ID: 1147900121

View in Genome Browser
Species Human (GRCh38)
Location 17:43778539-43778561
Sequence AGCCCGGGTGGCGCCTGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 242}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147900121_1147900137 17 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900137 17:43778579-43778601 GGGAAGGGCCGCGCCCGGCCAGG 0: 1
1: 0
2: 10
3: 51
4: 511
1147900121_1147900126 -5 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900126 17:43778557-43778579 GGGCTCCGTGCACCCCGCCACGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147900121_1147900131 2 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900121_1147900127 -4 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900127 17:43778558-43778580 GGCTCCGTGCACCCCGCCACGGG 0: 1
1: 0
2: 2
3: 3
4: 113
1147900121_1147900136 12 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900136 17:43778574-43778596 CCACGGGGAAGGGCCGCGCCCGG 0: 1
1: 0
2: 8
3: 14
4: 184
1147900121_1147900128 -3 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900128 17:43778559-43778581 GCTCCGTGCACCCCGCCACGGGG 0: 1
1: 0
2: 1
3: 3
4: 70
1147900121_1147900130 1 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900121_1147900138 21 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900138 17:43778583-43778605 AGGGCCGCGCCCGGCCAGGCAGG 0: 1
1: 0
2: 2
3: 51
4: 399
1147900121_1147900139 22 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900139 17:43778584-43778606 GGGCCGCGCCCGGCCAGGCAGGG 0: 1
1: 0
2: 1
3: 45
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147900121 Original CRISPR AGCCCGGGTGGCGCCTGCCC GGG (reversed) Intronic
900142845 1:1145732-1145754 TGCCAGGGTGGGGCCTGCCAGGG + Intergenic
900205193 1:1428363-1428385 AGCCCGGCTGCCGCCACCCCTGG - Intergenic
900221422 1:1511523-1511545 CTCCGGGGCGGCGCCTGCCCGGG + Intergenic
900420005 1:2552070-2552092 AGCCCGGGTCACCCCAGCCCTGG - Intergenic
900424420 1:2569572-2569594 AGCCCGGGTCACCCCAGCCCTGG + Intergenic
900676927 1:3892921-3892943 AGCCAGGTTGGCCTCTGCCCAGG - Exonic
901271344 1:7954265-7954287 ATCCCGGGTGGCGCATGCTGCGG + Intergenic
901706071 1:11074123-11074145 AGCCAGTGTGTCGGCTGCCCTGG - Intronic
901751488 1:11412641-11412663 AGCCTGGGTGCCCCCTACCCAGG + Intergenic
902388281 1:16088462-16088484 CGCTGGGGTGGCGCCTCCCCTGG + Intergenic
903239158 1:21971100-21971122 AGCCGGGGTGATGCCTTCCCTGG + Intergenic
905881697 1:41468231-41468253 AGCCTGGGTGCTGCCTGCACGGG + Intergenic
906258353 1:44367702-44367724 AGCCAGGGTGGCTCCCACCCAGG + Intergenic
912492530 1:110070166-110070188 AGCCGGGTTGGCGCTGGCCCGGG - Intronic
914980454 1:152410359-152410381 AGTCTGGGTGGCACCTGCCTGGG + Exonic
915883914 1:159702738-159702760 AGCCAGGGTGGAGCCTGGGCAGG - Intergenic
916721764 1:167489755-167489777 AGCCCAGGAGGGGGCTGCCCTGG - Intronic
