ID: 1147907824

View in Genome Browser
Species Human (GRCh38)
Location 17:43834046-43834068
Sequence CTGCTGGGATTGAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147907824_1147907835 11 Left 1147907824 17:43834046-43834068 CCCCCTTCCCTCAATCCCAGCAG No data
Right 1147907835 17:43834080-43834102 ACAGCACATGTCAGGAGAGGTGG No data
1147907824_1147907837 30 Left 1147907824 17:43834046-43834068 CCCCCTTCCCTCAATCCCAGCAG No data
Right 1147907837 17:43834099-43834121 GTGGACCCAGAGGTTAAGTCTGG No data
1147907824_1147907836 20 Left 1147907824 17:43834046-43834068 CCCCCTTCCCTCAATCCCAGCAG No data
Right 1147907836 17:43834089-43834111 GTCAGGAGAGGTGGACCCAGAGG No data
1147907824_1147907833 3 Left 1147907824 17:43834046-43834068 CCCCCTTCCCTCAATCCCAGCAG No data
Right 1147907833 17:43834072-43834094 AGAACGGCACAGCACATGTCAGG No data
1147907824_1147907834 8 Left 1147907824 17:43834046-43834068 CCCCCTTCCCTCAATCCCAGCAG No data
Right 1147907834 17:43834077-43834099 GGCACAGCACATGTCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147907824 Original CRISPR CTGCTGGGATTGAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr