ID: 1147905048

View in Genome Browser
Species Human (GRCh38)
Location 17:43817128-43817150
Sequence CCAGGTGACCAGAACACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147905048_1147905052 1 Left 1147905048 17:43817128-43817150 CCATCTGTGTTCTGGTCACCTGG 0: 1
1: 0
2: 2
3: 28
4: 263
Right 1147905052 17:43817152-43817174 ACCTGCTCAGGCCGCTCACTCGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147905048 Original CRISPR CCAGGTGACCAGAACACAGA TGG (reversed) Intronic
902070088 1:13727078-13727100 CCATGTGTCCAGAGCAGAGAAGG - Intronic
902411748 1:16215950-16215972 CCAGGAGGCAAGAACACGGAAGG + Intergenic
902565445 1:17308272-17308294 CAAGGTGCCCAGCACACACACGG - Exonic
903195659 1:21685882-21685904 CCAGGTGGCCAGATCACAGGGGG + Intronic
903287999 1:22288969-22288991 CTTGGTGAGCAGAGCACAGAAGG + Intergenic
903535876 1:24065983-24066005 CCAGGTGACCAACACCAAGAAGG - Exonic
904372418 1:30058240-30058262 CCAGGAGACCAGAACATAGGAGG + Intergenic
904380523 1:30107499-30107521 GCAGGTGCCCAGTACACAGTGGG - Intergenic
904454651 1:30640185-30640207 CGGGATGACCTGAACACAGAGGG - Intergenic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906650586 1:47509666-47509688 CCCAGTGCCCAGCACACAGACGG + Intergenic
909119171 1:71579209-71579231 CCATGTGACTGGAACACAGAGGG - Intronic
909477279 1:76094993-76095015 ACAGGTGACCAGAAATCACATGG - Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
913093594 1:115496382-115496404 CCAGGTGCCCAGAAACCAAAGGG + Intergenic
913496219 1:119430540-119430562 CCAGGTAACCATGACACAGGTGG - Intergenic
917470038 1:175318735-175318757 CCAGGTTACCATGACAGAGAGGG - Exonic
917634759 1:176924402-176924424 CCAGATGGCCAGCACAGAGAAGG - Intronic
919439742 1:197616999-197617021 CCAGGTGAAGAGAACAAGGAGGG + Intronic
920267162 1:204732755-204732777 GAAGGTGACTACAACACAGAGGG + Intergenic
921323369 1:213966070-213966092 CCATGTAAGCAGATCACAGAAGG - Intergenic
922729329 1:227941745-227941767 CCAGGCCCCCAGAACCCAGAAGG - Intronic
923028671 1:230228626-230228648 ACAGATGACCAGAACAGAAATGG - Intronic
923048212 1:230370864-230370886 ACATGGGACCAGATCACAGACGG - Intronic
1064457212 10:15498870-15498892 GCAGGTGATCAGGACACTGAAGG - Intergenic
1065240877 10:23703012-23703034 CCGAGGGACCAGAATACAGAGGG - Intronic
1065974016 10:30826945-30826967 CCAGGTGGCAAGAACACAGTGGG + Intronic
1067538547 10:47135306-47135328 CCAGCTGACCATAACTCAGCAGG - Intergenic
1068153359 10:53163191-53163213 CAAAGTGAGCAGAACACATATGG + Intergenic
1069551009 10:69364184-69364206 CCATGTAACCAGCACCCAGATGG - Intronic
1069760784 10:70809595-70809617 CCAAGTAACCACAAGACAGAGGG + Intergenic
1070357618 10:75655922-75655944 GCAGATGACCAGGTCACAGAGGG - Intronic
1071198056 10:83184607-83184629 CCAAGTGATCAGGACAGAGATGG + Intergenic
1072197812 10:93131610-93131632 CAAGCTGACCAGGCCACAGAAGG - Intergenic
1073208317 10:101780206-101780228 CCAGATCACCGCAACACAGACGG + Intronic
1075294534 10:121262720-121262742 TCATGTGACCACAACACAGAAGG + Intergenic
