ID: 1147911408

View in Genome Browser
Species Human (GRCh38)
Location 17:43858337-43858359
Sequence GCCTCCTGGCTCTGCGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147911400_1147911408 -8 Left 1147911400 17:43858322-43858344 CCACCTCCAAGCCCGGCCTCCTG 0: 1
1: 0
2: 3
3: 100
4: 907
Right 1147911408 17:43858337-43858359 GCCTCCTGGCTCTGCGGGCTAGG 0: 1
1: 0
2: 2
3: 37
4: 303
1147911398_1147911408 -1 Left 1147911398 17:43858315-43858337 CCACTGGCCACCTCCAAGCCCGG 0: 1
1: 0
2: 3
3: 31
4: 302
Right 1147911408 17:43858337-43858359 GCCTCCTGGCTCTGCGGGCTAGG 0: 1
1: 0
2: 2
3: 37
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147911408 Original CRISPR GCCTCCTGGCTCTGCGGGCT AGG Intronic
900393199 1:2442810-2442832 GCCTCTTGGCTCTGTGGCCAAGG + Intronic
900562392 1:3313725-3313747 GCCTCCTGCCCCGGCGGGCCTGG + Intronic
900792897 1:4691456-4691478 GCCTGCTGGCCCTTTGGGCTGGG + Intronic
901631317 1:10649537-10649559 CTCTGCTGGCTCTGAGGGCTGGG - Intronic
901666195 1:10827665-10827687 GGCTCCTGGCCCTGCATGCTAGG - Intergenic
902336803 1:15758789-15758811 GGCTCCGGGCTCCGCTGGCTCGG + Intronic
902779932 1:18698610-18698632 GCTTCCAGGCTCTGCGGGAAGGG - Intronic
902863618 1:19262935-19262957 CAATCCTGGCTCTGCGGCCTTGG + Intergenic
902983211 1:20139966-20139988 GCCTCCTGGCTCTGCCATCTGGG + Intronic
903282451 1:22257697-22257719 GAATCCTGGCTGTGCGGCCTTGG - Intergenic
904120331 1:28193961-28193983 GCCCCCGGGCTCTGCTGGGTGGG + Intergenic
904798591 1:33076532-33076554 GGCTCATGGCTCTGGAGGCTGGG + Intronic
906004426 1:42456601-42456623 GCCTCCCGGTGCTGCGCGCTGGG + Exonic
906735615 1:48123838-48123860 GCCCCCTGGCTCTTTGGTCTAGG - Intergenic
906844929 1:49181475-49181497 ACCTCCTGGCTGTGGGGACTTGG + Intronic
915530058 1:156498203-156498225 GCATCCTGGCTCTGCCCCCTTGG - Intronic
916463431 1:165049177-165049199 CCATCCTGGCTCTTAGGGCTGGG - Intergenic
917795184 1:178528218-178528240 CCCTCTTGGCTCTGTGGCCTTGG + Intronic
918159331 1:181882746-181882768 GCCTGCTGCCTCTGGGGGCAGGG + Intergenic
920507421 1:206526338-206526360 GCCTCCAGGCCCTCCGGGCTGGG + Intronic
920649711 1:207827654-207827676 CCCTCCTGGCTCTGCCTGCTGGG + Intergenic
921160964 1:212471978-212472000 GCCTCCTGGCTCTGGGAGTGCGG + Intergenic
921706082 1:218323914-218323936 GCCCCCTGCCCCTGCAGGCTCGG - Intronic
922484042 1:225959456-225959478 GGCTCAGGGCTCTGTGGGCTTGG - Intergenic
923027486 1:230217494-230217516 GCCTCCAGGCTCCTAGGGCTTGG - Intronic
924738406 1:246779940-246779962 CCCTCCTGGCCCTGTGGGCCTGG - Intergenic
1063097411 10:2920722-2920744 GCCTCCTGGCCCTCCGGGAGTGG - Intergenic
1065727329 10:28678181-28678203 TCCTCCTGGCTCTGCCTGCGGGG + Intronic
1066199925 10:33134828-33134850 GCCTCCTCGAGCTGGGGGCTAGG - Intergenic
1069808049 10:71138204-71138226 GCCACCTGGCTCTGCTCTCTTGG - Intergenic
