ID: 1147904976

View in Genome Browser
Species Human (GRCh38)
Location 17:43816726-43816748
Sequence CAGCATTAGTGGAGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147904969_1147904976 27 Left 1147904969 17:43816676-43816698 CCTTTGTCACAAGGCTGATCATC 0: 1
1: 0
2: 1
3: 6
4: 129
Right 1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG 0: 1
1: 0
2: 2
3: 11
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147904976 Original CRISPR CAGCATTAGTGGAGGGAAGC GGG Intronic
900238386 1:1603278-1603300 CAGCATTAGTGGAGACATGGGGG + Intergenic
901120716 1:6890817-6890839 TAGCATTTGGGGAGGAAAGCAGG - Intronic
902634825 1:17728447-17728469 CAGCATTTTGGGAGGGATGCAGG - Intergenic
903262662 1:22139739-22139761 CAGCCTCAGTGCAGGGAAGAGGG + Intronic
904981855 1:34510484-34510506 CAATATTAGTGGAGGTAAGGTGG + Intergenic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
910439515 1:87238316-87238338 CAGCATGGGGGCAGGGAAGCTGG + Intergenic
911301133 1:96175807-96175829 CAGCTTGTGTGGAGGGATGCAGG - Intergenic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
913555340 1:119961137-119961159 CACCATTAGGGCAGGAAAGCTGG + Intronic
915212676 1:154322239-154322261 AAGCATTAGTGTGAGGAAGCAGG - Intronic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
917600695 1:176570915-176570937 CAGCAGCAGTGTAGGGAGGCAGG - Intronic
919035066 1:192295939-192295961 CACCACTAGTGGAGGTAATCAGG - Intergenic
920225322 1:204434292-204434314 CAGCATTGGAGGAGAGAAGACGG - Intronic
921098976 1:211911957-211911979 CAGCTTTGGTGGAGGAAAGAAGG - Intergenic
921862715 1:220056012-220056034 CTCCATTCGTAGAGGGAAGCAGG + Intergenic
922191221 1:223320312-223320334 CATCATCAGGGGAGGGAAGGTGG + Intronic
922603240 1:226872532-226872554 CAGCAGTAGTGGAGAGACACGGG - Intronic
922962029 1:229655834-229655856 CAGCATTTGTCCAGGGAGGCTGG + Intronic
1063335938 10:5213322-5213344 CAGCATGGGTGGAGAGAATCAGG + Intronic
1066177774 10:32927304-32927326 CAACAGGAGTGGAGAGAAGCAGG + Intronic
1069379993 10:67833375-67833397 CAGCATTAGGTGAGGCAAGCAGG + Intronic
1069571845 10:69498912-69498934 CAGCATTAGTGGAGGCAGGCAGG + Intronic
1069798683 10:71069201-71069223 CAGCCTTTCTGGAGGGCAGCAGG - Intergenic
1070007074 10:72435140-72435162 CAGCACTTTTGGAGGGAAGGTGG + Intronic
1070501653 10:77078322-77078344 CAGCTTTAGGGGAGGGAAGGTGG - Intronic
1074440680 10:113475042-113475064 CAGCAGTGGTGGAGGGAGGTGGG + Intergenic
1078036104 11:7806576-7806598 CAGCATTAGTGGGTCGAGGCAGG - Intergenic
1078147335 11:8730725-8730747 GAGCATGTGTGGAGAGAAGCGGG - Exonic
1079344479 11:19639944-19639966 CAGCATGGGTGAAGGGAAGATGG + Intronic
1080656380 11:34261920-34261942 CAGCATTTCTGGAGGACAGCAGG + Intronic
1082636449 11:55599982-55600004 CAGCATCAGGGGAGTGAAGCTGG + Intergenic
1085293187 11:75414822-75414844 CACCATTAGCGGAGAGAACCAGG + Intronic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1088904388 11:114143244-114143266 CAGCATTAGTGGATGGATGAGGG - Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1091068576 11:132541826-132541848 CAGCAAGAGTGGAGAGATGCTGG - Intronic
1096498772 12:52053330-52053352 CTGCTTTAGTGGAGGGACCCAGG + Intronic
