ID: 1147904888

View in Genome Browser
Species Human (GRCh38)
Location 17:43816335-43816357
Sequence GAGTGTGAGCAGTGTGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 246}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147904874_1147904888 28 Left 1147904874 17:43816284-43816306 CCTTTCCAGGCCCTGAGGGGGAT 0: 1
1: 0
2: 4
3: 21
4: 172
Right 1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG 0: 1
1: 0
2: 0
3: 18
4: 246
1147904877_1147904888 18 Left 1147904877 17:43816294-43816316 CCCTGAGGGGGATTCTAGGCCAG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG 0: 1
1: 0
2: 0
3: 18
4: 246
1147904881_1147904888 -9 Left 1147904881 17:43816321-43816343 CCTCCCCAGTCCCTGAGTGTGAG 0: 1
1: 0
2: 3
3: 27
4: 300
Right 1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG 0: 1
1: 0
2: 0
3: 18
4: 246
1147904878_1147904888 17 Left 1147904878 17:43816295-43816317 CCTGAGGGGGATTCTAGGCCAGC 0: 1
1: 0
2: 2
3: 10
4: 75
Right 1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG 0: 1
1: 0
2: 0
3: 18
4: 246
1147904880_1147904888 -1 Left 1147904880 17:43816313-43816335 CCAGCAGGCCTCCCCAGTCCCTG 0: 1
1: 0
2: 7
3: 63
4: 604
Right 1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG 0: 1
1: 0
2: 0
3: 18
4: 246
1147904875_1147904888 23 Left 1147904875 17:43816289-43816311 CCAGGCCCTGAGGGGGATTCTAG 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG 0: 1
1: 0
2: 0
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147904888 Original CRISPR GAGTGTGAGCAGTGTGAATA GGG Intronic
900338418 1:2176111-2176133 GTGTGTGAGCAGGGTGCATTCGG + Intronic
902732614 1:18379301-18379323 GATTGTAAGCAGTCTGGATAGGG + Intergenic
903437480 1:23362105-23362127 GAGTGTGTGCAGTGTGGGAAAGG - Exonic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
907110148 1:51919813-51919835 GAGTGTGGGCAGTGTGTAACAGG + Exonic
907510257 1:54952736-54952758 GAGTGTGAGCTCTGTAAATGTGG - Intergenic
910452445 1:87360803-87360825 GGGTGGGAGCAGTGCGAATGAGG + Intergenic
915299319 1:154942939-154942961 GAAGGTGAGCAATGTGAACAGGG + Intergenic
915331643 1:155116482-155116504 GAGTTTGGGCAGGGGGAATAGGG - Intergenic
915816942 1:158977499-158977521 GAATGTGAGAAGAGGGAATATGG - Intergenic
916452152 1:164931104-164931126 GAGTGAGAGCAGAGAGAGTAGGG - Intergenic
917028855 1:170668173-170668195 GAGAGTGTGGAGTGTGAATGGGG + Intronic
917168109 1:172136442-172136464 GAGTGTGAACAGTGTTCACAGGG - Intronic
920210242 1:204322700-204322722 ATGTGTGAGGAGTGTGATTATGG - Intronic
921539432 1:216395319-216395341 GAGTGTGAACACTGTAATTAAGG - Intronic
921980347 1:221250468-221250490 GAGTGTGAGAAGTGAGACAATGG - Intergenic
924118278 1:240769605-240769627 GAGAATGAGCAGTATGAAAATGG - Intergenic