919465414 1:197918307-197918329 CGCCGGGGAGACGCCTGCCCCGG - Intronic
922726554 1:227925558-227925580 AGCCCTGCTGGAGCCTGGCCAGG + Intronic
1063407733 10:5813156-5813178 AGCCGGGGGTGCGCCCGCCCCGG + Intronic
1063665009 10:8055724-8055746 GGCCCGGGTGGTGCGTGTCCGGG - Exonic
1063759453 10:9056788-9056810 AGCCCAGCAGGCGCCAGCCCAGG - Intergenic
1064582712 10:16810460-16810482 AGCCCGGGGGGCGGCTGCTGGGG - Intronic
1066416159 10:35223661-35223683 TGCCCTGGTGGCACCTCCCCTGG - Intergenic
1070439526 10:76429777-76429799 AAGCTGGGTGGCCCCTGCCCAGG - Intronic
1070535921 10:77377170-77377192 AGCCCGGGAGGAAGCTGCCCTGG - Intronic
1070550590 10:77488086-77488108 AGGCCAGGTGGAGCCAGCCCTGG + Intronic
1070725336 10:78783881-78783903 AGGCCAGGTGGGGCCTGCTCAGG - Intergenic
1070768847 10:79070753-79070775 AGCCCCGGCTGCGCCTGCCCGGG + Intronic
1073314471 10:102569242-102569264 AGGCAGGGTGGCCCCTGCCGCGG + Intronic
1075737348 10:124672200-124672222 AGCACGGCTGGTGCCTGACCGGG - Intronic
1075825848 10:125356557-125356579 AGCCATGGGGACGCCTGCCCAGG - Intergenic
1075864255 10:125704254-125704276 AGCCAGAGAGGTGCCTGCCCTGG + Intergenic
1077051563 11:568983-569005 GACCCGGGTGGGGCCTGCGCGGG + Intergenic
1077069605 11:662533-662555 AGCCTGGGGGGCGCCTGGGCTGG - Intronic
1077124025 11:924684-924706 AGCCCTGGTGGAGCCCGGCCAGG - Intergenic
1077341452 11:2028164-2028186 TGCCTGGCTGGCGCCTGTCCGGG - Intergenic
1077385844 11:2269176-2269198 GGCCCGGGCGGGGTCTGCCCCGG - Intronic
1078334080 11:10450582-10450604 AGCCCGGCTGGCATCTGCTCCGG + Intronic
1078900527 11:15638364-15638386 AGCCCTGGTGCACCCTGCCCAGG + Intergenic
1083583382 11:63839328-63839350 AGCCCGAGCGGCGCATCCCCGGG + Exonic
1083997220 11:66278415-66278437 GGCCCGGGGGGCGCCAGCGCGGG - Exonic
1084659045 11:70536430-70536452 AGCCTGGGTGGGGACAGCCCTGG - Intronic
1085941174 11:81207931-81207953 AGCACGGGTGGCGCTTGTCAGGG - Intergenic
1088764759 11:112963577-112963599 AACCGGGGTGGCCCCCGCCCAGG - Intronic
1088976637 11:114821984-114822006 AGCCCTGGTGGAGACTGGCCGGG - Intergenic
1089619886 11:119716108-119716130 AGCACAGGAGGCACCTGCCCAGG + Intronic
1089622033 11:119727858-119727880 AGGCCGGGAGGAGGCTGCCCCGG + Intronic
1091321520 11:134655598-134655620 AGCCCCGGTGGCACCTGACCAGG - Intergenic
1092160442 12:6312659-6312681 AGCCTGGGAGGCGCCAGCTCTGG - Intronic
1092194573 12:6541495-6541517 AGACCGGTAGGCGCCTCCCCTGG - Exonic
1102505981 12:113384891-113384913 ATCCCGGGTGGGCCCAGCCCCGG + Exonic
1103698570 12:122835730-122835752 GGCCCGGGAGGCGCCGGCCAGGG + Intronic
1105337423 13:19486869-19486891 GGCCTGGGTGGTGCCTGCCAGGG + Intronic
1107605023 13:42048598-42048620 TGCCTGGAGGGCGCCTGCCCCGG + Intronic
1108632700 13:52302272-52302294 GGCCTGGGTGGTGCCTGCCAGGG + Intergenic
1108653998 13:52510325-52510347 GGCCTGGGTGGTGCCTGCCAGGG - Intergenic
