGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1147900115_1147900126 16 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900126 17:43778557-43778579 GGGCTCCGTGCACCCCGCCACGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147900115_1147900131 23 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900115_1147900127 17 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900127 17:43778558-43778580 GGCTCCGTGCACCCCGCCACGGG 0: 1
1: 0
2: 2
3: 3
4: 113
1147900115_1147900130 22 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900115_1147900128 18 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900128 17:43778559-43778581 GCTCCGTGCACCCCGCCACGGGG 0: 1
1: 0
2: 1
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147900115 Original CRISPR GGTCCCAGCCGCCACCCGCT TGG (reversed) Intronic
900105414 1:978933-978955 GGTCCCAGGCCCCGCCCCCTCGG + Exonic
900574016 1:3374133-3374155 GGTCCCAGCCGCTGACCGCCAGG + Intronic
901019907 1:6250253-6250275 GGCCCCAACCGCCACCCCCATGG - Intronic
903781730 1:25824374-25824396 AGTCCCAGCTGCCTCCCTCTAGG + Intronic
912494865 1:110084755-110084777 GGTCGCAGCCGCCAGCCGTAGGG + Intergenic
913235275 1:116775537-116775559 GCTCTGAGCCGCCAGCCGCTGGG + Intergenic
915214177 1:154329025-154329047 GGGCCCAGGCGCCTCCCTCTTGG + Intronic
915938467 1:160103019-160103041 GCTCCCAGCACCCACCCGATGGG - Intergenic
922357525 1:224790451-224790473 GGTCCCAGGAGCCACCCCTTGGG - Intergenic
922775300 1:228211765-228211787 GGTCCCCGCCGCCACCCTCATGG + Exonic
924428889 1:243979560-243979582 GGCCCCACCCGCCACCCTCGTGG - Intergenic
1067831673 10:49614300-49614322 GGTCCCCGCGGCCACCCGACTGG - Exonic
1072797334 10:98366021-98366043 GAACCCACCCGCCACCCGCCTGG + Intergenic
1075745564 10:124724925-124724947 GCTCCCAGCCCCCAGCAGCTGGG - Intronic
1077007023 11:363218-363240 GGTCCCGGCCCCCACCGTCTGGG + Intergenic
1077499612 11:2903220-2903242 GGTCCCAGGCAGCACCCGCCTGG - Exonic
1078458413 11:11493877-11493899 GGTCTCTGCTGCCACACGCTGGG - Intronic
1081625463 11:44652723-44652745 GGACCCAGCAGCCACCTGCCGGG + Intergenic
1082280636 11:50267968-50267990 AGTCCCAGCCGCCCCTCGCGGGG + Intergenic
1084218439 11:67664052-67664074 GGGCCCCACCGCGACCCGCTGGG + Intronic
1084459133 11:69286525-69286547 GGTTCCAGCCGCCGCAGGCTGGG - Intergenic
1084491205 11:69479619-69479641 GGTCACAGCCTCCAGCCTCTTGG + Intergenic
1091662585 12:2395627-2395649 GGTTCCAGCAGCCAGCCACTTGG - Intronic
1095752250 12:45726960-45726982 GATCCCGGCCGCGACCCGCCAGG + Intergenic
1096078459 12:48818801-48818823 GCTCCCTGCCGCCGCCCGCAGGG + Exonic
1096116740 12:49059695-49059717 GATCACAGCCGCCCCCCGCACGG + Intronic
1097383250 12:58920267-58920289 GCTCCCAGCCGGCGCGCGCTCGG + Exonic
1098302879 12:69071879-69071901 AGTCCCAGCCCCCAGCCACTGGG + Intergenic
1103685603 12:122729935-122729957 GATGCCAGCCGCCACCCGGGTGG + Exonic
