ID: 1147901875

View in Genome Browser
Species Human (GRCh38)
Location 17:43792094-43792116
Sequence CTGCTAGTTGAGATGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147901868_1147901875 11 Left 1147901868 17:43792060-43792082 CCAACATTTTGCCCAGGGGCTCA No data
Right 1147901875 17:43792094-43792116 CTGCTAGTTGAGATGGGGCTTGG No data
1147901870_1147901875 0 Left 1147901870 17:43792071-43792093 CCCAGGGGCTCAGAACATATGGA No data
Right 1147901875 17:43792094-43792116 CTGCTAGTTGAGATGGGGCTTGG No data
1147901871_1147901875 -1 Left 1147901871 17:43792072-43792094 CCAGGGGCTCAGAACATATGGAC No data
Right 1147901875 17:43792094-43792116 CTGCTAGTTGAGATGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147901875 Original CRISPR CTGCTAGTTGAGATGGGGCT TGG Intergenic
No off target data available for this crispr