1075677835 10:124308578-124308600 CCAGTTGCCCTAAACACAGAGGG + Intergenic
1076070593 10:127485256-127485278 CCAGGGAAGCAGAGCACAGAGGG - Intergenic
1076196477 10:128522101-128522123 GCAGGTGACCTGGACAGAGAAGG - Intergenic
1076303116 10:129442689-129442711 CAAGGGCATCAGAACACAGAGGG + Intergenic
1076313435 10:129524062-129524084 CCAGGTCATCAGGACACAGTAGG - Intronic
1076895113 10:133307375-133307397 CCAAGTGATTAAAACACAGAGGG + Intronic
1076901427 10:133340297-133340319 CATGGTGCCCAGCACACAGAAGG + Intronic
1077199275 11:1297291-1297313 CCAGGCGCCCAGAGCACAGCAGG - Intronic
1077819704 11:5725022-5725044 CCAGGAGAGCAGAAAAGAGAAGG - Intronic
1078008919 11:7555190-7555212 CCACGTGGTCAGGACACAGAAGG + Intronic
1079120453 11:17680394-17680416 CCAGGTGAGCAGAAGCCATATGG - Intergenic
1084121311 11:67070632-67070654 CCAGGTGTCCAGAACGCTCAGGG + Intronic
1084191498 11:67501338-67501360 CCAGGTCATCTGCACACAGAGGG - Intronic
1085020751 11:73205333-73205355 CCAGGTGCCCAGAATACAGCAGG - Intergenic
1085453970 11:76655575-76655597 ACAGGGGCACAGAACACAGACGG + Intergenic
1085532639 11:77201052-77201074 CCGTGTGACCAGAGCACAGGGGG + Intronic
1086008930 11:82074699-82074721 CCTGGTGCCCAGCACACAGGAGG - Intergenic
1087676504 11:101168764-101168786 CCAGAGGACCAGAACAAGGAAGG - Intergenic
1088041076 11:105382822-105382844 ACAGGGGAGCAGAATACAGAAGG - Intergenic
1088183650 11:107139789-107139811 CCAGATAACCAGAAGACATATGG - Intergenic
1089614154 11:119685773-119685795 CCAGGTGAGCAGAGCAAAGGTGG - Intronic
1090186596 11:124743099-124743121 CCAGGTGGCCAGTCCACAGGTGG - Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1095407084 12:41878813-41878835 CCCGGTGACCAGCACACTCAAGG + Intergenic
1096231618 12:49900061-49900083 CCAGGTGGCCAGGCCACAGAGGG + Intronic
1101410711 12:104465707-104465729 CCATGTGCGCAGAACTCAGAAGG + Intronic
1101528240 12:105551084-105551106 CCAGGTGGCCAGAGCAGAGGAGG - Intergenic
1102305227 12:111799740-111799762 CAAGCTCAGCAGAACACAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1103448529 12:121010992-121011014 CCAGGTGAACAAGACACACATGG - Intronic
1104779939 12:131413584-131413606 TCCGGGGACCAGAGCACAGAGGG + Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105284498 13:18993339-18993361 CCAGAAGGCCAGAAAACAGAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284806 13:18995184-18995206 CCAGAAGGCCAGAAAACAGAAGG + Intergenic
1105474360 13:20718017-20718039 CCAGGTGACGAGAACTCAGAGGG + Intronic
1106413576 13:29527670-29527692 CCAGCTGAGTGGAACACAGAAGG - Intronic
1107809444 13:44186234-44186256 AAAGGTGATTAGAACACAGAGGG - Intergenic
1108474326 13:50798822-50798844 CCAGGGTTCCAGAATACAGAAGG - Intronic
1108761540 13:53572127-53572149 CAAGGTTACCTGAACACAAAAGG + Intergenic
1109986449 13:69992547-69992569 TGAGGAGACCAAAACACAGAAGG + Intronic
1111538850 13:89643498-89643520 AAAGGTGCCCAGAACACACATGG - Intergenic
1112720168 13:102235427-102235449 CCAGGTGACCAGGGCACTTATGG - Intronic