1063995529 10:11614958-11614980 GTGTATGAGCAGTGTGGATGTGG - Intergenic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1065309111 10:24396983-24397005 GAGTGTTAGCAGAGTGAGCAGGG + Intronic
1066263642 10:33753517-33753539 GAATGTGAGCTGTGTGCTTATGG + Intergenic
1070399452 10:76040546-76040568 GAGTGTGAGCAGTGGGGAAGGGG - Intronic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1070777158 10:79116406-79116428 GAGAGAGAACTGTGTGAATATGG + Intronic
1075197467 10:120373149-120373171 GAAGGTGAGCAGGATGAATAAGG + Intergenic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1077921247 11:6643317-6643339 GAGTGTGAGAAGTGAGAAAATGG - Intronic
1078132309 11:8622855-8622877 GAGTGTGAGAATTTTGAACAAGG - Exonic
1079893045 11:26082131-26082153 TAGTGTGAGCAGTGTAAGGATGG - Intergenic
1080485417 11:32701837-32701859 GAATGTGAGGAGTGTGAAAAAGG - Intronic
1081296846 11:41401261-41401283 AAATGTGACTAGTGTGAATAAGG - Intronic
1081489052 11:43553322-43553344 GAGTGAGTGCAGCGTGGATATGG + Intergenic
1082884045 11:58065735-58065757 GAGTGTTAGCATTGTGCAAAGGG + Intronic
1083628447 11:64083878-64083900 GAGTGTGAGCAGCGTGCAGGCGG + Intronic
1085448772 11:76618217-76618239 GACTGTGAACTGTGAGAATAGGG - Intergenic
1087415631 11:97851863-97851885 GAGTGTGTGCAGTCTGCACACGG + Intergenic
1087701667 11:101442353-101442375 GAATGTGAGTACTGTGAACAAGG + Intergenic
1089396964 11:118142440-118142462 GGGTGCCAGCAGGGTGAATAGGG - Intronic
1090515729 11:127424384-127424406 AAGTGAGAGCAGTGTGAGTTTGG + Intergenic
1091112132 11:132979404-132979426 GAGTGTGAGCAGGCTGTCTAAGG - Intronic
1092927209 12:13282152-13282174 GAGTGTGAGCAATGTCATGAAGG - Intergenic
1093913280 12:24771541-24771563 GAGTGAAAGCAGTTTGAAAACGG + Intergenic
1094493827 12:30977310-30977332 GAGTGTGGGCAGGGGGGATACGG - Intronic
1095561367 12:43569956-43569978 GAGAATGAGCAGTATGAAAACGG - Intergenic
1095568429 12:43653964-43653986 GAGTGTTAGCAGTGAAAATGGGG - Intergenic
1096668895 12:53186064-53186086 GAGACTTACCAGTGTGAATAAGG - Exonic
1097515113 12:60594709-60594731 GAGAGTGAGCAAGGTGGATAAGG + Intergenic
1098101644 12:67024077-67024099 AAGTGTGAACAGTCTGAAAAGGG - Intergenic
1098779207 12:74663825-74663847 GAGAGTGAGAAGTATGAAGATGG - Intergenic
1101320462 12:103668930-103668952 GAGTGTGATCTGTGTTAAGAGGG - Intronic
1103738264 12:123074510-123074532 GAGTGTGTGTTGTGTGCATATGG - Intronic
1104993147 12:132637863-132637885 GAATCTGAGCAGCGTGAAAAGGG - Intronic
1105450816 13:20498058-20498080 GTGTGTGTGTAGTGTGTATAGGG - Intronic
1105450837 13:20498264-20498286 GTGTGTGTGTAGTGTGTATATGG - Intronic
1105450845 13:20498422-20498444 GTGTGTGTGTAGTGTGTATATGG - Intronic
1106088815 13:26568036-26568058 CAGGGAGGGCAGTGTGAATAGGG + Intronic
1106629937 13:31460917-31460939 GAGTGTCAGTTGTGTGAATTTGG + Intergenic
1111873716 13:93866718-93866740 GAGTGTGAAGAGTGGGAGTAGGG + Intronic
