ID: 1147907298 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:43831728-43831750 |
Sequence | TGCCCCCGAGGAGCCCGAGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 101 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 91} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1147907290_1147907298 | 28 | Left | 1147907290 | 17:43831677-43831699 | CCTGGGGAGAGGTGAGAAAAACA | 0: 1 1: 1 2: 3 3: 31 4: 393 |
||
Right | 1147907298 | 17:43831728-43831750 | TGCCCCCGAGGAGCCCGAGTGGG | 0: 1 1: 0 2: 0 3: 9 4: 91 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1147907298 | Original CRISPR | TGCCCCCGAGGAGCCCGAGT GGG | Intronic | ||