1112957025 13:105072935-105072957 CAAGGTGAACACTACACAGAGGG + Intergenic
1114864455 14:26571593-26571615 CCACGTGGCTAGAACACAGAGGG + Intronic
1115108546 14:29791041-29791063 CCAGGTGACTAAAAGACAGTAGG + Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117013049 14:51490519-51490541 CACGGTGCCCAAAACACAGAAGG - Intronic
1118270422 14:64338219-64338241 CGGGGTGACCCCAACACAGAGGG + Intergenic
1118599966 14:67465132-67465154 GCTGGTGACCGGCACACAGAGGG + Intronic
1118909449 14:70049151-70049173 CCAGCTGCCCAGAAGACAGCTGG - Intronic
1119145610 14:72310992-72311014 CCAGGTGGCTGGAACACAGCAGG - Intronic
1119879795 14:78091253-78091275 CCAGATGGCCAGATCAAAGAGGG - Intergenic
1120258656 14:82153968-82153990 CCAGTTGACCAGGAGACAGAAGG + Intergenic
1120695659 14:87641636-87641658 CCAAGGCACCAGAATACAGATGG + Intergenic
1120861548 14:89259385-89259407 CCTAGTGACCAGAGCAAAGAGGG - Intronic
1121902640 14:97707870-97707892 GCTGGTGACGAGACCACAGAAGG - Intergenic
1122241302 14:100369573-100369595 CCCAGTGCCCAGAACACAGGAGG + Intronic
1122374544 14:101249195-101249217 CCTGTTGACCAGGACAGAGATGG - Intergenic
1122578303 14:102755597-102755619 CCATGTGCTCAGGACACAGAGGG - Intergenic
1122793385 14:104193729-104193751 CCAGGTGACCTGGGCACAGGGGG + Intergenic
1122940820 14:104980605-104980627 CCAGGTGACCAGAGCAGGGTGGG - Intergenic
1123771665 15:23535611-23535633 CCAGGTATGCAGAACACAGCAGG + Intergenic
1124256240 15:28145124-28145146 CCAGGTGTCCAGCACACACCAGG + Intronic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1125214675 15:37257547-37257569 ACAGGTGACCAAAGCACAAATGG + Intergenic
1125602616 15:40923785-40923807 CCTGCTGACCAGCACCCAGAAGG + Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126961823 15:54005028-54005050 ACAGGTGACCAGAGCAAACATGG - Intergenic
1128704001 15:69825379-69825401 CCATGTGCCCAGAACAAAGCAGG - Intergenic
1130811979 15:87389355-87389377 CCAGGTAACCAGCACACCAATGG - Intergenic
1130814694 15:87419122-87419144 CCATGTTACTGGAACACAGAAGG - Intergenic
1133768898 16:8856369-8856391 CCTCGTGACCAGATCAAAGAGGG - Intronic
1137063417 16:35812255-35812277 GATGGTGACAAGAACACAGAGGG + Intergenic
1138060982 16:53889968-53889990 CGAGGAGACCAAAACACAAAGGG + Intronic
1139365440 16:66429553-66429575 CCAGCTGCCCAGAACAGGGATGG + Intronic
1140973582 16:80037610-80037632 AAAGGAGACCAGAGCACAGAGGG + Intergenic
1141475780 16:84272258-84272280 GAAGGGGACCAGAGCACAGAGGG + Intergenic
1141815830 16:86408701-86408723 CCAGGTATCCAGAGCAGAGAGGG - Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1142496993 17:311175-311197 CCTGGGGACCTGAAAACAGAGGG - Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1144303849 17:13949387-13949409 CCAGGTAACCTGAACAAAAATGG + Intergenic
1144753745 17:17667481-17667503 CCAGGTTCCCAGAAGCCAGAGGG + Intergenic
1144773761 17:17773666-17773688 CCTGATGCCCAGCACACAGAGGG + Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146816221 17:35944307-35944329 TCAGGTCACCATATCACAGATGG - Intergenic