1113315279 13:109173247-109173269 GTGTGTGAACAGTGAAAATACGG + Intronic
1115403441 14:32989926-32989948 CATTGAAAGCAGTGTGAATAGGG + Intronic
1115436214 14:33377674-33377696 GAGTGAGAGAAGTGTGAGTGAGG + Intronic
1120505978 14:85353629-85353651 GAGTCATAGCAGTGTGAATGAGG - Intergenic
1120540323 14:85742791-85742813 GAGTGTGAGAAGAGAGAAAATGG - Intergenic
1121443155 14:93961775-93961797 GCGTGTGTGCCGTGTGAATTTGG + Intronic
1122087025 14:99314873-99314895 GCCTGGGAGCTGTGTGAATACGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123452709 15:20381080-20381102 GAGTGTGAGTGGTGTGACTGTGG + Intergenic
1124531008 15:30506473-30506495 GTGTGTGAGTAGGGTGTATAGGG + Intergenic
1124767647 15:32501222-32501244 GTGTGTGAGTAGGGTGTATAGGG - Intergenic
1125085191 15:35721719-35721741 CAGTGTTTGCAGTGTGAGTAGGG - Intergenic
1126408330 15:48345896-48345918 GTGTGTGAGGAGGGTGTATATGG - Intergenic
1126596266 15:50387033-50387055 GTGGGTGAGCAGGGTGTATATGG + Intergenic
1127814953 15:62599794-62599816 GAGGGTGAGCTGTGTGAACGTGG + Intronic
1133908199 16:10040715-10040737 GAGTGTGTGCAGTGTGCCTATGG - Intronic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140111455 16:72008795-72008817 GCGAGTGAGCAGTGTGGATGGGG + Intronic
1141157417 16:81606951-81606973 CAGTGTGAGGAGTGTGGAAAGGG + Intronic
1141882182 16:86867413-86867435 GAGTGGGAGCAGTGGAAATGAGG - Intergenic
1143296174 17:5873699-5873721 GAGTGTGGGGAGTGTGCACATGG + Intronic
1146759664 17:35466050-35466072 GAGTGCGGGCAGTGGGTATATGG - Intronic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1149106613 17:52975063-52975085 TAGTGTGAGCAGTGGGGAAAAGG + Intergenic
1149200766 17:54183426-54183448 GAGAGTGGGTAGTGAGAATATGG - Intergenic
1149492761 17:57096906-57096928 AAATGTGACCAGTGTGACTAGGG - Intronic
1150745800 17:67815600-67815622 GAGTGCAAGCAGTGTGATTTTGG + Intergenic
1151030268 17:70729758-70729780 CAGTGTGAGCATTCTGAATTAGG + Intergenic
1152436792 17:80281256-80281278 GAGTGTGAGTGGTGTGAGTGGGG - Intronic
1152436825 17:80281419-80281441 GTGTGTGAGTGGTGTGAATGGGG - Intronic
1153062913 18:1012608-1012630 AATTGTGGGCAGTGTGAATGGGG + Intergenic
1154966659 18:21364669-21364691 GAATGTGTGCAGCCTGAATAGGG + Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1156205133 18:34877430-34877452 GAAAGAGAGCAGTATGAATAAGG - Intronic
1156821364 18:41376920-41376942 GAGTGAGAGCAGTGGAGATAGGG + Intergenic
1156897216 18:42259420-42259442 GAGTGTGAGCAGGATGAAGTTGG - Intergenic
1159355944 18:67337532-67337554 GAGACTGAGCAGGGTGGATAAGG + Intergenic
1160527524 18:79546281-79546303 GAGTGTGAAGAGGGTGAATGTGG - Intergenic
1162069604 19:8145906-8145928 CAGTGTGAGCTGTATGAATGGGG - Exonic
1162653685 19:12112052-12112074 GAGTGTAAGCAGTGTGGCAAAGG + Intronic
1163017014 19:14462693-14462715 AAGTGTGACCAGTGTGACCAGGG + Intronic