1070570718 10:77637939-77637961 GCCCCCTGGCTCTCGGCGCTCGG - Intronic
1072642976 10:97227286-97227308 GGCACCTGGATCTGTGGGCTTGG + Intronic
1072985561 10:100136710-100136732 GGCTCATGGCTCTGGAGGCTGGG - Intergenic
1073186109 10:101615854-101615876 GCTTCCTAGCTCTGCAGACTTGG - Intronic
1073424291 10:103446956-103446978 GTCACCTGGCCCTGCTGGCTGGG + Exonic
1074423583 10:113330949-113330971 GGCTCATGGTTCTGAGGGCTGGG + Intergenic
1074530812 10:114297531-114297553 CCCTCCTGGCTCTGAGTGTTGGG - Intronic
1075443029 10:122494435-122494457 GCCTCCCGGCTTTGCCTGCTTGG + Intronic
1076084119 10:127610252-127610274 CCATCCTGGCCCTGCGGGTTAGG - Intergenic
1076903113 10:133349664-133349686 GCCTCAGGGCTCTGTGGGCGTGG + Intronic
1077250082 11:1557062-1557084 GCGTCCGGGCTGTCCGGGCTGGG + Exonic
1077402549 11:2366345-2366367 GGCTCCTGGCTCTGCCCGCCTGG + Intergenic
1077468689 11:2746718-2746740 GTCTCCTGGCTCTGAGGCCGTGG + Intronic
1077610992 11:3642916-3642938 TCCTCCTGGCTCTGGCTGCTAGG - Intergenic
1080856978 11:36120987-36121009 TCCTCCTGGTTCTGGAGGCTGGG - Intronic
1080908814 11:36574617-36574639 TCCTGCTGGCTCTGAGGGCGAGG + Exonic
1081573630 11:44306335-44306357 GCCTCCAGTCTCTGCTGGCCGGG - Intronic
1084303768 11:68268027-68268049 GTGTCCTGGCCCTGCAGGCTGGG - Intronic
1084312638 11:68325748-68325770 TGCTCCTAGCTCTGCGGTCTGGG + Intronic
1084335249 11:68453748-68453770 GCCTCCTAGCTCTGCCTCCTGGG - Intergenic
1084445567 11:69201743-69201765 GCCTGCTGGCTCTGGGATCTGGG + Intergenic
1084535100 11:69751817-69751839 GTCTCCTGGCGCTCCGGACTAGG - Intergenic
1085013138 11:73155222-73155244 GCCTCCTCTCTCTGCTGCCTTGG + Intergenic
1088793801 11:113249962-113249984 GCATCCTTGCTCTGCAAGCTGGG + Intronic
1089299648 11:117490881-117490903 GCCTCCTGGCCCTGCTAGCCCGG - Intronic
1089676108 11:120090770-120090792 TCCTCCTGGCCCTGTGGGGTTGG - Intergenic
1089678401 11:120105842-120105864 GCCACCTGGCTCTGGTGTCTGGG - Intergenic
1090075376 11:123577434-123577456 CCGTCCTGGTTCTGCGGGGTTGG - Exonic
1090420783 11:126573471-126573493 CCCTCCTTGCTGTGTGGGCTGGG - Intronic
1091064515 11:132496532-132496554 GCCTCCTGCCACTCTGGGCTTGG + Intronic
1096816836 12:54207112-54207134 GCCTGCTGGCTGTGCAGTCTTGG + Intergenic
1096973960 12:55688010-55688032 TCCTCCTGGCTGTACTGGCTGGG - Exonic
1097106641 12:56629944-56629966 GTCTCCTTGCTCTGGGGTCTGGG - Intronic
1098577808 12:72063607-72063629 GTCTCCTGGCTCTGCAGACTGGG - Intronic
1102305048 12:111798487-111798509 GACTCCTGGCTCTGAGGGCCAGG - Intronic
1103595258 12:122021538-122021560 GCCGCCGCGCTCTGGGGGCTGGG + Exonic
1103918190 12:124386563-124386585 ACCTCCTGGTTGTGCGGGTTGGG - Intronic
1104859108 12:131915562-131915584 ACCTCCTGGCTGTGTGGGCTGGG + Intronic
1105930094 13:25044275-25044297 GTCTCCTGGTGCTGGGGGCTGGG - Intergenic