1147351006 17:39843838-39843860 TCATGTGACCTGATCACAGATGG - Intronic
1147447937 17:40486271-40486293 GCAGATGATGAGAACACAGAGGG - Intronic
1147798249 17:43061462-43061484 CCTAGTGCCCAGAACACAGTAGG + Intronic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1148834873 17:50460779-50460801 CCTGGAGACCACAGCACAGAGGG + Exonic
1149693443 17:58597786-58597808 CATGGTGACCAGTACATAGAAGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1152736491 17:81999897-81999919 CCAGGGGGACAGAAAACAGAGGG - Intronic
1152993638 18:385846-385868 ACTGGTTACCAGAACAAAGAGGG + Intronic
1153673872 18:7438470-7438492 CCAGGGGACCGGAACTCAGGTGG + Intergenic
1153676368 18:7459235-7459257 CCAGGTGACCTGTACATAGAGGG - Intergenic
1155296384 18:24388297-24388319 CAAGGTGCCTAGAACACAGTAGG + Intronic
1155474479 18:26224582-26224604 CTTGGTGACCAGCACACAGGAGG + Intergenic
1155673391 18:28399394-28399416 TCAGGTCAACAGAACTCAGAGGG + Intergenic
1157271771 18:46281766-46281788 CAAGGAAACCTGAACACAGAGGG - Intergenic
1157799029 18:50603382-50603404 CCCTGTGACCACAACAAAGAGGG + Intronic
1161777364 19:6270875-6270897 CCCAGTGAGCAGCACACAGACGG + Intronic
1162540196 19:11291000-11291022 CCAGCTGCCCAGACAACAGAGGG + Intergenic
1165134100 19:33654863-33654885 CCAGAAGTCCTGAACACAGATGG - Intronic
1165484322 19:36086292-36086314 CCAGGTAGCCAGACCTCAGAGGG + Intronic
1167296797 19:48655116-48655138 CCAGGAGACTGGAACCCAGAAGG - Intergenic
1168407797 19:56120078-56120100 CAAGGTGACCAGACCCCTGATGG - Intronic
924991396 2:315809-315831 ACAGGGGACCAGAAGACAGGAGG - Intergenic
925454124 2:3999717-3999739 TCAGGTGATCTGAACACAGGTGG - Intergenic
925802042 2:7611044-7611066 CCAGGTGAGCAGAGCAGACAGGG - Intergenic
926426557 2:12743835-12743857 CCAGGTGCTAAGGACACAGAAGG - Intergenic
926654050 2:15379795-15379817 CAAGGCGACTAGAGCACAGAAGG + Exonic
927819025 2:26245782-26245804 GAAGGTGACCAGAGCACAGCAGG - Intronic
928335598 2:30395373-30395395 CCAGGAGCCCTGAACCCAGAGGG + Intergenic
929311340 2:40429531-40429553 CCAAGCGAACACAACACAGATGG + Exonic
930418362 2:51118407-51118429 ACAGGTAACCATAATACAGAAGG - Intergenic
931843285 2:66176990-66177012 CCAGATGCCCTGAAGACAGATGG + Intergenic
932334660 2:70923140-70923162 CAAGGAGCCCAGAACACAGCTGG + Intronic
932981168 2:76669066-76669088 CCAAGTAACCATAAAACAGATGG - Intergenic
933770483 2:85741114-85741136 CCAGGTGATTAGGACACAGGCGG + Intergenic
934163561 2:89274236-89274258 CCAGGGAACTAGAACCCAGAGGG + Intergenic
934203712 2:89908288-89908310 CCAGGGAACTAGAACCCAGAGGG - Intergenic
935483582 2:103624020-103624042 CCAGGTGAAGAGAAAACACACGG - Intergenic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
937791009 2:125961753-125961775 CCAGGTGACCAGGACCCACCAGG + Intergenic
938555308 2:132418120-132418142 GCACGAGACCAGAACCCAGAAGG + Intronic
940927658 2:159384025-159384047 GCAGGATACCAGAACACACATGG + Intronic
941643512 2:168014936-168014958 CCAGGAGTCCTGAAAACAGAAGG - Intronic