1163713006 19:18857954-18857976 GAGCGTCAGCAGAGTGAAAAAGG - Intronic
1164996028 19:32720660-32720682 GAGTGGGGGCGGTGGGAATAAGG - Intronic
1165698330 19:37918180-37918202 GAGGGTGAGCAGGGGGACTAAGG + Intronic
1166587857 19:43967105-43967127 AAATGTGAGCAGTGTGAGAAGGG + Exonic
1167639369 19:50672233-50672255 AAGGGAGAGCAGTGTGAAGACGG + Intronic
1168677233 19:58287381-58287403 GAGTGGCAGCAGTGTGATCATGG + Intronic
929056848 2:37885701-37885723 GAGTCTGAGCAGTGAGGGTAGGG - Intergenic
930169777 2:48239365-48239387 GTGTGATAGCAGTGTGAAAAGGG - Intergenic
930968720 2:57367337-57367359 GGGTGGGACCAATGTGAATAAGG - Intergenic
931040037 2:58287242-58287264 GAGGGTGAGTAGGGTGAGTAGGG + Intergenic
932029685 2:68170959-68170981 GAGTGTGTGCAGTGGAAGTAAGG - Intronic
932043730 2:68326127-68326149 GAGTTTGCTCAGTGTGAAGATGG - Intergenic
932060826 2:68495905-68495927 GAGCCAGAGCAGTGGGAATATGG + Intronic
932418352 2:71586944-71586966 GGGTGGGAGCAGTGGGAGTAGGG - Intronic
934845880 2:97661042-97661064 GAGTGAGAGCAGGGTGCACAAGG - Intronic
938137410 2:128770526-128770548 GAGTGTGTGCAGTGTGGGCATGG + Intergenic
938180405 2:129177175-129177197 GAGTGTAAGCAGGTAGAATATGG + Intergenic
938259618 2:129885922-129885944 GCATGTGAGCTGTGTGATTATGG + Intergenic
940943427 2:159589251-159589273 GATTCTGAGCAGTGTGAGTAAGG - Intronic
942162171 2:173201955-173201977 GAATGTGAGCTGGCTGAATATGG - Intronic
942226786 2:173823529-173823551 GAGTGTGACCTCTGTAAATAGGG - Intergenic
942486478 2:176445293-176445315 GAATATGAGCAGTGTGCATGTGG - Intergenic
944634106 2:201657832-201657854 GAGCATGAGCAGGGTGAAGAAGG - Intronic
944641243 2:201727990-201728012 GAGTGTCAGCCATGTGAAGAGGG - Intronic
945791678 2:214312476-214312498 GACTTTGAGCTGTGTGTATAGGG + Intronic
947072118 2:226300723-226300745 GAGTGTGAGCATTGTGGCTTTGG + Intergenic
948172908 2:235919825-235919847 GGGTGTAAGCATTGTGAAGACGG - Intronic
948584503 2:239010886-239010908 TAGTGTGAGCAGTGTTATTATGG - Intergenic
948609718 2:239159177-239159199 GGGTGGGAGTAGTGTGAATTGGG - Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1172851817 20:37971924-37971946 GAGAGGGAGCAGTGTGAGTCAGG - Intergenic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174295743 20:49543811-49543833 GAGTGTCAGCTGTGTGAATTTGG + Intronic
1177334554 21:19706911-19706933 CACTATGAGCAGTGTGAAAATGG + Intergenic
1177587296 21:23114580-23114602 GAGTGTGCAGATTGTGAATAAGG + Intergenic
1178027793 21:28488005-28488027 GAGTAAGAGAATTGTGAATAAGG + Intergenic
1178271468 21:31193786-31193808 GAGTGCCGGCAGTGTGAATCGGG + Intronic
1178623150 21:34193901-34193923 CTGTGTCAGCAGTGTGAAAATGG + Intergenic
1179391269 21:40994256-40994278 GTGTGTGTGCAGTGTGAGTGTGG - Intergenic
1180678252 22:17603876-17603898 CTGTGTGACCAGTGTGGATAGGG - Intronic