1109944975 13:69421012-69421034 CCCTCCTGCCCCTGCAGGCTTGG - Intergenic
1112243866 13:97710339-97710361 GGCTCTTGACTCTGCTGGCTGGG - Intergenic
1112771780 13:102800403-102800425 GCCCTTGGGCTCTGCGGGCTGGG + Intronic
1113607663 13:111622099-111622121 GCCGCCTGCATATGCGGGCTGGG - Intronic
1119663236 14:76466026-76466048 CCCTCCTGGCTCTGCAGGCAAGG + Intronic
1120979547 14:90278272-90278294 GCCTCCTAGCTCCGCAGGGTGGG + Exonic
1122091597 14:99344328-99344350 GTCTGCTGGCTCTGAGGGCCGGG + Intergenic
1122252053 14:100446792-100446814 CACTCCTGGCTCTGTGGGCGTGG + Intronic
1124426846 15:29570207-29570229 CCCTCCGGCCGCTGCGGGCTCGG + Intronic
1124614912 15:31234431-31234453 GCCTCCTGGCTCTGCTGAATTGG - Intergenic
1125891225 15:43268648-43268670 ACCTCCCAGCTCTGAGGGCTGGG + Intergenic
1128562503 15:68677999-68678021 GCCTCCTGGGCCAGGGGGCTGGG - Intronic
1129716556 15:77855142-77855164 GGCTCCTTGCTCAGCTGGCTGGG + Intergenic
1130203927 15:81858411-81858433 GCCTCGTCACTCTGTGGGCTTGG - Intergenic
1132314661 15:100880724-100880746 GCCTCCTCGCTCTGTGGGCTGGG + Intronic
1132683726 16:1153791-1153813 GCCCCCTGGCCCTGCGGCGTTGG + Exonic
1132699201 16:1215117-1215139 CCCTCAGGGCTCTGGGGGCTGGG + Intronic
1132716077 16:1290414-1290436 GGCTGCTGGCTGTGCGGGCAGGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133113860 16:3564935-3564957 CCCTCATGGATCTGCTGGCTGGG - Exonic
1133323765 16:4931030-4931052 GGCTGCTGGCTCTGCAGGCAGGG + Intronic
1133967455 16:10541780-10541802 CGCTCCTGGCTATGCGGCCTTGG + Intronic
1134021340 16:10923498-10923520 TCCTCCAGGCTTTGCGAGCTTGG + Intronic
1134189193 16:12108272-12108294 GCCACCTGGCTCTTGAGGCTGGG + Intronic
1134452276 16:14370889-14370911 CCCTCCTGGGTCTGCGGGTTAGG - Intergenic
1134630565 16:15753045-15753067 ACCTCCTAGCTCTGTGGTCTTGG - Intronic
1134909916 16:18016122-18016144 GGCTCATGGCTCTGGAGGCTGGG + Intergenic
1135912150 16:26571291-26571313 GGCTCATGGCTCTGGAGGCTGGG + Intergenic
1136616818 16:31403566-31403588 TCCACCAGGCTCTGCTGGCTCGG - Exonic
1137575809 16:49599517-49599539 GAATCCTGGCTCTGGGGTCTTGG - Intronic
1137788052 16:51152873-51152895 GGCTCCTGGCTCTGGGCTCTGGG - Intergenic
1138172491 16:54866081-54866103 GCCTCCAGGCTCAGCTGGGTAGG - Intergenic
1138509038 16:57497358-57497380 GCCTTTCGGCTCTGCAGGCTCGG - Intergenic
1139597965 16:67968941-67968963 GTGTCCTGGCTCTGCGCCCTGGG + Intronic
1139693700 16:68657609-68657631 ACCTCCTAGCTCTGTGGCCTTGG - Intronic
1139737317 16:69002612-69002634 GACTCATGGCTCTGCAGGCTGGG - Intronic
1139847508 16:69931407-69931429 GCCTCCTGGCCCAGCAGGCTGGG + Intronic
1140924056 16:79566029-79566051 TCCTCCTGGCTCTTAGGTCTAGG + Intergenic
1141136707 16:81470343-81470365 GCCTGCTGGCTGTGGTGGCTGGG + Intronic
1142171423 16:88624673-88624695 GTCTCCTGGCTTGGTGGGCTCGG - Exonic
1142711929 17:1728124-1728146 GCCTCCTGCCTCCTCGGGCCTGG + Exonic