1097448715 12:59709838-59709860 CAGCCTAAGGGGAGGAAAGCTGG - Intronic
1097831789 12:64232629-64232651 CAGCATCTGTTAAGGGAAGCAGG - Intergenic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1099113012 12:78586694-78586716 CAGCATTAGTGGCAGAAAGTTGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1101371644 12:104137317-104137339 AATCATTAGTGGTGGGAGGCGGG - Intronic
1104188832 12:126458415-126458437 GAGCAGCAGTGCAGGGAAGCGGG - Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107772209 13:43800051-43800073 CAGCATTAGTTGAGAAAGGCAGG - Intergenic
1107925779 13:45260432-45260454 AAGCATTAGTTGAGGGGAGGGGG + Intronic
1107955433 13:45506769-45506791 CAGCTTTAGAGGTGGGAACCAGG - Intronic
1108576933 13:51798976-51798998 CAAGCTTAGGGGAGGGAAGCGGG + Intronic
1109215477 13:59584746-59584768 CAGAATTAGTACAGGGATGCAGG + Intergenic
1109412180 13:61984912-61984934 CAGCATTAGTGAAAGGATGGCGG + Intergenic
1111244306 13:85515349-85515371 CAGGGTCAGTGGAGGAAAGCGGG + Intergenic
1113413105 13:110107595-110107617 CAGCACTAGAGGCTGGAAGCAGG + Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117728212 14:58695048-58695070 CAGCCTCAAGGGAGGGAAGCTGG + Intergenic
1119924310 14:78477855-78477877 CACCATTAGGGTAGGGAAACAGG + Intronic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1125003374 15:34794420-34794442 GGCCATTAGTGGAGAGAAGCAGG + Intronic
1126377502 15:48010882-48010904 CATGATTAGTGTGGGGAAGCAGG - Intergenic
1126771284 15:52058845-52058867 CAGAATCTGTGTAGGGAAGCTGG + Intronic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1129350303 15:74952115-74952137 CAGCCTTGGTGGTGGGGAGCGGG + Intergenic
1130791844 15:87163682-87163704 CAGCAGCAGTGCAGGGAACCTGG + Intergenic
1131439987 15:92452455-92452477 CAGAATTAGAGAAGGGAATCAGG + Intronic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1132660003 16:1057113-1057135 CAGCATTGGAGCAGGGAAACTGG + Intergenic
1133003870 16:2866759-2866781 CAGCATTTGAAGAGGGAACCAGG + Intergenic
1133507777 16:6429307-6429329 CAGCAGCAGTGGTGGGGAGCTGG - Intronic
1133572574 16:7056088-7056110 CAGCATTAGGTGTGGGCAGCAGG + Intronic
1133610966 16:7432971-7432993 CAGCTTCTGTGGAGGGAAACAGG + Intronic
1134857492 16:17532500-17532522 CACAAAGAGTGGAGGGAAGCTGG + Intergenic
1137677833 16:50312605-50312627 CTGCAGTAGTGGAGGGTAACGGG - Intronic
1138024411 16:53511557-53511579 CAGTATTAGTGGAGTCAGGCAGG + Intergenic
1138293396 16:55867187-55867209 CAGGTTTAGTGGAAGGGAGCTGG - Intronic
1139837457 16:69850650-69850672 CAGCATGAGTGAAGGCAAGGAGG + Intronic
1140039116 16:71393827-71393849 GAGAATTAGTGGATAGAAGCTGG + Intergenic
1142252780 16:89000350-89000372 CAGCACGTGTGAAGGGAAGCAGG + Intergenic
1142548926 17:725789-725811 CAGCATTTGAGGAGGCAAGGTGG + Intergenic
1142677260 17:1521460-1521482 CATCATTACTAGAGGGAAGGAGG + Intronic
1143114790 17:4576385-4576407 CAGGGTTAGTGGAGGTAAGGAGG + Intergenic
1144642904 17:16948390-16948412 CAGCACTGGTGGAGGGCAGGTGG + Intronic
1145045750 17:19614226-19614248 CAGCCTCGGTGGGGGGAAGCAGG + Intergenic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1148675084 17:49440271-49440293 TAGCAAAAGTGGGGGGAAGCAGG + Intronic
