ID: 1147900122

View in Genome Browser
Species Human (GRCh38)
Location 17:43778540-43778562
Sequence GAGCCCGGGTGGCGCCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 232}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147900122_1147900136 11 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900136 17:43778574-43778596 CCACGGGGAAGGGCCGCGCCCGG 0: 1
1: 0
2: 8
3: 14
4: 184
1147900122_1147900127 -5 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900127 17:43778558-43778580 GGCTCCGTGCACCCCGCCACGGG 0: 1
1: 0
2: 2
3: 3
4: 113
1147900122_1147900128 -4 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900128 17:43778559-43778581 GCTCCGTGCACCCCGCCACGGGG 0: 1
1: 0
2: 1
3: 3
4: 70
1147900122_1147900130 0 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900122_1147900137 16 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900137 17:43778579-43778601 GGGAAGGGCCGCGCCCGGCCAGG 0: 1
1: 0
2: 10
3: 51
4: 511
1147900122_1147900139 21 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900139 17:43778584-43778606 GGGCCGCGCCCGGCCAGGCAGGG 0: 1
1: 0
2: 1
3: 45
4: 526
1147900122_1147900131 1 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900122_1147900138 20 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900138 17:43778583-43778605 AGGGCCGCGCCCGGCCAGGCAGG 0: 1
1: 0
2: 2
3: 51
4: 399
1147900122_1147900126 -6 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900126 17:43778557-43778579 GGGCTCCGTGCACCCCGCCACGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147900122 Original CRISPR GAGCCCGGGTGGCGCCTGCC CGG (reversed) Intronic
900142844 1:1145731-1145753 GTGCCAGGGTGGGGCCTGCCAGG + Intergenic
900221421 1:1511522-1511544 GCTCCGGGGCGGCGCCTGCCCGG + Intergenic
900589739 1:3454375-3454397 CGGCCCGGGAGTCGCCTGCCAGG - Intergenic
900794868 1:4701842-4701864 GATGCAGGGTGGCACCTGCCAGG + Intronic
900970755 1:5991614-5991636 GGGAGCGGGTGGCGCCTTCCGGG + Intronic
901529225 1:9843142-9843164 GAGTCCGGGCTGCGCCTCCCAGG + Intergenic
902329702 1:15725267-15725289 GACCCCGGGGGGTGCCTGACAGG + Intronic
902711584 1:18243634-18243656 CAGACCGGGTGGTGCCTCCCGGG - Intronic
904006619 1:27366421-27366443 GAGCCCGGGCTGCGGCTCCCGGG + Exonic
905182626 1:36176359-36176381 GCGCCAGGCTGGCCCCTGCCCGG - Exonic
905912213 1:41662578-41662600 GGGCGCGGCTGGCGGCTGCCAGG + Intronic
910127542 1:83860685-83860707 GAGCCCGAGTGGGCCCTGGCGGG - Intergenic
910200131 1:84690508-84690530 GAGGCCGGGAGGCGGCTGCAAGG - Exonic
914980453 1:152410358-152410380 CAGTCTGGGTGGCACCTGCCTGG + Exonic
915292389 1:154895214-154895236 GATCCAAGGTGGCCCCTGCCTGG + Intergenic
916721649 1:167488900-167488922 GAGCCCAGGGAGGGCCTGCCAGG + Intronic