1107086379 13:36431746-36431768 CGTCCCAGCCGCCTCCCGGCAGG + Intergenic
1107694381 13:42986152-42986174 GGCCCCAGCTGCCACCCTTTTGG - Intronic
1108844466 13:54660493-54660515 GTTCCCATCTCCCACCCGCTTGG + Intergenic
1109284900 13:60397691-60397713 GGTCTGGGCCGCCACCCGCCCGG - Intronic
1112365448 13:98752252-98752274 CGCCCCTGCCGTCACCCGCTGGG + Intronic
1113916135 13:113875149-113875171 GGTCTCAGACGACACCTGCTTGG - Intergenic
1117424501 14:55580478-55580500 GGGCCCGGACGCCGCCCGCTGGG + Intronic
1121315137 14:92956890-92956912 GGTCCCAGCCCCTGCCCACTGGG - Intronic
1122771870 14:104101232-104101254 GGCCCCAGCAGCCACGCCCTGGG - Intronic
1122862193 14:104587693-104587715 GGTACCAGCGGCCTCCCGCCGGG + Intronic
1122916752 14:104862901-104862923 GATCCCACCTCCCACCCGCTGGG - Intergenic
1122995049 14:105258652-105258674 GGTGCCCGCCACCACCCCCTGGG - Intronic
1125532355 15:40421930-40421952 GGTCCCAGCTCCCACCCGGCAGG - Intronic
1127841508 15:62835892-62835914 GGTCGCAGCCGCCACCATCCGGG - Exonic
1128743138 15:70096881-70096903 TTTCCCGGCCGCCCCCCGCTCGG - Exonic
1129235913 15:74223631-74223653 ACTCCCAGCCCCCACCCTCTGGG + Intergenic
1129907221 15:79196847-79196869 GGCCCCAGCTGCCACAAGCTAGG - Intergenic
1131173104 15:90192178-90192200 GGTCCCACCCGCCCCCTCCTGGG - Intronic
1132006900 15:98235545-98235567 GGTCCCAGCCTCCCCTCTCTAGG + Intergenic
1141868939 16:86771322-86771344 GGACCCAGGTGCCTCCCGCTTGG + Intergenic
1141869183 16:86773000-86773022 AGTCCCTCCCGCCACCCTCTGGG - Intergenic
1142393243 16:89816319-89816341 GCCCCCAGCCGCCGCCCGCGGGG - Intronic
1144107272 17:11997389-11997411 GGTCCCGGCCTCCGGCCGCTCGG - Intronic
1144266213 17:13572370-13572392 GGTCCGAGCGGTCACCCCCTAGG - Intronic
1145263767 17:21369656-21369678 GGCCCCCGGCGCCACCCGCTTGG + Intergenic
1147742763 17:42678206-42678228 GGTCCCACACGCCAGCCACTGGG - Intergenic
1147793741 17:43028445-43028467 GGACACAGCCCCCACCTGCTTGG - Exonic
1147900115 17:43778518-43778540 GGTCCCAGCCGCCACCCGCTTGG - Intronic
1148848457 17:50542256-50542278 GATACCAGCCGCCACTGGCTCGG - Exonic
1150561578 17:66300028-66300050 GATCCCAGCCTCCAGCCTCTGGG + Intergenic
1152099064 17:78290566-78290588 GGCCCCAGCCCCCACTCCCTGGG - Intergenic
1152614383 17:81331131-81331153 GGGCCCAGCCCTCACCTGCTTGG + Intergenic
1152897186 17:82919206-82919228 GGTCCCAGCAGCCCCTCGCTGGG + Intronic
1156590598 18:38483448-38483470 GGTCTCAGCCACAACCCCCTGGG + Intergenic
1160526782 18:79543154-79543176 GGTCCCAGGAGGCACCCGCAGGG + Intergenic
1160790488 19:920651-920673 GGTCCCACCCGGCCCCCGCCAGG + Exonic
1160910074 19:1470144-1470166 GGTCGCAGCCACCACCGACTCGG + Exonic
1161234170 19:3189823-3189845 GATCCCAGCCCCCGCTCGCTCGG - Intronic
1162940659 19:14006992-14007014 GATCCCAGCTCCCACCCGCTGGG + Intronic
1164189521 19:22901656-22901678 GGCCCGCGCCGCCACCCCCTGGG - Intergenic
1166962958 19:46510324-46510346 GGTGCCAGCCCCCACCCTCTTGG - Intronic
929766426 2:44847746-44847768 TGTGCCAGCCACCACCCCCTTGG - Intergenic