1150215206 17:63464038-63464060 CAGCATGAGTGAAGAGGAGCTGG + Intergenic
1150916397 17:69441962-69441984 CAGCATCAGTGGAGGCCAGATGG - Intronic
1151167600 17:72218841-72218863 CAGCATTAGTTGGGGGCAGGTGG + Intergenic
1151800631 17:76377359-76377381 AAGCATTTGTGGAGTGAGGCTGG - Intronic
1154255467 18:12777673-12777695 CAGGAATGGTGCAGGGAAGCCGG - Intergenic
1156235891 18:35204465-35204487 CAGCATCAGTGGAGGCCACCTGG + Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157488184 18:48104311-48104333 CATCATGAGAGGAAGGAAGCAGG - Intronic
1157491486 18:48126885-48126907 CAGCCTTAGGGCAGGGAAGAAGG + Intronic
1157923171 18:51734479-51734501 GAGCATTTGTGGAGGGAAAGTGG - Intergenic
1158051888 18:53232189-53232211 AAGCATTGGTGGAGAGAAGGGGG - Intronic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1159817811 18:73098704-73098726 GAGCAGTTGTGGAGGGAAGCTGG - Intergenic
1160918048 19:1507031-1507053 GAGCATCAGAGGAGGGAGGCTGG - Intronic
1161440958 19:4291410-4291432 CAGAAGTAGGGGAGGGGAGCTGG + Intergenic
1162930265 19:13953988-13954010 CAGCCTTCAGGGAGGGAAGCAGG + Intronic
1163690842 19:18737366-18737388 CAGCATCAGTGGAGGCACGTGGG - Intronic
1164085529 19:21898975-21898997 CAGCATTAATGGAACAAAGCTGG - Intergenic
1164412967 19:28020987-28021009 CAGCTCTGGTGGAGGGAAGAGGG - Intergenic
1168109906 19:54186530-54186552 CAGGATGTGTGGAGGGGAGCAGG - Intronic
1168297070 19:55382619-55382641 CACCATTAGTGCAGAGAGGCAGG + Intronic
1168315568 19:55483422-55483444 CAGCACTGGAGGAGGGCAGCAGG - Exonic
1168719380 19:58546522-58546544 CAGCATTGGTGGAAGATAGCGGG + Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928040684 2:27873343-27873365 GAACATTTGTGGAGGGAAGGAGG - Intronic
928845619 2:35668143-35668165 AAGCATTAGTGTAGTGATGCTGG - Intergenic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929463479 2:42123624-42123646 ATGCATTAATGGAGAGAAGCAGG - Intergenic
929502841 2:42504920-42504942 CAGCATGACTGGAGTGAGGCTGG - Intronic
929811028 2:45189552-45189574 CAGCAGTGGGGAAGGGAAGCCGG - Intergenic
930393703 2:50793410-50793432 CATGTTTAGTGAAGGGAAGCAGG + Intronic
930768442 2:55108568-55108590 CAGCTCTAGTGGAGGGATGGGGG + Intronic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
931701521 2:64913081-64913103 CAGCAGTAGTGGCAGGAAGAAGG + Intergenic
938705174 2:133917522-133917544 CACCATTATTTGAGGGAAGTGGG + Intergenic
941949877 2:171143763-171143785 CAGCAGTAGAGGAGGGAAAGAGG + Intronic
942547384 2:177079137-177079159 CAGCATTAGAGGAGGGAGTGAGG - Intergenic
943171954 2:184413135-184413157 CAGCATAGGTGGAGGGGAACTGG - Intergenic
946239410 2:218344768-218344790 CAGGTTTGGTGGAGAGAAGCTGG - Intronic
946744892 2:222835861-222835883 CAGCTTTAGTAGAGAGAAGCTGG + Intergenic
947722576 2:232378786-232378808 CAGCATGTCTGGAGGGCAGCAGG - Exonic
948796318 2:240404009-240404031 CAGCATCCGTGGGTGGAAGCTGG + Intergenic
1171970506 20:31562092-31562114 CAGCCTTGGTAGTGGGAAGCAGG + Intronic
1172537992 20:35689073-35689095 AAGCATCAGTGCAGGGAAGGAGG + Intronic
1175644908 20:60662879-60662901 CAGCATGAGTGAAGGCAAGCAGG + Intergenic
