ID: 1147910267

View in Genome Browser
Species Human (GRCh38)
Location 17:43851986-43852008
Sequence TGACCTTGAGCTTGTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147910266_1147910267 1 Left 1147910266 17:43851962-43851984 CCAGGGAAGACATTACAGAGGAG 0: 1
1: 0
2: 2
3: 49
4: 285
Right 1147910267 17:43851986-43852008 TGACCTTGAGCTTGTGCTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147910267 Original CRISPR TGACCTTGAGCTTGTGCTGA AGG Intronic