942481434 2:176392692-176392714 CCTCCTGACCAGGACACAGATGG - Intergenic
944874030 2:203943730-203943752 CCTGGTTAGCAGAACACAAAGGG - Intronic
947866583 2:233402070-233402092 GCAGGTGACCCGTACACACAGGG - Intronic
948741252 2:240047540-240047562 GCAGGTCACTGGAACACAGATGG + Intergenic
1170571507 20:17635382-17635404 TCAGGGGCCCAGAACCCAGACGG + Intronic
1171426524 20:25051984-25052006 CATGGTGGCCAGAACAAAGATGG - Intronic
1172868315 20:38117787-38117809 CAATGTGACCAGCACACAGCTGG - Intronic
1173393949 20:42660706-42660728 ACTGGTGACCAGAACAGACAAGG + Intronic
1174397627 20:50257660-50257682 CCATGTGCCCGGAACACAGTAGG - Intergenic
1174553891 20:51380535-51380557 CCAGGTGACCTGCACACATGAGG - Intergenic
1175020372 20:55841224-55841246 CCAGGTGCCAAGAATACACAGGG + Intergenic
1175646517 20:60677800-60677822 CCATGTGAACAACACACAGAGGG - Intergenic
1175871454 20:62211278-62211300 CCTGGTGCCCAGAACACAGTAGG + Intergenic
1176130756 20:63495837-63495859 CCAGGTGAGCAGGGCACAGCAGG - Exonic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1177357755 21:20031191-20031213 CAAGGAGAACAGAAGACAGATGG - Intergenic
1179587050 21:42380065-42380087 CCAGGGGCTCAGAACCCAGAGGG - Intronic
1179727951 21:43350717-43350739 CCAGGTGGCAAGCACACAGTTGG - Intergenic
1180142176 21:45899352-45899374 CCACCTGACCAGGACAGAGATGG - Intronic
1180187944 21:46149686-46149708 CCAGGTGTCCACAAGACAAAAGG + Intronic
1180303412 22:11054900-11054922 CCAGATGGCCACAACACAGCTGG - Intergenic
1181412624 22:22734814-22734836 CCAGGAGACCCGGACACGGAGGG - Intronic
1181428093 22:22856784-22856806 CCAGGAGACCCGGACACGGAGGG - Intronic
1183473879 22:38025075-38025097 CCAGGACACCAGGAGACAGAAGG - Intronic
1183686677 22:39365040-39365062 CCAGGTCACCAGCAAGCAGAGGG - Intronic
1184334338 22:43844612-43844634 CCAGGTGTGCAGAGCTCAGAGGG - Intronic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
950704582 3:14771985-14772007 CCAGGCTCCCAGAACACTGATGG + Intronic
953295484 3:41711232-41711254 GCAGATGACCACAACACAGGGGG + Intronic
954258118 3:49420181-49420203 CAAGGTGTCTAGAACACAGAGGG + Intronic
954934983 3:54318208-54318230 CCAGGAGAGAAGAGCACAGACGG + Intronic
956931638 3:74050119-74050141 ACAGGTGAGCTGAACACACAGGG - Intergenic
959765058 3:110016479-110016501 CAAGGTGAACAGAACAAAGAAGG - Intergenic
962481379 3:135801385-135801407 CAAAGTGACGAGGACACAGAGGG + Intergenic
963223122 3:142832702-142832724 CCAGGTGCCCAGCACACAGCCGG + Intronic
963767152 3:149349451-149349473 CAAAGTCACCACAACACAGAAGG + Intergenic
965517197 3:169634195-169634217 CCAAGTCTCCAGAACACACATGG + Intronic
967106185 3:186256634-186256656 CCAGGTGACTAGGACATATAGGG - Intronic
969260603 4:6030921-6030943 CCAGGTGATGAGGACGCAGACGG + Intronic
971802968 4:31316766-31316788 CCAGGGGACCAGAATCCTGAAGG - Intergenic
972882878 4:43447467-43447489 ACAAGTGACCTGAACAGAGAAGG - Intergenic
974328905 4:60450965-60450987 CCAGCTGGCTAGAACACAGCAGG + Intergenic