1142752615 17:1997969-1997991 GGCTCCTGGGTCTGGGGCCTGGG + Intronic
1142996885 17:3765799-3765821 GCCACCAGGATCTGGGGGCTGGG + Intronic
1143512653 17:7404950-7404972 GACTCCTGGCTCCGCGCGCCAGG - Intronic
1143635755 17:8162994-8163016 GCATCCGGGCACTGCGGGCGGGG + Intronic
1144061784 17:11589476-11589498 GCCGCCTGGTTCTGCTTGCTTGG + Intergenic
1145225881 17:21127548-21127570 GCTTCCTGGCTGTGCGGCTTTGG + Intronic
1146492525 17:33292693-33292715 GGCTCCTGGCTGGGCGGGCGGGG + Exonic
1146797813 17:35795291-35795313 GCCTCCGCGCTCCGCGGGCTGGG + Exonic
1147015562 17:37489416-37489438 ACCCCCGGGCTCTCCGGGCTAGG + Intergenic
1147015690 17:37489883-37489905 GCCACCGGCTTCTGCGGGCTGGG - Exonic
1147482152 17:40776307-40776329 GCCACATGGCTCTGCAGTCTTGG + Intergenic
1147911408 17:43858337-43858359 GCCTCCTGGCTCTGCGGGCTAGG + Intronic
1148002936 17:44400643-44400665 GCTTCCTGGTTCTGAGGGCTCGG + Exonic
1148598740 17:48878093-48878115 GTCTCCTGGGACTGCTGGCTCGG - Intergenic
1150568283 17:66362419-66362441 GCCTCTTGGCTCTCCAGGCTGGG + Intronic
1151351057 17:73532465-73532487 GCCACCTGACTCTGGGGCCTGGG - Intronic
1151944576 17:77312406-77312428 CGCTCCTGGCTCTGAGTGCTCGG + Intronic
1152069120 17:78126435-78126457 GCCTCCCAGCTCTGCAGGCCTGG - Intronic
1152309926 17:79543909-79543931 GCACCCTGGCTCTGGGGGGTAGG - Intergenic
1152782126 17:82231225-82231247 GCTTCCCGGCTCTGCGGGCGGGG - Intronic
1152937940 17:83151550-83151572 CCCTCCTCGCCCTGTGGGCTGGG - Intergenic
1155440197 18:25854362-25854384 GCCTCCTGTTTGTGCAGGCTGGG - Intergenic
1156469760 18:37369914-37369936 TCCTCCTGGCTCTGGGGCCTTGG + Intronic
1157504506 18:48217151-48217173 GTCTCATGGCTCTGCAGGCCAGG - Intronic
1160497382 18:79383421-79383443 CCTCCCTGGCTGTGCGGGCTGGG + Intergenic
1160729433 19:634232-634254 GGCTCCTGCCCCTGAGGGCTTGG - Intergenic
1160822715 19:1066010-1066032 GACTCATGGCGCTGAGGGCTGGG - Exonic
1161294966 19:3514913-3514935 GCCTCCTGGCTCTTCATTCTGGG + Intronic
1161482650 19:4518536-4518558 GCCGCCTGCCGCTGCTGGCTGGG - Intergenic
1161980007 19:7625330-7625352 ACCCTCTGGCTCTGCGGCCTTGG - Intronic
1162425303 19:10591595-10591617 GCCTCCTGGCTCTGGGGCCGTGG - Intergenic
1163052716 19:14696526-14696548 GACTCCTGGTTCTGGAGGCTGGG + Intronic
1163320533 19:16572149-16572171 ACATCCTGGCTCTGTGCGCTGGG - Exonic
1163516917 19:17770413-17770435 TCCTCCTTGCACTGCGGGGTAGG - Exonic
1164615428 19:29664576-29664598 GCCTCCGGGCACTGAGGCCTGGG + Intergenic
1165148910 19:33749746-33749768 GTCTCCTGGCTCAGCAGCCTGGG - Intronic
1165309557 19:35022081-35022103 GCCTCCTGGCTGTGTGACCTTGG + Intronic
1166232947 19:41436264-41436286 GCCTCCTGGCTGTGTGGCTTGGG - Intronic
1166319103 19:42005586-42005608 GCCTCCTGGCTGTATGGTCTTGG - Intronic
1167414455 19:49362696-49362718 GACTCCTGGGTCTGGGGGCTGGG + Intronic