1183374419 22:37454655-37454677 GAGAGTGAGAAGTCTGGATATGG + Intergenic
1183900280 22:41000418-41000440 GGGAGTGAGCCATGTGAATATGG - Intergenic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
1184054208 22:42033515-42033537 GAGGGTGAGCAATGAGAATGAGG + Intronic
1185202188 22:49514380-49514402 GAATGTGTGCAGTGTGCATGCGG + Intronic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
950764157 3:15260944-15260966 ATGTGTGTGCAGTGTGAATTCGG + Intronic
951088395 3:18542205-18542227 GAGAGTGAGCCATGTGCATATGG + Intergenic
951092167 3:18586957-18586979 GTGTGTGAGCAGTGAAATTAAGG - Intergenic
953208710 3:40855200-40855222 GAATGTGAGCAGAGTGGACAGGG + Intergenic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
958149553 3:89671846-89671868 ATGTGTTAGCAGTGTGAAAATGG + Intergenic
958804365 3:98792057-98792079 GAGTGTGAGAAGAGAAAATATGG - Intronic
961138832 3:124538424-124538446 GTGTGTGTGCATTGTGAATAAGG + Intronic
962114733 3:132491760-132491782 GAGTGTGTGCAGTCTGACGAGGG - Intronic
964392365 3:156211092-156211114 GAGTGTGGGCAGTGAAAAAAGGG + Intronic
965230360 3:166043269-166043291 GTGTGTGAGAAGTGTCAAAAGGG + Intergenic
966263184 3:178004432-178004454 GAGTGAGAGCAGTGTCAAAGAGG + Intergenic
966560366 3:181313147-181313169 GAGTGTAAGAGGTGTGAAAATGG - Intergenic
966861351 3:184232633-184232655 CAGTGTGTGCAGTGTGCAAATGG + Intronic
968248131 3:197176224-197176246 GTGTGTGAGCAGGGGGCATATGG - Intronic
969910965 4:10445736-10445758 CAGTGTGAGTATTGTGACTATGG - Exonic
970216754 4:13766966-13766988 GAGAGAGAGAAGTGTGAACAGGG + Intergenic
973072987 4:45888434-45888456 CAGTGGGAGCAGTGTTAAGAGGG - Intergenic
974744477 4:66053884-66053906 GAATGGGACCAGTGTTAATATGG - Intergenic
975147065 4:70980152-70980174 CAGTGTGAGGAGTGTGTACAGGG - Intronic
976382062 4:84410737-84410759 GAGTGGGGGCAGTGTCACTATGG + Intergenic
979052405 4:115951484-115951506 GAGTGTGTGTAGTGTGAGTGTGG + Intergenic
980474565 4:133295937-133295959 GAGTGTTAACAGTGTGAACAAGG + Intergenic
982628424 4:157798710-157798732 AAGTGTGAGCAGTGTGAGAGTGG + Intergenic
983419717 4:167501675-167501697 GGGTATCAGCAGTGTGAAAATGG - Intergenic
983714075 4:170755439-170755461 GAATGAGAGCTGAGTGAATAGGG - Intergenic
984161855 4:176262440-176262462 GTTTTTGAGCATTGTGAATAAGG + Intronic
985268041 4:188168123-188168145 CAATGTGAGCAGTGTGAATTTGG + Intergenic
985487589 5:160224-160246 GTGTGGGAGCCGTGTGAACATGG - Intronic
985632300 5:1020431-1020453 GAGGCTGAGCAGGGTGACTAGGG - Intronic
986969481 5:13315436-13315458 GAGAGGGAGCAATGTGACTAAGG - Intergenic
987271132 5:16310448-16310470 GAGTGTGAGTGGTGTGAGTGTGG - Intergenic
987613099 5:20234165-20234187 AAGTGTGACCAGTTTAAATAAGG + Intronic
988850732 5:35177735-35177757 GTATGTGGACAGTGTGAATAGGG + Intronic