982606612 4:157523963-157523985 CCAGGTGACTGGAATAAAGAGGG - Intergenic
984120051 4:175730913-175730935 CCAAGAGACCAGAAAACTGATGG - Intronic
985622233 5:961698-961720 CCATGTGACCAGAGCACAAGTGG - Intergenic
986043145 5:4012324-4012346 CCAGGTGTCCTGGAGACAGAAGG + Intergenic
986628098 5:9741727-9741749 CCAGGTGACCGGGACACAGTGGG + Intergenic
987860254 5:23477179-23477201 CCATGTTCCCACAACACAGAAGG - Intergenic
989541944 5:42628127-42628149 CCAGCTGACCAGCAGACAGATGG - Intronic
989772490 5:45161401-45161423 CAAGGTGACCAGAAGACAGTGGG - Intergenic
992659664 5:78945831-78945853 CCAGATAAGCAGAACACAGGTGG - Intronic
993367843 5:87054846-87054868 GAAGGAGACCAGAACACAGAAGG - Intergenic
993573969 5:89578553-89578575 ACAGGTGATCAGAAGAAAGATGG + Intergenic
995190347 5:109312846-109312868 CCAGGAGCCCAGTATACAGAAGG - Intergenic
997432622 5:133851245-133851267 CCAGGGAACCAGAAGACAGGGGG + Intergenic
998522073 5:142810178-142810200 GCAGGGGAACAGATCACAGAGGG + Intronic
999284606 5:150386771-150386793 CCAGCTAACGAGAACACACATGG - Intronic
999871451 5:155755685-155755707 CAGGGTTACAAGAACACAGAAGG - Intergenic
1000197514 5:158973674-158973696 CCAAGTAACTAGCACACAGAAGG + Intronic
1001779949 5:174359634-174359656 CCAGGTGCCCAGAGCAGAGTAGG - Intergenic
1002401492 5:178993838-178993860 GCAGGAGACCAGAGCTCAGAAGG + Intronic
1002571473 5:180142035-180142057 CCACGTGCACAAAACACAGATGG - Intronic
1003617664 6:7670198-7670220 CCAGGTGACCAGGATTCAAAAGG + Intergenic
1003978868 6:11370740-11370762 CCATGTGCCAAGAACACAGCAGG + Intronic
1004188868 6:13446892-13446914 CTAGGTGTCCAAAACAGAGATGG + Intronic
1004301099 6:14458059-14458081 CCTGGTGACCACCTCACAGAAGG - Intergenic
1004470258 6:15922603-15922625 CCAGATGACCAGAACACACAAGG - Intergenic
1006411774 6:33877978-33878000 CCAGGTACCCAGAATAAAGAAGG + Intergenic
1006443649 6:34067221-34067243 AAAGGTCACCAGACCACAGATGG - Intronic
1007329903 6:41098122-41098144 CCAGATGACCAGTCAACAGAGGG - Exonic
1007717969 6:43868254-43868276 CCAGCTCTCCAGAACATAGAAGG + Intergenic
1007737755 6:43992340-43992362 CCACGTGACCTGAACATAGTAGG + Intergenic
1007785085 6:44275300-44275322 CCAGGCAACCAGAGCACAGATGG + Intronic
1008508496 6:52254168-52254190 CCAGGTGAGCAGAACTGAAATGG - Intergenic
1009835354 6:68993821-68993843 CCAGGTGACCAAGACACTGTTGG + Exonic
1011002165 6:82603432-82603454 CCAGGTCTCCAGCTCACAGATGG - Intergenic
1012976030 6:105781725-105781747 ACAGGTGAACAGATCACACAGGG + Intergenic
1013247193 6:108297970-108297992 CAAAGTGCCTAGAACACAGAAGG - Intronic
1013355336 6:109341412-109341434 CCAGCTGAGCAGGACAGAGAAGG + Intergenic
1014223817 6:118825244-118825266 CCAGGAGACCAAAAGAAAGAGGG + Intronic
1015886549 6:137924011-137924033 CTAAGTGACCAGAACACAATGGG - Intergenic
1017918629 6:158852877-158852899 AAAGGCTACCAGAACACAGAAGG + Intergenic
1018580079 6:165301098-165301120 CCAGCTGACCAGTTCCCAGAAGG + Intronic
1018600645 6:165536126-165536148 CCAAGAGAACAGAACACAGATGG + Intronic