1167489205 19:49782121-49782143 GACTCCTGGGTCTGCGGGGGAGG + Intronic
1167497595 19:49828664-49828686 GCCTCCTGGCTCAGCGTGCTTGG - Intronic
1167537807 19:50066114-50066136 GCTTCCTGGCTGTGTGGCCTTGG - Intergenic
1168020969 19:53608425-53608447 GACTGCTGGCTCTGGGAGCTCGG - Intergenic
1168406867 19:56115010-56115032 TCCGCCTGGATCTGCAGGCTAGG + Intronic
925568848 2:5287688-5287710 TCCTCCTGGCCCTGCAGGCTGGG + Intergenic
925988810 2:9237093-9237115 ACCTCTTGGCTGTGCGGGCTGGG + Intronic
926130716 2:10302175-10302197 GCCTCCTGGCTCTCGGGGAGGGG - Intergenic
927397629 2:22672215-22672237 GCCTCCAGGCTCTGTTGGGTTGG + Intergenic
927506924 2:23620826-23620848 TACACCCGGCTCTGCGGGCTTGG - Intronic
927885378 2:26714970-26714992 GCCTCCAGGGTCTCTGGGCTGGG - Intronic
928427828 2:31193214-31193236 GCCTCCTGGCTCAACAGGCCTGG + Exonic
929242334 2:39665827-39665849 GCCTCCTCGCCCTGCGAGCCCGG - Intronic
929928286 2:46232911-46232933 GCCACCTGGCTGTGGGGGCAGGG + Intergenic
930002835 2:46872774-46872796 GGCTCTTGGTTCTGCAGGCTGGG + Intergenic
931747255 2:65301066-65301088 GCCTCCTGCCACTGCAGACTTGG - Intergenic
931851221 2:66252222-66252244 GCCTCCTGGCTCTCCGGGAGGGG - Intergenic
932020902 2:68085389-68085411 GCCTCCTGGCTGTGTGATCTTGG + Intronic
932286005 2:70532452-70532474 GCCTCCAGCCTCTGGGGCCTTGG + Intronic
932397178 2:71456138-71456160 GCTGCCTGGCTCTTCGGGGTAGG + Intronic
933960590 2:87406006-87406028 GGCTCCTGGCTTGGCTGGCTTGG - Intergenic
933962741 2:87415810-87415832 GGCTCCTGGCTGCGCTGGCTTGG - Intergenic
933963430 2:87418842-87418864 GGCTCCTGGCTTGGCTGGCTTGG - Intergenic
935511909 2:103986208-103986230 TCCTCCTGGCTTTGCTGGCTGGG - Intergenic
936747519 2:115596057-115596079 GCCTCCTGGCTATGCAGGAAAGG - Intronic
937284382 2:120741055-120741077 GGGTCCTGGCTCAGTGGGCTTGG + Intronic
937615755 2:123920530-123920552 ACCTCATGGTTCTGCAGGCTGGG + Intergenic
937869578 2:126777509-126777531 ACCTCCTGGCTCCGCGGGGCCGG - Intergenic
938583430 2:132668605-132668627 GCCGCCTGGCTCTGAGGCGTGGG - Intronic
939072918 2:137565306-137565328 GGCTCATGGCTCTGGAGGCTGGG + Intronic
946006473 2:216529498-216529520 GTCTCCTGGAGCTGGGGGCTGGG - Intronic
946007174 2:216535389-216535411 CCATCCTGGCTCTGACGGCTGGG + Intronic
946415787 2:219539065-219539087 GCCTCTGGGCCCTGGGGGCTGGG - Exonic
947212085 2:227717820-227717842 GGTTCCTGGCTCTGCGGGCCTGG - Intronic
948154098 2:235767401-235767423 GCGTGGAGGCTCTGCGGGCTGGG + Intronic
948385513 2:237578278-237578300 ACCTCCTGGCCATGCGGGCGTGG - Intronic
948689647 2:239693927-239693949 TCCTCCTGTCTCTCCTGGCTAGG - Intergenic
948751488 2:240135988-240136010 GCCTCCTGGTCCCCCGGGCTAGG + Intronic
1168969141 20:1918910-1918932 ACCTCCTGGCTCTGTGACCTGGG + Intronic
1171321293 20:24246775-24246797 GCCTCCTAGCCCTGTGGTCTTGG - Intergenic