923086322 1:230705914-230705936 GAGACCGGGAGGCTCCTACCGGG + Exonic
923506544 1:234609992-234610014 GCGCCGGGGTGGCGGCGGCCGGG + Intergenic
1062925382 10:1312355-1312377 GAGCCAGCCTGGGGCCTGCCGGG - Intronic
1064582713 10:16810461-16810483 TAGCCCGGGGGGCGGCTGCTGGG - Intronic
1066063809 10:31748063-31748085 GAGCCGGGATCGCGCCAGCCTGG - Intergenic
1069544399 10:69318515-69318537 GTGCCCGGGTGGGCCGTGCCAGG - Intronic
1070768846 10:79070752-79070774 GAGCCCCGGCTGCGCCTGCCCGG + Intronic
1073110632 10:101061342-101061364 GAGGCGGGCTGGCGCCTCCCCGG - Intergenic
1073510951 10:104042057-104042079 GAGCCCAGGTGGAGACTGCCGGG - Intronic
1074976018 10:118582262-118582284 GAGCCCGGGTGTGGCCAACCCGG - Intergenic
1076668187 10:132104698-132104720 CAGCCCGGGTGACACCTGCTGGG + Exonic
1076720662 10:132391220-132391242 CAGACCGGGAGGCCCCTGCCTGG - Intergenic
1077230489 11:1456293-1456315 GGGCCAGGGTGGGACCTGCCAGG + Intronic
1077341453 11:2028165-2028187 GTGCCTGGCTGGCGCCTGTCCGG - Intergenic
1078143514 11:8708081-8708103 GAGCCTGTGTGGAGCCTGGCAGG - Intronic
1083613722 11:64016339-64016361 GGGCCTGGGCGGCACCTGCCTGG - Intronic
1084091449 11:66881684-66881706 GAGCCACAGTGGCCCCTGCCTGG - Intronic
1084480322 11:69416122-69416144 GATCCTGTGTGGCCCCTGCCAGG - Intergenic
1085396435 11:76209254-76209276 GGGCCCGGGAGGCGGCCGCCTGG + Intronic
1085519636 11:77130509-77130531 GAGCCCAGGTGACCCCAGCCAGG + Intronic
1085941175 11:81207932-81207954 TAGCACGGGTGGCGCTTGTCAGG - Intergenic
1090256234 11:125286612-125286634 CAGGCCTGGTGTCGCCTGCCGGG + Intronic
1090327764 11:125904151-125904173 GAGTCCGGGGGGCTCCCGCCTGG + Intronic
1092406874 12:8227592-8227614 GGGCCCGGATGGGGCCTGACTGG + Exonic
1094652426 12:32390966-32390988 GCGACCGGCTGGCGCCTGCTGGG - Intergenic
1096253792 12:50050925-50050947 GGCCCCGGGTGGGGCCGGCCAGG + Intergenic
1098973439 12:76878822-76878844 GAGACCGGGGCGCGCCGGCCGGG + Intronic
1102259788 12:111436985-111437007 GAGCTGGGGTGCCACCTGCCTGG + Intronic
1103698569 12:122835729-122835751 GGGCCCGGGAGGCGCCGGCCAGG + Intronic
1104839036 12:131811761-131811783 GAGGCCGGGTGGTGCCCGGCTGG - Intergenic
1105337422 13:19486868-19486890 TGGCCTGGGTGGTGCCTGCCAGG + Intronic
1106144857 13:27041300-27041322 GAGCCAGGGGGCAGCCTGCCTGG - Intergenic
1108632699 13:52302271-52302293 TGGCCTGGGTGGTGCCTGCCAGG + Intergenic
1108653999 13:52510326-52510348 TGGCCTGGGTGGTGCCTGCCAGG - Intergenic
1113682289 13:112252990-112253012 GACCCCGGGTTGTGACTGCCCGG + Intergenic
1113981824 13:114282399-114282421 AAGCCCGGGAGGCGCCGGGCGGG - Intronic
1114259104 14:21024974-21024996 CGGCCCGGCTGGCGCCTTCCAGG + Intronic
1115907101 14:38211726-38211748 GCTCCCGAGTGGGGCCTGCCTGG + Exonic
1118935526 14:70284519-70284541 GAGCCTGGGTGGCGGCCACCAGG - Intergenic
