ID: 1147900131

View in Genome Browser
Species Human (GRCh38)
Location 17:43778564-43778586
Sequence GTGCACCCCGCCACGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147900123_1147900131 -10 Left 1147900123 17:43778551-43778573 CCACCCGGGCTCCGTGCACCCCG 0: 1
1: 0
2: 0
3: 23
4: 190
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900122_1147900131 1 Left 1147900122 17:43778540-43778562 CCGGGCAGGCGCCACCCGGGCTC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900114_1147900131 24 Left 1147900114 17:43778517-43778539 CCCAAGCGGGTGGCGGCTGGGAC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900110_1147900131 30 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900121_1147900131 2 Left 1147900121 17:43778539-43778561 CCCGGGCAGGCGCCACCCGGGCT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900115_1147900131 23 Left 1147900115 17:43778518-43778540 CCAAGCGGGTGGCGGCTGGGACC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900113_1147900131 25 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147900131 Original CRISPR GTGCACCCCGCCACGGGGAA GGG Intronic
901169436 1:7246013-7246035 GTGACCCCAGCCACAGGGAAAGG + Intronic
906675205 1:47688353-47688375 GAGCAGCCCGGCACAGGGAACGG + Intergenic
912512965 1:110200951-110200973 GAGCCCCCTGCTACGGGGAAAGG + Exonic
914952199 1:152126064-152126086 GTCCCCCCAGCCACAGGGAACGG + Intergenic
915595404 1:156893890-156893912 GACCACCCTGCCCCGGGGAAAGG + Intronic
922800989 1:228364697-228364719 GTGCACCCCGCCACATCCAATGG + Intronic
1069547276 10:69337824-69337846 GTGCACCCTTCCACGGGGTGGGG + Intronic
1077062083 11:621937-621959 GTGCACCTCACAACGGGGAGGGG - Intronic
1083172067 11:60928963-60928985 GAGCACCAGGCCACGGGGATGGG + Intronic
1084325236 11:68396369-68396391 GCGCACACCACCACGTGGAACGG - Intronic
1089192092 11:116660605-116660627 CTGCACCCAGCCAGGGGGATGGG + Intergenic
1101771983 12:107760690-107760712 GTGCACCCCGCCACGGGTTGGGG + Exonic
1113455516 13:110446059-110446081 GTGCTCCCTGCCAGGGAGAAGGG + Intronic
1113538772 13:111090150-111090172 GTGCCCCCCTCCAGAGGGAAAGG - Intergenic
1122266601 14:100549651-100549673 GTGCACCCAGACACGGGGGCAGG + Intronic
1125606663 15:40943326-40943348 TTGCAGCCCGCACCGGGGAAAGG - Intergenic
1127770138 15:62224301-62224323 CTGCACCCCGCCACGGAGGAGGG - Intergenic
1128079048 15:64845419-64845441 GTGAACCCTGCCAAGGGGAGGGG + Intronic
1128672795 15:69586886-69586908 GTCCACCCTGGCACAGGGAATGG + Intergenic
1129227958 15:74180759-74180781 GTGCGCCCTCCCACTGGGAATGG - Intronic
1131152907 15:90058089-90058111 GTGCACCCGGGCCTGGGGAATGG + Intronic
1137300283 16:47143076-47143098 CTGCACCTCGCGGCGGGGAACGG - Intronic
1137787993 16:51152644-51152666 GGGCACCCCGCCCTGGGGAGGGG + Intergenic
1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG + Intronic
1150464106 17:65377206-65377228 GTGCCCCCCGCCAAGTGGCAGGG - Intergenic