1113485860 13:110651991-110652013 AGCCCGAGTGGCTCCTTGCCTGG + Intronic
1113625484 13:111793170-111793192 AGCCCGGGCAGGACCTGCCCTGG - Intergenic
1113748375 13:112761896-112761918 AGCAGGGGTGGGGCCTCCCCAGG + Intronic
1113836499 13:113331462-113331484 CACCCGGGTGGCTCCTGCACTGG - Intronic
1113872220 13:113566255-113566277 AGCCCCGCTGTCGCCCGCCCCGG - Intergenic
1117548427 14:56811485-56811507 GGCTCGGGCGGCGCCAGCCCAGG - Intergenic
1122108631 14:99480399-99480421 AGACCGGGTGGCGCGGGGCCCGG + Intronic
1122152301 14:99731710-99731732 ATCCCGTTTGGAGCCTGCCCTGG + Intergenic
1122282720 14:100633571-100633593 AGCCGGGGAGGCGCCTGCCCGGG - Intergenic
1122297646 14:100714311-100714333 AGCCGTGGTGGCTCCTCCCCAGG + Intergenic
1122878822 14:104680808-104680830 AGCCCGGGAGCCACCTCCCCGGG + Intergenic
1122886510 14:104712770-104712792 ACCCCGGGTGGTGCCCGCGCGGG + Intronic
1123035436 14:105469986-105470008 AGACCAGGTGGGGCCTTCCCAGG + Exonic
1127880921 15:63157756-63157778 TTCCGGGGTGGCGCCGGCCCCGG - Exonic
1128154492 15:65384223-65384245 AGCCAGGCTGCCCCCTGCCCTGG + Exonic
1131080037 15:89527078-89527100 AGCCAGGTTGCCACCTGCCCTGG + Intergenic
1132477534 16:148740-148762 AGCGTGGGTGGCACCTACCCTGG + Intergenic
1132592697 16:733215-733237 GGCACAGGTGGCGACTGCCCAGG - Intronic
1132665718 16:1080548-1080570 AGCCAGGGTCACGCCTGTCCTGG + Intergenic
1132849953 16:2020448-2020470 TGCCAGGGTCGAGCCTGCCCAGG - Intronic
1132856184 16:2045895-2045917 AGCCCAGGTCACGCCTGCACTGG + Intronic
1132941945 16:2512909-2512931 AGGCCTGGTGGCAGCTGCCCAGG + Intronic
1134521037 16:14919356-14919378 TGCCAGGGTGGCCCCGGCCCAGG - Intronic
1134708713 16:16318007-16318029 TGCCAGGGTGGCCCCGGCCCAGG - Intergenic
1134950892 16:18350638-18350660 TGCCAGGGTGGCCCCGGCCCAGG + Intergenic
1135607374 16:23836134-23836156 AGCCCGAGAGGTGCCGGCCCCGG - Exonic
1137787672 16:51151688-51151710 AGAGCGGGGGGCGCCTGCCGGGG - Intergenic
1138352563 16:56353704-56353726 AGCCCGTGTGGACCCTGCCCAGG - Intronic
1138515358 16:57533060-57533082 GACCTGGGTGGTGCCTGCCCTGG - Intronic
1141609124 16:85171213-85171235 AGGCCTGGTGGTACCTGCCCAGG - Intergenic
1142006102 16:87690251-87690273 AGCAAGGGCGGCGCCTGCCGGGG + Exonic
1142275521 16:89116754-89116776 AGTGCTGGTGGCCCCTGCCCTGG + Intronic
1142348490 16:89569314-89569336 AGCCCATGAGGCACCTGCCCAGG - Intergenic
1143095412 17:4476128-4476150 AGCCCTGGTGGCCGCTGCCCCGG + Intronic
1143401901 17:6651675-6651697 AGCGCGGGTGGAGCCATCCCAGG - Intergenic
1143729731 17:8874299-8874321 AGCCAGCCTGGTGCCTGCCCTGG - Intergenic
1144663258 17:17085201-17085223 AGCCCGGGAGGTGCCTACACAGG - Intronic
1145250443 17:21294228-21294250 AGCCCTTGTGGCTCCTTCCCTGG + Intronic
1145976251 17:28986021-28986043 ATCCCTGGTGGAGACTGCCCAGG + Intronic
1146498355 17:33343168-33343190 AGCCCAGATGGGTCCTGCCCAGG + Intronic
1147335199 17:39723481-39723503 AGCCCGCGTGGGGTCTGCACCGG + Intronic