1171405438 20:24909552-24909574 CCCTCCTGGTTCTGTGGGCGGGG + Intergenic
1172083238 20:32358718-32358740 ACCTCCGGGCTGGGCGGGCTGGG - Exonic
1172231380 20:33338825-33338847 GCCTCCTGGCTGTGTGGCCTTGG - Intergenic
1173812984 20:45967844-45967866 GCCTCCAGGCTCTGCAGGTCCGG + Exonic
1174124144 20:48290284-48290306 GCCTGGTGGCTCTGAGGACTGGG + Intergenic
1174378475 20:50141573-50141595 ACCTCCTGGCTCTGTGGCCTTGG - Intronic
1175108806 20:56631466-56631488 CCCTCCTGGCTCTGGCGGCCGGG - Exonic
1175296567 20:57912829-57912851 GCCTCCTGGCTGTGCGTCCTTGG + Intergenic
1175502666 20:59461363-59461385 AGCTCATGGCTCTGAGGGCTGGG + Intergenic
1175546974 20:59784719-59784741 ACCTCCTGGCTATGTGGCCTTGG + Intronic
1175870733 20:62208323-62208345 GCCTCATGGGTCTGGTGGCTAGG + Intergenic
1176049584 20:63110817-63110839 GCCACCTGCCTCTGCAGGGTGGG + Intergenic
1178409805 21:32353769-32353791 TGCTCCTAGCTCTGCTGGCTGGG + Intronic
1180553757 22:16560242-16560264 GCTTCCTGGCTTGGCTGGCTTGG - Intergenic
1180557866 22:16592147-16592169 GCCTCCCGGAGCTGCGGGCGAGG + Exonic
1180831753 22:18910319-18910341 ACCACCTGGCTCTGCTGACTGGG + Intronic
1180995674 22:19964063-19964085 GCCTCCTGTCTGTGTGGGCGTGG + Intronic
1181068095 22:20316050-20316072 ACCACCTGGCTCTGCTGACTGGG - Intronic
1183860854 22:40668856-40668878 GGCTCATGGTTCTGCAGGCTGGG - Intergenic
1184184994 22:42858351-42858373 GCTTCCTAGCTCTGTGGCCTTGG + Intronic
1184410616 22:44324018-44324040 TCCTCCTGGCTGTGTGGCCTTGG - Intergenic
1185223333 22:49639990-49640012 TCATCCTGACTCTGGGGGCTGGG - Intronic
1185333412 22:50261527-50261549 GCCCGCAGGCTCTGCGGGGTGGG - Exonic
1203281833 22_KI270734v1_random:135590-135612 ACCACCTGGCTCTGCTGACTGGG + Intergenic
950416760 3:12873275-12873297 GGCTCCAGGCTCAGCGAGCTGGG + Intergenic
950459438 3:13112508-13112530 TCTTCCTGGCTCTCAGGGCTGGG - Intergenic
950545691 3:13636685-13636707 GACTGCTGGGTCTGTGGGCTAGG + Intronic
950710958 3:14812318-14812340 GCCTCCTGCCTGTGCTGGCGTGG + Intergenic
951509742 3:23487282-23487304 GCCCCCTGCCCCTGCAGGCTTGG - Intronic
954082380 3:48220168-48220190 GCCTCCTGGGTCTGCAGGAGAGG + Intergenic
956191042 3:66608913-66608935 GCCTCATGGTTCTGAAGGCTGGG + Intergenic
956192280 3:66619514-66619536 GCCTCCTGGCTGTGTGACCTTGG - Intergenic
957709305 3:83834463-83834485 GCCTCATGGTTCTGGAGGCTGGG - Intergenic
959977688 3:112480486-112480508 GGCTCATGGCTCTGTAGGCTGGG + Intronic
960497233 3:118389106-118389128 GCCTCATGGTTCTGGAGGCTAGG - Intergenic
960670527 3:120151418-120151440 GCCTCATGACTCTTCAGGCTTGG - Intergenic
960702266 3:120450622-120450644 GCCTCTTGGGTCTGCGCGCTGGG - Intronic
962196393 3:133367398-133367420 CCCTCCAGGCTGTGCGTGCTTGG - Intronic
963338024 3:144000078-144000100 GCTTACTGGCTCTGCAGCCTTGG - Intronic
963919186 3:150889349-150889371 GCCCCCTGCCCTTGCGGGCTTGG - Intronic
