ID: 1147900130

View in Genome Browser
Species Human (GRCh38)
Location 17:43778563-43778585
Sequence CGTGCACCCCGCCACGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147900113_1147900130 24 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900121_1147900130 1 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900114_1147900130 23 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900115_1147900130 22 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900122_1147900130 0 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900110_1147900130 29 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147900130 Original CRISPR CGTGCACCCCGCCACGGGGA AGG Intronic
900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG + Intronic
900997804 1:6131810-6131832 CGGGGACCCCGCCACAGGCAGGG + Intronic
902920687 1:19664820-19664842 CGTGCGCCCCGCCTCGCGGTGGG - Intergenic
1069510879 10:69041671-69041693 AGTGCACTGGGCCACGGGGAGGG - Intergenic
1069547275 10:69337823-69337845 TGTGCACCCTTCCACGGGGTGGG + Intronic
1071501954 10:86210597-86210619 AGTGCTCACCTCCACGGGGAGGG - Intronic
1077062084 11:621938-621960 GGTGCACCTCACAACGGGGAGGG - Intronic
1078414863 11:11156741-11156763 CGTGGACCCAGCCCAGGGGAGGG - Intergenic
1083172066 11:60928962-60928984 TGAGCACCAGGCCACGGGGATGG + Intronic
1083678325 11:64340248-64340270 CGGGCACCCCGACCCGGGCATGG + Exonic
1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG + Intergenic
1101771982 12:107760689-107760711 CGTGCACCCCGCCACGGGTTGGG + Exonic
1113553956 13:111216348-111216370 CCTCCACCCAGCCACAGGGAAGG - Intronic
1122496294 14:102158232-102158254 CATGCACCCCTCCAAGGTGATGG - Intronic
1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG + Intronic
1123036644 14:105474504-105474526 CCTGCCCGCCGCCCCGGGGACGG + Intronic
1124164977 15:27318398-27318420 CTTGCACCCTGCCAGGGAGATGG + Intronic
1127770139 15:62224302-62224324 CCTGCACCCCGCCACGGAGGAGG - Intergenic
1128079047 15:64845418-64845440 TGTGAACCCTGCCAAGGGGAGGG + Intronic
1132739567 16:1404783-1404805 CGTGTACCCCGTCACGTGGATGG - Intronic
1134121058 16:11585759-11585781 AGTGCACCAGGCCAAGGGGAGGG + Intronic
1134588673 16:15434591-15434613 CCTGCAGCCCGCAACGGGAATGG + Exonic
1137787992 16:51152643-51152665 TGGGCACCCCGCCCTGGGGAGGG + Intergenic
1141463273 16:84191044-84191066 AGTGCACCCTGCCAATGGGAAGG - Intergenic
1142199924 16:88756185-88756207 CGGGCACCAGGCCACAGGGAGGG + Intronic
1142413124 16:89926169-89926191 GGCGAACCCCGCCCCGGGGAGGG - Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148052301 17:44775315-44775337 CATGCTCCCCGCCGCGGGGCTGG - Intronic
1152772612 17:82179549-82179571 GGTGGACCCAGCCACGGGGTGGG + Intronic
1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG + Intronic
1152879253 17:82806124-82806146 CGTGCACTCAGCGAAGGGGACGG - Intronic
1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG + Intergenic
1160514491 18:79470903-79470925 CCTGCCCCCCGCCCCAGGGAGGG - Intronic
1161203601 19:3029097-3029119 CGCGCACCCCAACCCGGGGAGGG - Exonic
1162558964 19:11404992-11405014 CGTGCAACCCGCCAGGGACAAGG + Intronic
1163720601 19:18896432-18896454 CGTGCCCCCCGTCACGGGCACGG - Intronic
1164624015 19:29714969-29714991 TGTCCACCCCGGCACCGGGAGGG + Exonic
1165511312 19:36268221-36268243 CCCCCACCCCGCCACGGGGTAGG - Intergenic
1168315526 19:55483259-55483281 CGTGCCCCCCGCCACCTCGAGGG - Exonic
934618150 2:95787959-95787981 CCTGCCCCCAGCCACAGGGAGGG + Intergenic
934642743 2:96036600-96036622 CCTGCCCCCAGCCACAGGGAGGG - Intronic
938469231 2:131544220-131544242 CCCCCACCCCGCCACGGGTAGGG - Intergenic
948999916 2:241607350-241607372 CGTGCATCCAGCCAGGGTGAGGG - Intronic
1169214751 20:3786543-3786565 GGTGCCCCCCGCCACGGGCCCGG - Exonic
1171782041 20:29427966-29427988 CATGCCCCCCGCCAGGGGCAGGG - Intergenic
1172083296 20:32358887-32358909 CGCGCACCCCCCCACTGGGGGGG + Intronic
1176244961 20:64093120-64093142 GGTGCTCCCCTCCACAGGGAGGG + Intronic
1180953498 22:19731198-19731220 TGTGCACACCGCCGCGGGGGAGG + Intergenic
949980839 3:9500866-9500888 CCTGCTCCCTGCCAAGGGGAAGG + Exonic
969302011 4:6302616-6302638 CGTGGACCCCGACAAAGGGAAGG + Exonic
969612653 4:8235913-8235935 CATGCACCCCGAAGCGGGGACGG + Intronic
979468862 4:121072034-121072056 CGCACACCACACCACGGGGAGGG - Exonic
981004074 4:139857245-139857267 TGTGCACCCAGCCAAGCGGAAGG + Intronic
1002021368 5:176366089-176366111 AGTGCACCCCGCCCGGGGGTGGG + Intronic
1003180013 6:3783209-3783231 CCTGCACCCAGCCCCAGGGAGGG - Intergenic
1007096878 6:39218739-39218761 CCTGCACCACTCCAGGGGGAAGG - Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG + Intronic
1023109663 7:36796553-36796575 AGTGCACCCTGCAATGGGGATGG + Intergenic
1035066413 7:156108433-156108455 CGTGGACCCCGGGGCGGGGATGG - Intergenic
1039848550 8:41343265-41343287 CATGCCCGCCGCCAAGGGGAAGG + Intergenic
1040644448 8:49382094-49382116 GGTGCACCTGGCCACGGGGAGGG - Intergenic
1040811289 8:51456454-51456476 AGTGCTCCCCTCCACTGGGATGG + Intronic
1049680840 8:143917370-143917392 CGTGGACCCCGAGACGGGCAAGG - Exonic