1147900121 17:43778539-43778561 AGCCCGGGTGGCGCCTGCCCGGG - Intronic
1148147261 17:45373692-45373714 AGGCCTGGTGGCCCCAGCCCAGG - Intergenic
1149996719 17:61409640-61409662 AGGCCGGGCGGCGCCGGCGCGGG + Intergenic
1151579926 17:74972130-74972152 AGCCTGGCTGGCGTCCGCCCGGG - Intronic
1151679006 17:75614199-75614221 AGGCCTGGAGGCGCCTCCCCGGG + Intergenic
1151828589 17:76537210-76537232 AGCCTGGGTTGAGCCTTCCCTGG - Intronic
1151852346 17:76698380-76698402 AGCCCAGCTGGCGCCAGCTCCGG + Intronic
1152392799 17:80012789-80012811 AGCCTGGCTGTGGCCTGCCCCGG - Intronic
1153880710 18:9419531-9419553 AGCCCACCTGGCCCCTGCCCTGG + Intergenic
1153947901 18:10032872-10032894 AGGCCGGGCCGCGCCTGTCCAGG + Intergenic
1157616240 18:48989278-48989300 AGCTAGGGTGGCACCTGCCCTGG - Intergenic
1158653553 18:59308614-59308636 AGCCCGGGTTCCGCCTCCCGCGG + Intronic
1158931099 18:62325492-62325514 AGCCAGGATGCCGCCGGCCCCGG - Intronic
1159770477 18:72542129-72542151 AGCCCGAGTGGCCCCCGGCCGGG + Exonic
1160453755 18:78981253-78981275 AGCCCGGGCGCCGCCGGCCGAGG - Intronic
1160747792 19:720030-720052 CGTCCGGGGGGCGCCCGCCCAGG - Intronic
1160797528 19:952876-952898 TGCCCAGGTGGGGCCTGCCTGGG + Intronic
1160943733 19:1631723-1631745 AGCCCGGCTGACCCCTCCCCGGG + Intronic
1160980623 19:1815080-1815102 AGCCCTGGGGGAGCCAGCCCTGG + Intergenic
1161039317 19:2101585-2101607 AGCCTGGCTGGCGCGTGGCCTGG + Exonic
1161221944 19:3121955-3121977 AGCCCCCGTGGCTCCAGCCCGGG - Exonic
1161399242 19:4060143-4060165 AGCCCAGGAGGGGCCTGCCAGGG - Intronic
1162020228 19:7864853-7864875 AGCCCCGTGGGTGCCTGCCCCGG - Intronic
1163415434 19:17183598-17183620 AGTCCGGGTGCCGCCAACCCAGG + Intronic
1163557583 19:18001360-18001382 GGCCCGGGCGGCGCCTACCGCGG + Intronic
1164431710 19:28194466-28194488 AGCCTGGGTGGAGGCTGCCTGGG + Intergenic
1167143888 19:47670947-47670969 AGCCCGGGAGGCACCTCCCCGGG + Intronic
1167613276 19:50517498-50517520 AGCCCGGGCGCAGCCTGACCGGG - Exonic
925023978 2:593728-593750 AGCCCTGGTGGCGTCTCCCTGGG - Intergenic
925203921 2:1990849-1990871 AGCAAGGCTGGCGCATGCCCTGG + Intronic
925431847 2:3801639-3801661 GGCCTGGGTGGCCCCTGGCCCGG + Intronic
927501137 2:23584146-23584168 AGGCCGGCTGGAGCCTGCCTGGG - Intronic
930034135 2:47075065-47075087 AGCTCGGGTGAGGGCTGCCCTGG + Exonic
932475318 2:72002421-72002443 AGCCAGCGTGGCCCCTCCCCGGG + Intergenic
934949138 2:98564475-98564497 AGCCCAGGTGGGGCATGCCCTGG - Intronic
935265104 2:101387176-101387198 GGCCCGGGCGGCGCCCGCCCGGG + Exonic
936086373 2:109472298-109472320 GGCCCGGGAGGCCCCTGGCCGGG - Intronic
938047893 2:128139688-128139710 ATCCCGGGTGGCACCTGCTGTGG + Intronic
940333499 2:152500968-152500990 AAGCCGAGTGGCGCCTGCCTCGG - Intronic
941249804 2:163147859-163147881 ATCCCTGGTGGCACCTGCCAAGG + Intergenic
942504452 2:176626853-176626875 GGCCAGGATGGAGCCTGCCCTGG + Intergenic