1121258417 14:92548985-92549007 GAGCCCTGGTGATGCCAGCCAGG - Intronic
1121570132 14:94940975-94940997 GAGCACTGGGTGCGCCTGCCGGG - Intergenic
1122282721 14:100633572-100633594 CAGCCGGGGAGGCGCCTGCCCGG - Intergenic
1122878821 14:104680807-104680829 GAGCCCGGGAGCCACCTCCCCGG + Intergenic
1124270692 15:28277854-28277876 GAGCCAGGGTGGGGCAAGCCTGG - Intronic
1125685171 15:41559445-41559467 GAGCCCGGGGCGGGCCTGGCGGG + Intronic
1128115500 15:65102410-65102432 GAGCCCGGTTGGAGGCTGCTGGG + Exonic
1128453367 15:67819888-67819910 GAGGCTGGGCGGGGCCTGCCGGG - Intronic
1130967076 15:88705495-88705517 GAGCCCGGGCGGCGCGCGGCGGG - Intergenic
1131827411 15:96332173-96332195 GGGCACGGGCGGCGCCTGCGAGG - Exonic
1132393237 15:101454001-101454023 GAGCCCGTCTGGCTCCTGCCAGG + Intronic
1132590378 16:723876-723898 GAGACCCGGTGGAGCCTCCCAGG - Exonic
1132889325 16:2196286-2196308 GAGCCCCGGGGGCCCCTCCCCGG - Intronic
1132974859 16:2706155-2706177 GAGCCTGGGGGGCACCCGCCTGG + Intronic
1132997036 16:2828828-2828850 GAGCCCGGGTGGTGGATCCCTGG - Intergenic
1133347543 16:5080802-5080824 GGGCCCGGATGGGGCCTGACTGG + Intronic
1136024408 16:27460789-27460811 CAGCCCAGCTGGGGCCTGCCAGG + Exonic
1136129630 16:28211700-28211722 GAGGCCGGGGAGCCCCTGCCTGG - Exonic
1136544271 16:30947154-30947176 GTGCCCGGCTGGCAGCTGCCGGG + Exonic
1137787673 16:51151689-51151711 GAGAGCGGGGGGCGCCTGCCGGG - Intergenic
1138584320 16:57960447-57960469 GAGCTCGGGAGGGGGCTGCCTGG - Intronic
1140223160 16:73058355-73058377 GAGCGCGGGCGGCGGCGGCCGGG + Intronic
1141461282 16:84180039-84180061 GAGACTGGGGGGGGCCTGCCAGG + Exonic
1141615129 16:85206092-85206114 GAGGCCGGGAGGCATCTGCCGGG + Intergenic
1142006101 16:87690250-87690272 CAGCAAGGGCGGCGCCTGCCGGG + Exonic
1142057043 16:88004537-88004559 GAGCTGGGGCGGTGCCTGCCAGG - Intronic
1142194786 16:88734365-88734387 CAGCGCGGGAGGCGCGTGCCAGG + Exonic
1142206293 16:88784758-88784780 GCGCCCGGGTCGCGCGTCCCTGG + Intronic
1142264034 16:89055414-89055436 GAGCCCAGGTGGGGGCTGGCAGG - Intergenic
1142753792 17:2003658-2003680 GAGCCCAAGTCCCGCCTGCCTGG + Intronic
1142849330 17:2696669-2696691 GAGCCCGGGCTGGCCCTGCCAGG - Intronic
1142876533 17:2854486-2854508 GAGCCCTCGAGGTGCCTGCCTGG + Intronic
1143090617 17:4447392-4447414 GAGCCCCAGCGGGGCCTGCCCGG - Intronic
1143125634 17:4639653-4639675 CAGCCCCGGTGGGGCCTGGCGGG + Intronic
1143402843 17:6657170-6657192 CAGCCCCGGTGGGGCCTGGCGGG - Intergenic
1146370981 17:32265712-32265734 GGGCCCGGGTGGCGGCGCCCGGG + Intergenic
1146970208 17:37066175-37066197 GTGTCCGGGAGGCTCCTGCCGGG + Intergenic
1147182269 17:38693850-38693872 GAGCCCATGTGGAGGCTGCCGGG + Intergenic
1147373395 17:40009703-40009725 GAGCCATGGCGGCGCCTGGCCGG - Intergenic
1147900122 17:43778540-43778562 GAGCCCGGGTGGCGCCTGCCCGG - Intronic