964222475 3:154363358-154363380 GCCTCCTGGTTCTGGAGGCTAGG + Intronic
964982253 3:162700580-162700602 GCCACCTAGCTCTGCTGTCTTGG + Intergenic
965074058 3:163953795-163953817 GCCTCCCTGCACTGCAGGCTTGG - Intergenic
966919264 3:184601740-184601762 TTCCCCTTGCTCTGCGGGCTGGG - Intronic
967311877 3:188113951-188113973 TCCTCCTGGCTTTGTGGCCTGGG - Intergenic
967849178 3:194069765-194069787 TTCTCCTGGCTCTGGAGGCTGGG - Intergenic
967991604 3:195135578-195135600 GCCTCCTGGTGCTGAGGCCTAGG - Intronic
968437720 4:602705-602727 GCCTCCAAGGTCTGTGGGCTAGG - Intergenic
968633888 4:1667795-1667817 CCCTGCTGGCTCTGAGGGCCTGG + Intronic
969297813 4:6279975-6279997 CCATCCTGGCTCTGTGGCCTTGG + Intronic
975820622 4:78267166-78267188 TCCTCCTGCCTCTGTTGGCTTGG + Intronic
976390638 4:84500791-84500813 CCCTCCTGGCTTTTCGTGCTTGG - Intergenic
978061370 4:104344593-104344615 GCCTCCTGCCCCTGCAGGCTCGG + Intergenic
982725616 4:158902911-158902933 GCTTGCTGGCTCTGTGGGCATGG + Intronic
984702113 4:182825255-182825277 GCCTCTTGCCTCTGGGGGCTGGG - Intergenic
985661888 5:1161481-1161503 GCTCCCTGGTTCTGTGGGCTGGG + Intergenic
985708737 5:1416196-1416218 GCCCTCTGGCTCTGCAGGTTTGG - Exonic
988500313 5:31778296-31778318 GCCTCTTGCCACTGCTGGCTGGG - Intronic
988607290 5:32689618-32689640 GCTTCCTGGCTCTGAGTCCTGGG - Intronic
989732392 5:44664414-44664436 GCCTCCTGCCCCTGCATGCTTGG + Intergenic
994507097 5:100656861-100656883 GCCGGCTGGCTCTGCCGGCCCGG + Intergenic
994619465 5:102145979-102146001 GGCTCCTGGCTCTGAAGGCTGGG + Intergenic
994916120 5:105982459-105982481 GCCCCCTGCCCCTGCAGGCTTGG + Intergenic
997284589 5:132669069-132669091 GCCTCCTGGCTGTGTGACCTTGG - Intergenic
997704735 5:135938148-135938170 ACATCCTTGCTCTGGGGGCTAGG + Intronic
998154375 5:139776142-139776164 ACCTCCTGCCGCTGAGGGCTGGG + Intergenic
998673547 5:144381455-144381477 GGCTCAAGGCTCTGCAGGCTTGG + Intronic
999317608 5:150594336-150594358 GCCTCCTGGCTCTGCAAGGCAGG - Intergenic
999440269 5:151595438-151595460 GCCACCTGGCTCTGCAGCCAGGG + Intergenic
999743649 5:154575591-154575613 GCCTCCTGGCTCTGTTCTCTGGG - Intergenic
1000343719 5:160296922-160296944 GCCTACTAGCTATGTGGGCTTGG + Intronic
1001638648 5:173230334-173230356 GCCTGCTGGGGCTGTGGGCTGGG + Intergenic
1001704062 5:173729142-173729164 GCCTACTGGCTCTGTGACCTTGG + Intergenic
1002188626 5:177467682-177467704 GCCACCAGGGTCTGCGTGCTGGG - Intronic
1002424572 5:179167579-179167601 GCCTCCTGGCGGGGCGGGCGCGG - Intronic
1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG + Intronic
1002895551 6:1378264-1378286 GCCGCCGGGCACCGCGGGCTTGG - Intergenic
1005506981 6:26477987-26478009 GACTCCTGGCCCTGTGTGCTAGG + Intergenic
1005881065 6:30061376-30061398 GCCTCCTGCCTCTGCGACCAAGG - Exonic
1006372480 6:33653914-33653936 TCCTCCTGCCTCTTCAGGCTGGG - Intronic
