ID: 1147907298

View in Genome Browser
Species Human (GRCh38)
Location 17:43831728-43831750
Sequence TGCCCCCGAGGAGCCCGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147907290_1147907298 28 Left 1147907290 17:43831677-43831699 CCTGGGGAGAGGTGAGAAAAACA 0: 1
1: 1
2: 3
3: 31
4: 393
Right 1147907298 17:43831728-43831750 TGCCCCCGAGGAGCCCGAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147907298 Original CRISPR TGCCCCCGAGGAGCCCGAGT GGG Intronic