1149571385 17:57674964-57674986 GCGCCGGGTTGGAGCCTGCCGGG - Exonic
1149996718 17:61409639-61409661 GAGGCCGGGCGGCGCCGGCGCGG + Intergenic
1150414332 17:64975276-64975298 GAGCCTGGGTTGTGCCTGCACGG - Intergenic
1150830080 17:68511737-68511759 GGGCCCGGGCGGCGCTGGCCGGG + Intergenic
1151679005 17:75614198-75614220 GAGGCCTGGAGGCGCCTCCCCGG + Intergenic
1151699522 17:75735930-75735952 GAGCCAGGGTGCCGCTAGCCTGG - Intronic
1151977517 17:77490917-77490939 TAGACGGGGTGGCCCCTGCCAGG - Intronic
1152523032 17:80871473-80871495 GATCCCTGGTGGCGCTGGCCTGG + Intronic
1152600807 17:81261224-81261246 GAGCCGGGGTGGCGGGAGCCGGG - Intronic
1152628129 17:81397585-81397607 GGGCTCGGGAGGCGCCGGCCGGG + Intronic
1152722513 17:81929883-81929905 GTGCCCGGGAGGTGCCTGCGGGG - Intergenic
1155055329 18:22177175-22177197 GAGCCAGGGCGGGGCCGGCCGGG - Intronic
1157474423 18:48012189-48012211 GAGCCTGGGCGGGGGCTGCCAGG + Intergenic
1160163997 18:76494980-76495002 GCGCCCGGGGGGCCCCTCCCCGG + Intronic
1160500778 18:79400343-79400365 GAGCCGGGGTCGCGGCCGCCAGG - Intronic
1160571287 18:79819234-79819256 GCACCCGGGTAGGGCCTGCCTGG - Intergenic
1160797527 19:952875-952897 GTGCCCAGGTGGGGCCTGCCTGG + Intronic
1161394420 19:4037677-4037699 CAGCACGGGTGGCGGCGGCCCGG + Exonic
1161399243 19:4060144-4060166 CAGCCCAGGAGGGGCCTGCCAGG - Intronic
1162778697 19:12995766-12995788 GAGCGCGGCCGCCGCCTGCCGGG + Exonic
1163113811 19:15177748-15177770 GTGCCCGCGCGCCGCCTGCCAGG - Exonic
1163480930 19:17555856-17555878 GAGCACGCGCGGCGCCTGCAGGG - Exonic
1164431709 19:28194465-28194487 CAGCCTGGGTGGAGGCTGCCTGG + Intergenic
1166509574 19:43395792-43395814 GAGCCACGGAGGCTCCTGCCTGG - Intergenic
1167090501 19:47340865-47340887 CTGCCTGGATGGCGCCTGCCTGG + Exonic
1167143887 19:47670946-47670968 GAGCCCGGGAGGCACCTCCCCGG + Intronic
924988003 2:288501-288523 GCTCCCGGGTGGCGCCGGGCAGG - Intronic
925023979 2:593729-593751 CAGCCCTGGTGGCGTCTCCCTGG - Intergenic
925610465 2:5697073-5697095 GAGCCCGGGGCGCGCGTGCCCGG - Exonic
926083381 2:10006449-10006471 GTGCCCGGCTGGCGCCTGCTGGG - Intergenic
927424872 2:22970758-22970780 GACCCCGGGTAGCCGCTGCCTGG + Intergenic
927501138 2:23584147-23584169 GAGGCCGGCTGGAGCCTGCCTGG - Intronic
931355826 2:61537438-61537460 GAGCCCGGGAGGCGGCGGGCGGG - Intronic
932475317 2:72002420-72002442 GAGCCAGCGTGGCCCCTCCCCGG + Intergenic
933897629 2:86825557-86825579 GTGCCTGGGTGCTGCCTGCCAGG - Intronic
934615405 2:95767733-95767755 GAGTCAGGGTGGAGCCTTCCAGG + Intergenic
935265103 2:101387175-101387197 TGGCCCGGGCGGCGCCCGCCCGG + Exonic
936086374 2:109472299-109472321 GGGCCCGGGAGGCCCCTGGCCGG - Intronic
936463427 2:112727427-112727449 GTGGCGGGGTGGGGCCTGCCAGG + Intronic
943811544 2:192194893-192194915 GAGCTCGAGAGGCGGCTGCCGGG - Exonic