943658549 2:190534395-190534417 AGGGCGGGCGGGGCCTGCCCGGG + Intronic
946191414 2:218009907-218009929 AACCTGGGTGGCGACTCCCCCGG + Intergenic
948213799 2:236214325-236214347 AGCCCGGCTGGCACGTGCCCTGG - Intronic
948254508 2:236556253-236556275 AGCCAGGGTGGCGCTTGCCACGG + Intergenic
948257343 2:236577857-236577879 AGCTCGGCTGGCGCCTGGCTTGG - Intronic
948457778 2:238114880-238114902 AGCCCGGGGGCCGCCGGCTCTGG - Intronic
948541557 2:238694709-238694731 AGACCTGGTGGAGGCTGCCCGGG + Intergenic
948567382 2:238895731-238895753 AGCCCCGGTAGAGCCCGCCCTGG + Intronic
948729017 2:239951897-239951919 GGCCCTGCTGACGCCTGCCCAGG + Intronic
948749565 2:240123977-240123999 GGCCCTGGTGGCGCCTGCAGAGG - Intergenic
948981558 2:241497297-241497319 AACCAGGGCGGCACCTGCCCGGG + Intronic
1168819809 20:765297-765319 CGCCCTGGTGGCTCTTGCCCAGG - Exonic
1169088136 20:2840046-2840068 AGCCATGGTGGCGCCAGCCTTGG + Intronic
1170568111 20:17617941-17617963 AGGCTGGGTGGAGCCTGCCAAGG + Intronic
1171444785 20:25195760-25195782 GGCCGGGGTGGCGCCGGCCGGGG + Exonic
1171473361 20:25389980-25390002 AGCCCGAGGGGCGCCCGCCCGGG + Intronic
1171770617 20:29319908-29319930 AGCAGGCCTGGCGCCTGCCCGGG - Intergenic
1171968329 20:31547405-31547427 AGGCCGCGTGGCGCCCGCGCCGG + Intronic
1172389859 20:34559162-34559184 AGGCCGGGTCGGGCCGGCCCAGG - Intronic
1172838721 20:37889114-37889136 TGCCCGGCTGGCTCCTGCTCTGG + Intergenic
1173595936 20:44258381-44258403 AGCCAGAGGGGCACCTGCCCCGG - Intronic
1174199099 20:48794570-48794592 AGCCAGGCTGGAGCCTGCCAGGG + Intronic
1174452020 20:50626280-50626302 AGGCCAGGTGGGGGCTGCCCAGG + Intronic
1175429023 20:58889837-58889859 AGCTCGGCTCGCGCCTGGCCCGG - Intronic
1175965047 20:62656204-62656226 ATCCAGGGTGGCGTCTGGCCAGG - Intronic
1176055152 20:63141367-63141389 TGTGCGGGGGGCGCCTGCCCTGG - Intergenic
1176222968 20:63978882-63978904 AGCCCGCACGGCACCTGCCCCGG + Intronic
1176736147 21:10548507-10548529 GGCCTGGGTGGTGCCTGCCAGGG - Intronic
1179466813 21:41581376-41581398 AGGCTGGGTGACGTCTGCCCCGG + Intergenic
1179531682 21:42023755-42023777 AGCACGGCTGGTGCCTGCCAAGG - Intergenic
1179723131 21:43326729-43326751 AGCCCGGGGAGCCACTGCCCGGG + Intergenic
1179968305 21:44818969-44818991 TGCCCGGGTGGTGCCAGCCGGGG + Intergenic
1180042802 21:45288513-45288535 AGCCCGGGTGCCCCCTCGCCGGG - Intergenic
1183533001 22:38374348-38374370 GGCCTGGGTGGTGCCTGCCAGGG + Intronic
1184659612 22:45959881-45959903 AACCCAGCTGGAGCCTGCCCGGG + Intronic
1184998008 22:48224600-48224622 AGCCAAGGTGGCTGCTGCCCTGG - Intergenic
1185038019 22:48489766-48489788 GGCCCGCGGGGCGCCTGCCGGGG - Intronic
950518063 3:13480267-13480289 GGCGCGGGTGGGGCCAGCCCAGG - Exonic
951981774 3:28575176-28575198 CGCCCAGCTGGCGCCCGCCCCGG + Intergenic
954277914 3:49554541-49554563 CGCCCGGGAGCCGCCGGCCCGGG + Exonic