932780210 2:74554636-74554658 GGCCCCCGCCGGCAGCCGCTGGG - Exonic
937905564 2:127051211-127051233 GGTCCCACCCGCCACCTCCGAGG + Exonic
938727280 2:134120115-134120137 CGTCCCTGCCGCGGCCCGCTCGG + Intronic
940901208 2:159128278-159128300 TGTCCCAGCAGACACCCTCTGGG - Intronic
941476574 2:165957210-165957232 GGCCTCAGCCGCCTCCCGCGCGG - Intergenic
945302545 2:208227837-208227859 GGCCTCAGCCGCCTCCCACTGGG - Intergenic
948436696 2:237958548-237958570 AGCCCCAGCCGCCATCCACTGGG + Intergenic
948752277 2:240139615-240139637 GGCACCAGCAGCCACCTGCTGGG + Intronic
948792238 2:240385096-240385118 GGTCTCAGCAGCCACCTGCTGGG - Intergenic
948866901 2:240780180-240780202 TTTCCCAGCAGCCACCCGCCTGG + Intronic
1168952291 20:1810741-1810763 GCCCCCAGCAGCCACCCTCTGGG + Intergenic
1170603802 20:17861073-17861095 GCTTCCAGCCGCCAGCCGGTAGG - Intergenic
1174353845 20:49985681-49985703 CCTCCCAGCCCCCACCCACTGGG - Intronic
1175905714 20:62378431-62378453 AGTCCCAGCCGCCTTCCTCTGGG + Intergenic
1175994194 20:62805061-62805083 GGTCCCCGGCGCCCCCCGCCCGG + Intronic
1176546684 21:8205386-8205408 GGCCCGAGCCGCGACCCGCGGGG + Intergenic
1176554579 21:8249576-8249598 GGCCCGAGCCGCGACCCGCGGGG + Intergenic
1176565635 21:8388433-8388455 GGCCCGAGCCGCGACCCGCGGGG + Intergenic
1176573500 21:8432601-8432623 GGCCCGAGCCGCGACCCGCGGGG + Intergenic
1178537216 21:33420333-33420355 GCTCCCAGCAGCCACCTCCTTGG + Intronic
1180309706 22:11159030-11159052 GATCCCAGCCGCCAGCCGTCAGG + Intergenic
1180548183 22:16520840-16520862 GATCCCAGCCGCCAGCCGTCAGG + Intergenic
1180874639 22:19169467-19169489 GGCCCAGGCCGCCCCCCGCTGGG + Intergenic
1181271774 22:21663030-21663052 GGTGCCTGCCTCCACCCTCTGGG - Intronic
1183509097 22:38224751-38224773 GGTCCTAGGCGACCCCCGCTGGG - Intronic
1184595981 22:45514574-45514596 GGTCACTGCCTCCACCCCCTGGG + Intronic
1185372579 22:50467892-50467914 GGACACAGCTGCCACCCGCTGGG + Exonic
1203251549 22_KI270733v1_random:121652-121674 GGCCCGAGCCGCGACCCGCGGGG + Intergenic
1203259599 22_KI270733v1_random:166734-166756 GGCCCGAGCCGCGACCCGCGGGG + Intergenic
953474963 3:43197352-43197374 AGTGCCAGCCTCCACCAGCTTGG - Intergenic
953847869 3:46443249-46443271 GGTGCCAGCCTCCACTCTCTGGG + Intronic
953886140 3:46715394-46715416 GGACTCAGCCTCCACCTGCTTGG + Intronic
954366876 3:50151068-50151090 TGGCCCAGCCCCCACCCACTAGG - Intergenic
961047592 3:123720233-123720255 GGTCCCAGCCCCCACAGGCCCGG + Intronic
961474903 3:127140446-127140468 GGCCCCTGCAGCCACCCCCTTGG - Intergenic
961547881 3:127648277-127648299 GGTCCCAGCAGACAGCTGCTCGG - Intronic
968684407 4:1947323-1947345 GGTCCTTGCTGCCACCTGCTTGG + Intronic
968912219 4:3482211-3482233 GGGAACAGCCGCCAGCCGCTAGG - Intronic
968982854 4:3860049-3860071 GGACCCAGCCTCCACGCTCTGGG - Intergenic
970035042 4:11723669-11723691 GGACCCAGCGGCAACCCGCTTGG - Intergenic
971043335 4:22778738-22778760 GGCCTCAGCCGCCTCCCGCCCGG - Intergenic