946865487 2:224038756-224038778 GGGCCGGCGTGGCTCCTGCCCGG - Exonic
947398926 2:229713927-229713949 GAGCCCGGCTGGCCCCGCCCGGG + Intronic
948225181 2:236304289-236304311 GAGCCAGGGTGTTGACTGCCGGG + Intergenic
948541556 2:238694708-238694730 GAGACCTGGTGGAGGCTGCCCGG + Intergenic
948729522 2:239954082-239954104 GAGACTGGGTGCCACCTGCCAGG + Intronic
948729545 2:239954179-239954201 GAGACTGGGTGCCACCTGCCAGG + Intronic
948729568 2:239954277-239954299 GAGACTGGGTGCCACCTGCCAGG + Intronic
948739406 2:240033153-240033175 GGGCCAGGCTGGCCCCTGCCTGG + Intergenic
948765166 2:240215768-240215790 GAGCCTGGCTGGGGCCTCCCTGG + Intergenic
948782429 2:240329930-240329952 AAGGCCAGGTGGCACCTGCCAGG + Intergenic
949027638 2:241773935-241773957 GTGCCCGGGTGCGGCCTGACAGG + Intergenic
1171301130 20:24061266-24061288 GAGGGCGGGTGGAGCCTGCTTGG - Intergenic
1171444784 20:25195759-25195781 AGGCCGGGGTGGCGCCGGCCGGG + Exonic
1171473360 20:25389979-25390001 CAGCCCGAGGGGCGCCCGCCCGG + Intronic
1171770618 20:29319909-29319931 GAGCAGGCCTGGCGCCTGCCCGG - Intergenic
1172622933 20:36331483-36331505 CAGCCCGGGTGACCCCTGCCTGG - Intronic
1173852693 20:46228752-46228774 CAGCCCAGGAGGGGCCTGCCTGG - Intronic
1174199098 20:48794569-48794591 CAGCCAGGCTGGAGCCTGCCAGG + Intronic
1174287399 20:49482892-49482914 GAGCCCGGGAGGCCCCACCCTGG + Intergenic
1174915714 20:54651576-54651598 AAGCAGGGATGGCGCCTGCCTGG + Intergenic
1175778039 20:61665259-61665281 GAGCCCTGGTGGCAGCTTCCTGG - Intronic
1175787846 20:61723332-61723354 GGCCCCGGGAGGGGCCTGCCCGG - Intronic
1175789096 20:61730690-61730712 GAGCCAGGGTGAAGCCAGCCAGG + Intronic
1175949676 20:62576648-62576670 GTGCCTGGGTCCCGCCTGCCTGG + Intergenic
1176086480 20:63297607-63297629 GAGCCAGGCTGGGGCCTCCCTGG + Intronic
1176093539 20:63329395-63329417 GAGCCCAGGAGGCGCCTGTGTGG + Intronic
1176213869 20:63939221-63939243 GAGCCCGGGGGGGGCCTGCTCGG + Intergenic
1176736148 21:10548508-10548530 TGGCCTGGGTGGTGCCTGCCAGG - Intronic
1178932958 21:36835609-36835631 GAGGCTGGGTGTGGCCTGCCTGG - Intronic
1179674713 21:42974020-42974042 GAGCCCGGGTGGGCCCGTCCTGG - Intergenic
1179968304 21:44818968-44818990 GTGCCCGGGTGGTGCCAGCCGGG + Intergenic
1181107380 22:20583132-20583154 GAGCCCAGCTGGCTCCAGCCAGG + Exonic
1182277719 22:29201057-29201079 AGTCCCGGGTGGCACCTGCCGGG - Intergenic
1183533000 22:38374347-38374369 TGGCCTGGGTGGTGCCTGCCAGG + Intronic
1184219320 22:43089239-43089261 GTGCCCGGGAGGCGGCGGCCTGG + Intronic
1184659611 22:45959880-45959902 GAACCCAGCTGGAGCCTGCCCGG + Intronic
1184672635 22:46023450-46023472 CAGCCCTGGAGCCGCCTGCCTGG - Intergenic
1184979967 22:48089227-48089249 GACCCAGGGTGGCTCCTGCAGGG - Intergenic
1185038020 22:48489767-48489789 AGGCCCGCGGGGCGCCTGCCGGG - Intronic