954677122 3:52322199-52322221 AGATGGGGTGGGGCCTGCCCTGG - Intronic
956442323 3:69292568-69292590 AGCCCTGGTGCCTCCTGCCTAGG + Intronic
957646750 3:82939905-82939927 AGCCCAGGAGCCGCCCGCCCAGG + Intergenic
960121051 3:113948531-113948553 TGCCCAGACGGCGCCTGCCCAGG + Intronic
960955426 3:123027607-123027629 GGCCCGGGTGGGGACTGCACCGG - Intronic
961602486 3:128072342-128072364 AGCCCTGGTCAGGCCTGCCCTGG - Intronic
961754852 3:129121666-129121688 ACCCCGGCTGGCTCCCGCCCCGG + Exonic
964472543 3:157070237-157070259 TTCCCGGGTGGGCCCTGCCCTGG - Intergenic
968610997 4:1556895-1556917 GGCCTGGGTGCCGCCCGCCCCGG - Intergenic
968682486 4:1930733-1930755 TGCCCTGGTGGCCCCTGTCCAGG + Exonic
968775487 4:2537135-2537157 AGCGCGGGCGGCGCCGCCCCCGG + Intronic
968914642 4:3492137-3492159 AGCACGGGAGGGGCCTGGCCTGG + Intronic
968977636 4:3830303-3830325 AGCAAGGGTGGCACGTGCCCCGG + Intergenic
979474260 4:121136098-121136120 AGCCCTGGTGGAACCTGACCAGG - Intronic
981427687 4:144622413-144622435 AGGCAGGGTGGCGCCAGCCAGGG + Intergenic
984067113 4:175062313-175062335 AGCCCTAGTGTCTCCTGCCCTGG - Intergenic
984167596 4:176320574-176320596 CGCGCGGGAGGCGCCAGCCCAGG - Intronic
985592682 5:773720-773742 AGCCCAAGTGGGGCCTGGCCAGG + Intergenic
985619067 5:944206-944228 CGCCCGGGTGACACCTTCCCAGG - Intergenic
986750164 5:10779891-10779913 AGCCTGGGAGCCACCTGCCCAGG + Intergenic
986786821 5:11122611-11122633 AGCTCAGGGAGCGCCTGCCCAGG - Intronic
987707093 5:21471394-21471416 AGCCGGGGTGGGGGCTGCCTAGG + Intergenic
989523113 5:42423862-42423884 GGCCCGCGTGGCCCCAGCCCGGG - Intronic
992530488 5:77647386-77647408 AGCCAGAGTGCCGACTGCCCAGG - Intergenic
995764693 5:115602409-115602431 GTCCCGGGTGGGGCCTGCCACGG - Exonic
997206520 5:132053544-132053566 AGCCCAGGTGGCAGCTTCCCTGG + Intergenic
997248202 5:132369637-132369659 GGCCCGGGCGGGGCCTGTCCTGG - Intergenic
1002006465 5:176238551-176238573 AGCTCCGGGGGCGCCCGCCCGGG + Exonic
1002219912 5:177672085-177672107 AGCTCCGGGGGCGCCCGCCCGGG - Intergenic
1002259506 5:177983956-177983978 ACTCCGGGTGGCACATGCCCTGG - Intergenic
1002501346 5:179649549-179649571 ACCCCTGGGGGCGGCTGCCCTGG + Intergenic
1003062888 6:2876217-2876239 AGCCCGGGGGGTGCCGGCCTAGG + Intergenic
1006742501 6:36319592-36319614 AGCTGGGGTGGCGCCTGATCTGG + Exonic
1011127554 6:84023138-84023160 AGCCCTGGTAGCACCTGCTCTGG - Intergenic
1011494499 6:87925144-87925166 ATCCCGGCTGGTGCCTGCCTCGG - Intergenic
1015654146 6:135497881-135497903 GGGCCGTGCGGCGCCTGCCCGGG + Intergenic
1018911948 6:168106364-168106386 AGCAAGGGTGCCGCCTGCCTGGG - Intergenic
1019342004 7:512788-512810 AGCCCAGGTGAGGGCTGCCCCGG + Intronic
1019425736 7:975692-975714 AGCCCCGGTGGGCGCTGCCCGGG + Intergenic
1019503753 7:1380257-1380279 AGTTCGGGTGGTCCCTGCCCAGG + Intergenic
1019508187 7:1403901-1403923 GAGCCGGGTGGCGCCTGGCCCGG + Intergenic