1151185656 17:72362107-72362129 GTGCACCCAGCCTCTGAGAAGGG + Intergenic
1152568181 17:81109549-81109571 GTGCACCCCTCCACAGGGGCCGG - Intronic
927697899 2:25250597-25250619 GTGGACCCCGCTATGGGGGAGGG + Intronic
935148999 2:100417306-100417328 GTGCGCCCCGCGGCGGGGAGAGG + Intronic
938595312 2:132782762-132782784 GGGCACCCCTCCTCCGGGAAGGG - Exonic
1169214750 20:3786542-3786564 GTGCCCCCCGCCACGGGCCCGGG - Exonic
1176244962 20:64093121-64093143 GTGCTCCCCTCCACAGGGAGGGG + Intronic
1179504836 21:41833434-41833456 GTGCCACCCACCACTGGGAATGG + Intronic
1179505055 21:41834644-41834666 GTGCCACCCACCACTGGGAATGG + Intronic
1180953499 22:19731199-19731221 GTGCACACCGCCGCGGGGGAGGG + Intergenic
1184173148 22:42771385-42771407 GTGCACTCAGGCAGGGGGAATGG + Intergenic
949980840 3:9500867-9500889 CTGCTCCCTGCCAAGGGGAAGGG + Exonic
950092200 3:10303995-10304017 GTCCACCATGCCACGGGGAATGG + Intronic
952946224 3:38479347-38479369 GTGGACACCTCCACAGGGAAGGG - Intronic
954678942 3:52331099-52331121 GTGCCCCCCGCCATGGGGGCAGG - Intronic
955060055 3:55486339-55486361 GCGCACCCCGGCGCGGGGAGCGG - Intronic
969658478 4:8511325-8511347 GTGCAGACCACCACGGAGAAGGG - Intergenic
975666942 4:76741700-76741722 GTGGCCGCCGCCTCGGGGAACGG + Exonic
985965301 5:3335207-3335229 GTGCATGAGGCCACGGGGAAGGG - Intergenic
998205430 5:140154005-140154027 GTGCACCCTGGCACGTGGGAAGG + Intergenic
1001642217 5:173252515-173252537 GGGCACCCCGCTACGGAGGAAGG - Intergenic
1002021369 5:176366090-176366112 GTGCACCCCGCCCGGGGGTGGGG + Intronic
1002324758 5:178397090-178397112 GTGCACCCAGCCTCCAGGAAGGG + Intronic
1006874035 6:37279874-37279896 GTGGACTCCACCACAGGGAAAGG - Intronic
1007575969 6:42925422-42925444 CTGCACCCGGCCACGGAGACTGG + Exonic
1008545668 6:52581123-52581145 GTGAACCCCGACACTCGGAATGG + Intergenic
1008914847 6:56775937-56775959 GTGCAGCCCACAACGGGGGATGG - Intronic
1018141274 6:160839165-160839187 GTGCACCCAGCCACGGTTAGAGG + Intergenic
1018817872 6:167349407-167349429 GTGCACCCAGCCACGGTTAGAGG - Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1020274711 7:6617027-6617049 CTGTCCCCCGCAACGGGGAACGG - Intronic
1022489537 7:30805920-30805942 GTGCACCCTGCCTCTGTGAATGG - Intronic
1024800210 7:53068413-53068435 GTGCACCAGGGCACAGGGAAAGG + Intergenic
1026003527 7:66582069-66582091 TTGCACCTGGCCCCGGGGAAGGG - Intergenic
1029280138 7:99430111-99430133 GGCCACCCCGTCAAGGGGAAAGG + Intronic
1035843339 8:2836160-2836182 GTGCACCATGCCACGTGCAAGGG - Intergenic
1036619137 8:10411911-10411933 GTGGACACCGCCCCTGGGAAGGG + Intronic
1038271085 8:26076513-26076535 ATGCACCCCTCCAAGGGGACAGG - Intergenic
1040811290 8:51456455-51456477 GTGCTCCCCTCCACTGGGATGGG + Intronic
1048308420 8:133299522-133299544 CTGTACTCCGCCACTGGGAAAGG + Intronic
1053353382 9:37427953-37427975 GTGGGCCCCGGCACGGGGCATGG + Intronic