1185242058 22:49751933-49751955 GAACCCGGGAGGCGCAGGCCTGG + Intergenic
1185281940 22:49975969-49975991 GAGCCCCGCCTGCGCCTGCCCGG - Intergenic
1185402738 22:50627147-50627169 GGGCCCGGGTGGTTCCTACCTGG + Exonic
951643448 3:24861860-24861882 GAGCCCTGGTGGTCCCTGCAGGG - Intergenic
953748770 3:45594287-45594309 GATCCCGGCCGGCGCCTGGCAGG - Intronic
954406956 3:50350560-50350582 GAGCCCGGGTGGCACCTGATAGG + Exonic
954717993 3:52536399-52536421 CAGCCCACGTGGCGCCGGCCCGG - Intronic
956678086 3:71753894-71753916 GAGCCCAGGAGGGGCCGGCCGGG + Intronic
961116743 3:124336248-124336270 AAGCCCTTGTGGGGCCTGCCGGG + Intronic
963084975 3:141428060-141428082 GATCCCGGGTGGCAGTTGCCAGG - Intronic
964257372 3:154791541-154791563 GAGACCAGGTGCCGGCTGCCAGG + Intergenic
969590872 4:8121323-8121345 GAGCTGGGCTGGCGTCTGCCCGG - Intronic
980063362 4:128155622-128155644 GGGCCCGGATGGCTCCTGGCTGG - Intronic
981427686 4:144622412-144622434 CAGGCAGGGTGGCGCCAGCCAGG + Intergenic
985490433 5:175620-175642 GAGCCCTGGTCGTGTCTGCCTGG - Intronic
985490450 5:175679-175701 GAGCCCTGGTCGTGTCTGCCTGG - Intronic
985490467 5:175738-175760 GAGCCCTGGTCGTGTCTGCCTGG - Intronic
985490484 5:175797-175819 GAGCCCTGGTCGTGTCTGCCTGG - Intronic
985490501 5:175856-175878 GAGCCCTGGTCGTGTCTGCCTGG - Intronic
985490517 5:175914-175936 GAGCCCTGGTCGTGTCTGCCTGG - Intronic
985490533 5:175972-175994 GAGCCCTGGTCGTGTCTGCCTGG - Intronic
985578241 5:683602-683624 GAGCCAGCATGGCCCCTGCCAGG - Intronic
985593168 5:775742-775764 GAGCCAGCATGGCCCCTGCCAGG - Intergenic
985665522 5:1180022-1180044 CAGCTCGGGTGGCACCTCCCGGG - Intergenic
989121056 5:38004964-38004986 GGGCCCGGATGCTGCCTGCCAGG - Intergenic
1000370908 5:160535715-160535737 GACCCAGGGTGGGGGCTGCCTGG - Intergenic
1001972251 5:175966102-175966124 GAGCCCAGGTGGAGGCTGCAGGG + Intronic
1002006464 5:176238550-176238572 GAGCTCCGGGGGCGCCCGCCCGG + Exonic
1002219913 5:177672086-177672108 GAGCTCCGGGGGCGCCCGCCCGG - Intergenic
1002245187 5:177877675-177877697 GAGCCCAGGTGGAGGCTGCAGGG - Intergenic
1002712816 5:181205239-181205261 GAGCCCGGGGCGCGCCCGGCTGG + Intronic
1005595484 6:27374948-27374970 GAGCCCGGGACGCGCCCTCCAGG - Intronic
1005826029 6:29632470-29632492 GAGCCCGGTCGGAGCCTGCGAGG - Intronic
1013411332 6:109886808-109886830 GAGGCCAGAGGGCGCCTGCCAGG + Intergenic
1015654145 6:135497880-135497902 GGGGCCGTGCGGCGCCTGCCCGG + Intergenic
1018911949 6:168106365-168106387 GAGCAAGGGTGCCGCCTGCCTGG - Intergenic
1019425735 7:975691-975713 GAGCCCCGGTGGGCGCTGCCCGG + Intergenic
1019573004 7:1722055-1722077 GGGCCCGGGTGGCCCAGGCCTGG + Intronic
1020238614 7:6374943-6374965 CGGCCCGGGCGGCGCGTGCCTGG + Intronic
1020319001 7:6926725-6926747 GGGCCCGGATGGGGCCTGACTGG + Intergenic