990257410 5:53985219-53985241 GAGTGTGAGCAGAGGGAGTGAGG - Intronic
990846313 5:60144036-60144058 GAGTGTTTGCAGAGTGACTAGGG - Intronic
991318634 5:65342191-65342213 CTGTGTCAGCAGTGTGAAAATGG - Intronic
992040596 5:72827105-72827127 AGGAGTGAGCAATGTGAATATGG + Intronic
992866194 5:80960018-80960040 GAGTGTGTGCATTGTGGATCTGG + Intergenic
993548823 5:89248405-89248427 GAGTGAGAAGAGTGAGAATAAGG - Intergenic
994236142 5:97365344-97365366 GAGTGTGATCAGTCTTATTAAGG + Intergenic
994305044 5:98192876-98192898 GAGTGTGAGCAGAGAGCAAAGGG + Intergenic
995849386 5:116529130-116529152 GAGTCTGTTTAGTGTGAATAGGG + Intronic
996292299 5:121866470-121866492 GACTGTAAGCAGTGTGGATTAGG - Intergenic
996463457 5:123772922-123772944 GAGTGAGAGCAAAGTGAGTATGG - Intergenic
1000719006 5:164682234-164682256 GAAAGTCAGCAGTGTGAAGATGG - Intergenic
1005106453 6:22229257-22229279 GAGTGTGTGCAGTGCGTATCTGG + Intergenic
1006470683 6:34227075-34227097 GAGGGTGAGCAGCGTGAATCTGG - Intergenic
1007375614 6:41454610-41454632 GTCTGTGAGCTGTGTGTATAAGG + Intergenic
1007590618 6:43018595-43018617 AAGTGTCAGGAGTGTGAAGAGGG - Intronic
1007903630 6:45436517-45436539 GGGTGGGTGCAGTTTGAATAGGG - Intronic
1007922360 6:45621874-45621896 GAGTGAGAGCAGTGGAAAAATGG + Intronic
1009271319 6:61618614-61618636 GAGTGTGATGGGTGTGAAGAGGG - Intergenic
1010530807 6:76965512-76965534 GAGTATGTGCATTGTGAAGATGG - Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011780262 6:90781002-90781024 GAAGGTGTGCAGTGTGTATATGG - Intergenic
1014473283 6:121842167-121842189 GAATGTAAGCAGTGGCAATAAGG - Intergenic
1014508180 6:122285007-122285029 GACCATGAGCAGTGTGAATTTGG - Intergenic
1015924329 6:138294218-138294240 GAGTGTAAGCAATGGGAATGTGG - Intronic
1016311002 6:142733581-142733603 GAGAGTGTGCAGGGTGAGTAAGG - Intergenic
1017948173 6:159113456-159113478 GCGTGTGAGCAGTGTGTATGCGG + Intergenic
1018236836 6:161734756-161734778 GAGTGGGACCTGAGTGAATAAGG + Intronic
1019201980 6:170324935-170324957 AAATGTCAGCAGTGTTAATAAGG + Intronic
1021614831 7:22491608-22491630 GAATGTGAACAATGTGAACAAGG + Intronic
1022954108 7:35365739-35365761 GAGTGTGCTCAGTATAAATATGG - Intergenic
1023731788 7:43198626-43198648 GAGTGTGGGGTGTGTGACTATGG - Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1027056240 7:75051781-75051803 ATGTGTGTGCAGTGTGCATATGG - Intronic
1027922743 7:84416422-84416444 GTTTATGAGCAGTGTGAAAATGG + Intronic
1028379544 7:90183403-90183425 GAATGTGAACAATGTGAACAAGG - Intronic
1028823848 7:95245935-95245957 GAATGTAAGCAGTGTGAGTGCGG + Intronic
1028968333 7:96827788-96827810 AAGTGTGGGAAGTGTGAAGAGGG - Intergenic
1031696989 7:124869362-124869384 GAGTGTTAGCTATGTGAGTATGG + Intronic
1034781301 7:153885178-153885200 GATTGTAAGCAGGGTTAATATGG - Intergenic
1034968919 7:155407572-155407594 GAGTGTGGGGTGTGTGAATGTGG + Intergenic