1019718739 7:2555364-2555386 AGCCCAGGTCGCGCACGCCCCGG + Intronic
1019811021 7:3165136-3165158 AGCCCTGGCAGCACCTGCCCAGG - Intronic
1021717045 7:23469907-23469929 AGCCCGGGTGGGGCCAGGCCCGG + Intronic
1023054699 7:36282431-36282453 ATCCCGGCTGGAGCCTGACCTGG + Intronic
1023847423 7:44130347-44130369 AGCCGGGGTGGTGCCAGGCCAGG + Intergenic
1023937268 7:44748878-44748900 GGCGCGGGTGGCGGCGGCCCCGG + Intronic
1024247220 7:47479574-47479596 AGCCAGGCAGGCGCCCGCCCCGG + Intronic
1026807357 7:73436555-73436577 TGCCCTGGTGGGGGCTGCCCTGG - Intergenic
1029285888 7:99465914-99465936 AACCCGGTTGGCGCAGGCCCTGG + Intronic
1031629950 7:124033323-124033345 AGCCCCGGCGCCGCCTCCCCTGG - Intergenic
1035388272 7:158488959-158488981 GGCCCGGGTGGCGTCTGCCCTGG + Intronic
1037819759 8:22130010-22130032 AGCGGCGGTGGCGGCTGCCCTGG - Intronic
1039898295 8:41731843-41731865 TGCCGGAGCGGCGCCTGCCCTGG - Intronic
1040322964 8:46327757-46327779 AGCCTCCGTGGTGCCTGCCCAGG - Intergenic
1040843455 8:51809282-51809304 TGGCCGGGTGGTGCCTGCCAGGG - Exonic
1041355314 8:56993668-56993690 AGCCCGCGCGGCGCCTGGCCCGG - Exonic
1045498818 8:102729680-102729702 AGCCAGGGTGGGGCCTCCCAGGG + Intergenic
1049274493 8:141713009-141713031 AGCCAGGGTGCTGACTGCCCCGG + Intergenic
1049287095 8:141781767-141781789 AGCCGGCATGGCTCCTGCCCTGG + Intergenic
1049519599 8:143081123-143081145 AGCCCGGGCCGCGCCTTACCTGG - Exonic
1049573974 8:143382100-143382122 AGCACAGGTGGCCCCTGCCCAGG - Intronic
1049657744 8:143806213-143806235 AGCCCAGGTGGCACTTGCCCAGG + Intronic
1055486690 9:76763166-76763188 AGCCCAGGTGCTGCCTGCACTGG + Intronic
1061012873 9:127965778-127965800 CGCCTGGGAGGAGCCTGCCCTGG + Intronic
1061450771 9:130665961-130665983 AGCCCGGGCGCCGCCCTCCCTGG + Intronic
1061858403 9:133455556-133455578 AGCCTCGGCGGCTCCTGCCCGGG + Exonic
1061904774 9:133690989-133691011 AGCCTGGCTGGGGCCTGCCTGGG - Intronic
1062239101 9:135526340-135526362 AGCCAAGGTGTCCCCTGCCCTGG - Exonic
1062389591 9:136328582-136328604 ATCCCGGGGGGCGCCTAGCCTGG + Intronic
1062482095 9:136757239-136757261 AGCCCAGCAGGCCCCTGCCCGGG - Intronic
1062520518 9:136955825-136955847 AGCCGGGCTGGAGCTTGCCCCGG + Intronic
1062550960 9:137086379-137086401 AGCCCGGGTGCCGCCCGGCCTGG + Intergenic
1062610586 9:137371676-137371698 AGCCCCGGGGGTGCCTGGCCTGG - Intronic
1187688465 X:21839881-21839903 AGCCCGGGAGGCGCCAGGCAGGG - Intronic
1187950481 X:24465592-24465614 AGCCCGAATGGCGGCGGCCCCGG - Intronic
1190234353 X:48604440-48604462 AGCCAGGTTGGCACCAGCCCTGG - Intronic
1190279353 X:48919028-48919050 CTCCCGGGAGGCGCGTGCCCAGG - Intergenic
1196645886 X:118116909-118116931 GGCCCCGGCGGCGCCTGCGCGGG + Intronic
1200134703 X:153869247-153869269 AGCCCAGGTGGCACCTCTCCTGG - Intronic
1200310261 X:155071089-155071111 TACTCGGGAGGCGCCTGCCCAGG + Exonic
1202594438 Y:26521673-26521695 GGCCTGGGTGGTGCCTGCCAGGG - Intergenic