1020586514 7:10077138-10077160 GAGCCGGGATGGGGCCTGGCTGG + Intergenic
1020771705 7:12403751-12403773 GAGCCCGGGCCGCGGGTGCCAGG + Exonic
1022923380 7:35037557-35037579 GAGGCCGGGCGGCTGCTGCCTGG + Intronic
1022954232 7:35366674-35366696 GAGCCCGGGTGGCCGTGGCCCGG - Intergenic
1027551589 7:79604186-79604208 GAGCCCTGTTGGCCTCTGCCTGG + Intergenic
1029171181 7:98630068-98630090 GAGCCTGGGCAGAGCCTGCCAGG - Intergenic
1030048897 7:105521531-105521553 GAGCCCGCGTGGCGCCTAGTAGG + Intronic
1034830232 7:154302564-154302586 GAGCCCCGGTGGGGCCTGGCTGG + Intronic
1034860793 7:154592977-154592999 CAGCCTGGGTGACGCCTGCAAGG - Intronic
1035564622 8:633157-633179 GAGCCCGCGTGGGGCCGCCCAGG + Intronic
1035816964 8:2551536-2551558 GAGCACTGGTGTTGCCTGCCAGG - Intergenic
1037977575 8:23224564-23224586 AGGCCCGGGTCGCTCCTGCCTGG + Intronic
1040843456 8:51809283-51809305 CTGGCCGGGTGGTGCCTGCCAGG - Exonic
1041233233 8:55773565-55773587 CAGCCCGGGTCGCGCCTGCCGGG - Exonic
1043581576 8:81721330-81721352 GAGCGCGCGCGGCGCCTGACGGG + Intronic
1045498817 8:102729679-102729701 TAGCCAGGGTGGGGCCTCCCAGG + Intergenic
1045510091 8:102806944-102806966 GACCTCGGCTGCCGCCTGCCCGG - Intergenic
1047512844 8:125528926-125528948 GAGCCTGGGTTGCACCAGCCTGG + Intergenic
1049268930 8:141683988-141684010 GCTCCAGGGTGGCGGCTGCCTGG + Intergenic
1049718765 8:144106000-144106022 GAGCCATGGTGGGGCCTACCTGG + Intronic
1049746552 8:144265599-144265621 GAGCGAGGGTGGCGGCTGGCAGG - Intronic
1053215489 9:36266853-36266875 GAGCCGAGATGGCGCCAGCCTGG + Intronic
1057607111 9:96506889-96506911 GAGCCTGGCTGGCACTTGCCAGG - Intronic
1060242032 9:121912262-121912284 GAGGCCATGTGGTGCCTGCCAGG + Intronic
1060849143 9:126860563-126860585 CACCCGGGTTGGCGCCTGCCCGG + Intergenic
1061904775 9:133690990-133691012 CAGCCTGGCTGGGGCCTGCCTGG - Intronic
1061970467 9:134042080-134042102 GAGACAGGGTCCCGCCTGCCTGG + Intronic
1062269541 9:135702282-135702304 GACCCCGGGGGGCGTCTGCCGGG + Exonic
1062339004 9:136085597-136085619 GGGCCTGGGAGGCGGCTGCCAGG + Intronic
1062358255 9:136175263-136175285 GGGCCAGGGTGGAGCCTGCTGGG + Intergenic
1062466166 9:136682558-136682580 GAGCCCTGCTGGCCACTGCCAGG + Intronic
1062482096 9:136757240-136757262 GAGCCCAGCAGGCCCCTGCCCGG - Intronic
1062670810 9:137707857-137707879 GAGCCGGGGTGGAGCATGGCAGG - Intronic
1062690265 9:137837915-137837937 GAGCCCAGGGGGCCCCAGCCGGG + Intronic
1062712580 9:137984701-137984723 GAGCCAGCCTGGCACCTGCCTGG + Intronic
1187688466 X:21839882-21839904 CAGCCCGGGAGGCGCCAGGCAGG - Intronic
1192201706 X:69070419-69070441 ATGCCCGTGTGGCACCTGCCCGG + Intergenic
1199634643 X:149803875-149803897 GAGGCAGGGAGACGCCTGCCTGG + Intergenic
1202594439 Y:26521674-26521696 TGGCCTGGGTGGTGCCTGCCAGG - Intergenic