1034968984 7:155407842-155407864 GAGTGTGGGGTGTGTGAATGTGG + Intergenic
1036753059 8:11455348-11455370 GAGTGTGAGGAGTGTGAGTGTGG + Intronic
1036927498 8:12921343-12921365 GAGAGGGAGCAGTGATAATAAGG - Intergenic
1037166980 8:15842261-15842283 GATTATGAGCAGTGTGAACCTGG + Intergenic
1037449591 8:19003426-19003448 GAGAGTGAGAAGTGTGAAGTTGG - Intronic
1041572797 8:59356754-59356776 GAGTGTGAGAATTGTGAATTGGG - Intergenic
1042037060 8:64545193-64545215 GAGTGAGAGCACTGGGAAAAGGG - Intergenic
1043564272 8:81530809-81530831 AAGAGAGAGCAGTGTGAAAATGG + Intronic
1043909107 8:85839833-85839855 TAGTCTCAGCAGTGTGAAAATGG + Intergenic
1045553157 8:103190756-103190778 GAGTGTCTGCAGGGTGAAGATGG + Intronic
1045909736 8:107393221-107393243 GAGTGTGAACATTCTGAAAAAGG + Intronic
1047067627 8:121303440-121303462 GTGTGGGAGCAGTGTGTGTAGGG + Intergenic
1049424051 8:142530179-142530201 GCGTGTGAGCATTGTGTATGTGG + Intronic
1049839107 8:144759277-144759299 GAATGTGAGGAGTGAGAACAAGG - Intergenic
1051846903 9:21462249-21462271 TACTGTGAGCTGTGTGAATCAGG + Intergenic
1052731852 9:32295569-32295591 GAGGGAGAGCAGTGCCAATATGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1055774028 9:79748585-79748607 GAGAGTGAACAGAGAGAATAAGG + Intergenic
1057669091 9:97072811-97072833 GTATGTGAGCAGTGTGAACTGGG + Intergenic
1058123552 9:101165965-101165987 GAGTGAGAGAAGAATGAATATGG - Intronic
1058606130 9:106725522-106725544 GATTGTCAGCAATGTGGATAAGG - Intergenic
1058794710 9:108486748-108486770 GAGTGGGAGAAGTGTGAGTGGGG + Intergenic
1060054335 9:120400837-120400859 GTTTGTGAGCAGTGTGAGCACGG - Exonic
1060077694 9:120607968-120607990 GAATGTGACCAGTGTAAAGATGG - Exonic
1060262892 9:122091729-122091751 GAGTGTCAGGAGTTTGATTAAGG - Intronic
1062195294 9:135269682-135269704 ATGTGTGGGCAGTGTGAACAGGG - Intergenic
1062686226 9:137814848-137814870 GAGTGTGAGGGGTGTGAAGAGGG + Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189921297 X:45905444-45905466 GAGGGTGAAGAGTGGGAATATGG - Intergenic
1190385796 X:49881045-49881067 GAGGGAGAGCAGTGTGAACGGGG + Exonic
1191033635 X:56002342-56002364 AAGTGTGATGAGTGTGAATGAGG - Intergenic
1191115669 X:56849739-56849761 GAGCTAGAGCAGTGTGAAGAGGG + Intergenic
1192256829 X:69468544-69468566 GAGTGTGAGCAGTGGGGCGAGGG + Intergenic
1192792519 X:74397056-74397078 GAGAATGAGCAGTATGAAAATGG - Intergenic
1196060932 X:111407604-111407626 GACTATGTGAAGTGTGAATAGGG - Intronic
1196243307 X:113368796-113368818 GAGAGTGACCAGTGTGATTAGGG - Intergenic
1196395539 X:115257944-115257966 GAATTTGTGCAGTGGGAATAAGG - Intergenic
1196999807 X:121426615-121426637 CACTGTGAGAAGTGAGAATATGG - Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1200122479 X:153797683-153797705 GAGTGTGGGCAGAGTGGACACGG - Intronic