1018601898 6:165552922-165552944 CCAGTTCACAAGATCACAGACGG + Intronic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019006324 6:168799746-168799768 CCAGGTGAGGAGAACATGGAGGG - Intergenic
1019357812 7:590101-590123 CCTGGAGACCAGAAGACAGAGGG + Intronic
1022008216 7:26286669-26286691 GCAGGAGAATAGAACACAGAAGG + Intergenic
1022981689 7:35610536-35610558 AGAGGTGACCAGACCCCAGATGG + Intergenic
1023001655 7:35814024-35814046 CCCAGTGACCAGCACACAGCAGG - Intronic
1026078585 7:67196867-67196889 CCTGGTGTCCAGAACTCAGCAGG - Intronic
1026461393 7:70618331-70618353 CAGGGTGACCAGATCACAGGAGG - Intronic
1026698237 7:72615115-72615137 CCTGGTGTCCAGAACTCAGCAGG + Intronic
1030028293 7:105346384-105346406 CATGGTGACTGGAACACAGAGGG + Intronic
1033020211 7:137717104-137717126 CGAAGTGACCAGCACATAGAAGG + Intronic
1033516658 7:142113408-142113430 CCAAGTGACCAGCACAAACAGGG - Intronic
1034734852 7:153419199-153419221 CCATGTGACAAAAACAAAGAAGG + Intergenic
1035185208 7:157121040-157121062 CCAGGTGAGCACAGCACAGATGG + Intergenic
1035907694 8:3531578-3531600 CCACGGGGCCAGACCACAGATGG - Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037950762 8:23017571-23017593 CCACGTAACCAGGACCCAGAGGG + Exonic
1038808389 8:30814916-30814938 CCAGTTGAACAAAACACAAAAGG + Intergenic
1047344899 8:124018136-124018158 GCAGGTTCCCAGGACACAGAGGG - Intronic
1047446758 8:124927054-124927076 GCACGTGGCCAGAACCCAGAGGG + Intergenic
1052788784 9:32854793-32854815 CCAAGTGTCCAGAACACAGTTGG - Intergenic
1056135755 9:83628248-83628270 CAAGGAGACCAGAACACAATGGG - Intronic
1056811819 9:89771052-89771074 CCAGGTGCCCTGGACACAGATGG - Intergenic
1060418485 9:123450178-123450200 CCAAGTGAGCAGAACCCAGTGGG - Intronic
1060741039 9:126097760-126097782 CCCGGGGACCAGAACAGAGAAGG - Intergenic
1061824022 9:133246796-133246818 CCGGGAGAGCAGAACACAGTGGG + Intergenic
1062734506 9:138127775-138127797 CCAGGTGACCCCAGCACAGGAGG + Intergenic
1186570941 X:10714234-10714256 CCAAATGACCAGCACAAAGAAGG - Intronic
1191097524 X:56688995-56689017 CCAGGTGAGACCAACACAGAAGG - Intergenic
1191612362 X:63131349-63131371 CCAGGGGTCCATGACACAGAAGG - Intergenic
1191623935 X:63247577-63247599 CCAGGGGTCCATGACACAGAAGG + Intergenic
1191794644 X:65007932-65007954 TCAGGTGACCAAAACAAAAATGG + Intronic
1192406156 X:70887871-70887893 CCAGGCTTCCAGAACAGAGAGGG + Intronic
1193468115 X:81871172-81871194 TCAGGGGAACAGAACCCAGAAGG - Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195063527 X:101219146-101219168 CCAAGTGCCCAGCACACAGTAGG - Intergenic
1195688598 X:107605977-107605999 CCATGTGCCCATCACACAGAGGG - Intergenic
1195916557 X:109941825-109941847 GCAGATGACCACAACACACAGGG + Intergenic
1198255575 X:134921524-134921546 TAAAGTGACTAGAACACAGAAGG + Intergenic
1199405371 X:147452254-147452276 CCAGCTGACTAGAACAAAGCAGG + Intergenic
1199622810 X:149714606-149714628 CCTCCTGGCCAGAACACAGAGGG + Intronic
1199628504 X:149760904-149760926 CCTCCTGGCCAGAACACAGATGG + Intergenic