972630249 4:40836074-40836096 GGTCCCAGCACCCACCTGCTTGG - Intronic
976389286 4:84492984-84493006 GGTCCCAGCCGCGTCCCCATAGG - Exonic
978751161 4:112249216-112249238 GCTCACAACCTCCACCCGCTGGG - Intronic
982198550 4:152937852-152937874 CGGCTCAGCCGCCACCGGCTGGG - Intronic
983497630 4:168461113-168461135 AGTCCCAGCCACCAACCTCTGGG - Intronic
984703409 4:182832830-182832852 GGTCCCAGCCAGCAGCAGCTGGG - Intergenic
985112024 4:186555623-186555645 GGGCCCAGCCGCCGCGCCCTGGG + Intergenic
985995899 5:3596564-3596586 TGGCCCAGCCGTCACCCGCCCGG - Intronic
996287798 5:121815366-121815388 GGTCCTAGGAGCCACCAGCTGGG - Intergenic
1001035311 5:168292523-168292545 GGCCCCAGCCGGCACCTGCCCGG + Intronic
1001313100 5:170625112-170625134 GGTCCCAGCAGCAGCCCTCTGGG + Intronic
1002334676 5:178469605-178469627 GGTCCCAGCTGCCAGCTGCCCGG - Intronic
1006472197 6:34235548-34235570 GGGCCCAGCCCCCACCCGTGCGG - Intergenic
1006644853 6:35509117-35509139 GCTCCAAGCCCCCACCCTCTAGG + Intronic
1015366344 6:132401449-132401471 GGTACCGGCCTCCAGCCGCTGGG + Exonic
1016898404 6:149076539-149076561 TGTCCCAGCCAACACCCTCTAGG + Exonic
1019547240 7:1584400-1584422 GGTCCCAGCATCCAGCAGCTGGG - Intergenic
1023026642 7:36056670-36056692 GGTCCCAGCTGCAGCCCCCTGGG - Intergenic
1023955659 7:44885022-44885044 GGCGCCAGCCGCCAGCTGCTCGG + Exonic
1024576005 7:50764613-50764635 GAACCCAGCCTCCACCAGCTGGG + Intronic
1029187088 7:98747000-98747022 GGTCCCATCCGCTGCCAGCTGGG + Intergenic
1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG + Intergenic
1035714462 8:1743461-1743483 GGTGCCAGCCGCCCCCGGCGGGG + Intergenic
1049803033 8:144526990-144527012 GGGCCCGGCCGCCACCTGCACGG - Exonic
1050542354 9:6681382-6681404 GGTCACCGCCTCCACCCGCCTGG + Intergenic
1053481468 9:38419567-38419589 GGTCCCGGCCAGCACCCGCCAGG - Intronic
1057211971 9:93205400-93205422 AGTGCCAGCCTCCACCCACTGGG - Intronic
1061144366 9:128788497-128788519 GGCCCCAGCCCCCAGCAGCTGGG - Intronic
1061811470 9:133164641-133164663 GGTCCCACCCCCCACCCCTTGGG - Intergenic
1061935079 9:133853071-133853093 GATTCCAGCCGCCAGCCACTCGG + Intronic
1062029132 9:134354147-134354169 GGTCCCAGCAGGCACCAGCAGGG + Intronic
1062055641 9:134468524-134468546 GGTCCCAGCCTCCGCCTGCAGGG - Intergenic
1203467951 Un_GL000220v1:104803-104825 GGCCCGAGCCGCGACCCGCGGGG + Intergenic
1203475772 Un_GL000220v1:148775-148797 GGCCCGAGCCGCGACCCGCGGGG + Intergenic
1186626271 X:11297000-11297022 CGTCCCAGCAGCCTCCCGCCTGG + Intronic
1187273744 X:17801317-17801339 GGTCCCACCAGCCACCCTCTTGG - Exonic
1191184100 X:57592111-57592133 GGACTCGGCCGCCACCCGCGGGG - Exonic
1191213290 X:57910336-57910358 GGACTCGGCCGCCACCCGCGGGG + Exonic
1194268321 X:91780787-91780809 AGTCCCAGCCGCAACCCGGGCGG - Intronic
1200231328 X:154445179-154445201 GGCCCCAGCCCCAACCCACTTGG - Intronic
1200585521 Y:5001699-5001721 AGTCCCAGCCGCAACCCGGGCGG - Intronic