1177012863 21:15750088-15750110 CAGCATCCGGGGAGGGAAGAGGG + Intronic
1177196896 21:17912706-17912728 CAGGATGAGAGGAGTGAAGCAGG - Intronic
1177260242 21:18720189-18720211 CAGCATTAGTGAATGTAAGGAGG + Intergenic
1177937776 21:27370506-27370528 CAGCATTAGGGGAAGCAAGGTGG + Intergenic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1179599324 21:42465585-42465607 CACCATTAATAGAGGGAGGCAGG - Intergenic
1182212188 22:28685898-28685920 CAGCATTTTGGGAGGGAGGCGGG + Intergenic
1182744330 22:32594079-32594101 CAGCTTTAGTGGAGTGGAGGGGG + Intronic
1183327605 22:37202937-37202959 CAGCATTATCAGAGGGGAGCTGG - Intergenic
1184437267 22:44486790-44486812 CAGCGTCAGTGGAGGTCAGCAGG - Intergenic
952645158 3:35648394-35648416 CTGCACTAGTGGATGGGAGCTGG + Intronic
953419315 3:42742294-42742316 CTGCATTGGAGGAGAGAAGCTGG + Intronic
954430292 3:50467218-50467240 CAGCAGCAGTGGAGAGGAGCTGG - Intronic
954904489 3:54048510-54048532 CAGCATAAATGGATGGAAACTGG + Intergenic
955832833 3:63022986-63023008 CAGCACCAGTGGAAAGAAGCAGG - Intergenic
961250200 3:125496686-125496708 GAGCATTAGTAGTGGTAAGCTGG - Intronic
961636485 3:128336124-128336146 CAGCTTCAGGGGAGGGGAGCTGG - Intronic
961683341 3:128613484-128613506 CAGCCTCAGTGGAGGGAGGGAGG - Intergenic
964562937 3:158018542-158018564 CAGCAATAGGGGAGGGATGTGGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
967142798 3:186576356-186576378 CAGCATTAGGGGAAGGAATTAGG + Intronic
967241163 3:187441055-187441077 CAGCATCAGTGCATGGAAGAGGG + Intergenic
967311457 3:188110264-188110286 CAGCATTACAGGAAGGAAGGAGG + Intergenic
967829444 3:193906185-193906207 CGTCAGTGGTGGAGGGAAGCAGG + Intergenic
968068463 3:195771839-195771861 CAGCATTCAGGGAGGGAAGTGGG + Intronic
972717362 4:41660795-41660817 CAGCACAAGTGGAGGAAAACAGG + Intronic
973248273 4:48034080-48034102 GAGCATTAGAGGAAGGAGGCTGG + Intronic
975297289 4:72749387-72749409 CAGCATTAGAGCAGGAAAACAGG - Intergenic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
979026885 4:115588674-115588696 CAGCATTGGTAGAGAGAAGCTGG + Intergenic
983382072 4:167008838-167008860 CAGCAAGAAGGGAGGGAAGCAGG + Intronic
984131424 4:175879729-175879751 AATAATTAGTGGAGGGAAGAAGG - Intronic
984373343 4:178894652-178894674 CAGCACCGGTGGAGGGAAGGAGG + Intergenic
984598303 4:181697047-181697069 CCTAATTAGTGGAGGGAGGCAGG - Intergenic
985164418 4:187077731-187077753 CTGCATAGGTGGAGAGAAGCTGG + Intergenic
985788880 5:1914865-1914887 CAGCAATAGGTGAGTGAAGCAGG + Intergenic
986036169 5:3942235-3942257 CAGCATGAGTGGAATAAAGCAGG - Intergenic
986074948 5:4326862-4326884 CAGCAGAGGTGGAGGGCAGCAGG - Intergenic
990201020 5:53374679-53374701 CAGCATCTATGGAGGAAAGCAGG - Intergenic
993723837 5:91346921-91346943 CAGCTTTCGTGGATGGCAGCAGG + Intergenic
994342155 5:98642948-98642970 CAGCAATGATGGAGGGCAGCAGG + Intergenic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996404076 5:123089748-123089770 CAGCATTGCTGGATGGGAGCTGG + Intronic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
998525153 5:142836130-142836152 AAACATTAGAGGAGGGAAGTGGG - Intronic
1001771428 5:174300002-174300024 CAGCAGTAAAGGAGGGCAGCTGG + Intergenic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1004184548 6:13410842-13410864 CAGCGTTAGTGTAGGGAGTCAGG - Intronic
1005494200 6:26374635-26374657 GAGCTGTAGAGGAGGGAAGCTGG + Intronic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1008593866 6:53021428-53021450 CAGGATTATAGGAGAGAAGCTGG - Intronic
1015725223 6:136292705-136292727 CAACAGTAGTAGTGGGAAGCAGG + Intergenic
1016378921 6:143453038-143453060 CAGAATTAGTGAAGGGGAACTGG + Intronic
1017519417 6:155188308-155188330 CAGGCATAGTGGAGTGAAGCTGG - Intronic
1017775618 6:157678786-157678808 CAGAATAGGTGGAGGGAACCAGG - Intergenic
1018725795 6:166612574-166612596 CAGGATTAGTGGAGGCAGTCGGG - Intronic
1019058815 6:169241566-169241588 CAGCATTGTTAGAGGGAAGTTGG - Intronic
1019105298 6:169662395-169662417 GAGCACTTGTAGAGGGAAGCTGG + Exonic
1019476975 7:1249000-1249022 GAGGCTTAGGGGAGGGAAGCAGG - Intergenic
1019573537 7:1725133-1725155 CAGGATTAGGGAGGGGAAGCAGG + Intronic
1022074622 7:26955172-26955194 CAGCATTATTCGAGGCCAGCCGG + Intronic
1022493674 7:30839721-30839743 CAGCATTAATGAAGGGGAGGCGG + Intronic
1023411457 7:39892798-39892820 CAGAATTGGTGGAGAGATGCTGG - Intergenic
1030978776 7:116161730-116161752 AAGCATTAGAGGAGTGAATCAGG + Intergenic
1031640267 7:124154348-124154370 CAGCACAAGTGGAGCCAAGCAGG - Intergenic
1036185216 8:6616720-6616742 CACCATTAGCAGAGGAAAGCTGG + Intronic
1037633140 8:20676566-20676588 CACCATTGGTGGAGGGACCCAGG + Intergenic
1039627464 8:39068726-39068748 CAGCATTCTGGGAGGGAAACAGG + Intronic
1039864710 8:41490694-41490716 CAGCATGGGTGAAGGGGAGCGGG + Exonic
1040790852 8:51228228-51228250 CAAGATATGTGGAGGGAAGCCGG + Intergenic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1044781093 8:95744277-95744299 CAGAATTAGAGGAGGAAACCTGG + Intergenic
1045007566 8:97929494-97929516 CAGCTTTAGTGGGTGGAGGCTGG - Intronic
1045871469 8:106932288-106932310 CAGCATTTGAGGAGAGATGCTGG + Intergenic
1048472572 8:134716613-134716635 CAGCATTTTTGGAAGGAACCTGG - Intergenic
1048946731 8:139455660-139455682 CAGCCTTCATGGAGGGAAGATGG - Intergenic
1049193184 8:141300216-141300238 CAGCTTTGTTGGAGGAAAGCAGG - Intronic
1049396791 8:142404655-142404677 CAGCTAGAGTGCAGGGAAGCCGG + Intergenic
1049552810 8:143268184-143268206 CATCATTAGGGGATGGAGGCTGG + Intronic
1050144507 9:2552243-2552265 CAGAATTTGTGGAAGGCAGCAGG + Intergenic
1051122465 9:13766181-13766203 CAGCAATAGTTGAAGGAACCAGG - Intergenic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1059326342 9:113506167-113506189 CAGCAGTAGGGGAGGCAAGCAGG + Intronic
1059801115 9:117750456-117750478 CAGCATTCATGGAGGAGAGCAGG - Intergenic
1061887994 9:133602442-133602464 TAGCATTGGTGGAGGGAAGCAGG - Intergenic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1188243478 X:27815186-27815208 CAGCCTTCATGGAAGGAAGCAGG - Intronic
1188245933 X:27835741-27835763 CAGCCTTCGTGGAAGGAAGCAGG - Intergenic
1190320371 X:49176344-49176366 CAGTCTTAGTGGAGGAAAGAAGG - Intronic
1195994098 X:110713957-110713979 GATCAATGGTGGAGGGAAGCTGG + Intronic
1199874233 X:151918993-151919015 TGGGATTGGTGGAGGGAAGCGGG + Intronic