1006390935 6:33758064-33758086 GCCTCAGGGCTCTGCAGGCCTGG + Intergenic
1007751078 6:44072528-44072550 GCATCCTGGCTCTCCTGGCTAGG - Intergenic
1009191382 6:60634114-60634136 GCCCCCAGTCTCTTCGGGCTTGG + Intergenic
1009851500 6:69205552-69205574 GCCTCATGGTTCTGGAGGCTGGG + Intronic
1011355841 6:86472649-86472671 GCCTCCTGGGTCTTCTGGGTTGG + Intergenic
1013359597 6:109382127-109382149 GCCTCCTCGCCGTGCGGGCGGGG - Intronic
1015307336 6:131724403-131724425 GCTTCCTGGCTGTGTGAGCTGGG + Intronic
1018156781 6:160992189-160992211 GCATCCAGTCTCTGCAGGCTGGG + Intronic
1019581123 7:1763679-1763701 GGCTCCAGGCTCTGCAGGCAGGG - Intergenic
1019927526 7:4203112-4203134 GCCTCCTGCCTCTGCGGGAAGGG - Intronic
1020279436 7:6642902-6642924 GGCTCCTGGCCCTGCAGGCTGGG + Intronic
1021653594 7:22854140-22854162 GCCTCCGGGCCCCGCGGGCGGGG + Intergenic
1024196026 7:47059739-47059761 CCTTCCTGGCCCTGCTGGCTGGG - Intergenic
1024984436 7:55183004-55183026 CCCTCCTGGCTCTGGAGGCCAGG + Intronic
1029540080 7:101177685-101177707 CCCTCCTTGCTCTTCAGGCTGGG - Intronic
1029572758 7:101381508-101381530 GGCTCATGGCTCTGGAGGCTGGG + Intronic
1031905072 7:127451473-127451495 GCCTACTGCCTCTGTGGGCAGGG + Intergenic
1033589264 7:142796728-142796750 GACTCCTGGTTCTGGGTGCTGGG + Intergenic
1034260351 7:149751513-149751535 CCCTCCCTGCTCAGCGGGCTGGG - Intergenic
1034445948 7:151114567-151114589 GCCGCCTCTCTCTCCGGGCTGGG + Intronic
1034619450 7:152445858-152445880 GCCTCCCGGAGCTGCGGGCGAGG - Intergenic
1034919710 7:155070220-155070242 GCCTCCTGGCTCAGAGCGCGCGG - Intronic
1034988506 7:155532861-155532883 GTCTCCTGGCTATGCGTGTTGGG + Intronic
1035286265 7:157809328-157809350 GCCTCCTGGCTCCACAGCCTCGG - Intronic
1035566311 8:643533-643555 CCCTCCTGCCCCTGCCGGCTGGG + Intronic
1035739698 8:1917354-1917376 GCCTTCTGGCTCTGACGTCTCGG + Intronic
1036788901 8:11704860-11704882 GCCTCCTCGCCCTCGGGGCTGGG + Intronic
1037373348 8:18203611-18203633 GCCTCCTGGCTATGCTGGGAAGG + Intronic
1037462252 8:19123041-19123063 GGCTCATGGCTCTGGAGGCTGGG + Intergenic
1038314997 8:26476853-26476875 GCTTCCTGGCTGTGTGGACTTGG - Intronic
1039043411 8:33428855-33428877 GGCTCATGGTTCTGGGGGCTGGG - Intronic
1039350553 8:36759262-36759284 GCCTCATGGCTCTGCAGTGTGGG - Intergenic
1039467747 8:37796549-37796571 CCCTCCTGGACCCGCGGGCTTGG - Intronic
1040575154 8:48645638-48645660 ACCTCCTAGATCTGCGGGCCTGG + Intergenic
1040722698 8:50345379-50345401 GCTTCCTGGCTCTGCCCTCTAGG + Intronic
1040819940 8:51545526-51545548 GGCTCATGGCTCTGAAGGCTGGG + Intronic
1040988078 8:53318284-53318306 GCCGCCTGGCTCTAAGAGCTGGG - Intergenic
1042196891 8:66238532-66238554 ACCTCCTGCCCCTGCAGGCTTGG - Intergenic
1044523924 8:93230167-93230189 GGCTCCTAGGTCTCCGGGCTGGG - Intergenic
1044734795 8:95268737-95268759 GACTGCGGGCTCTGCGGGCGGGG + Intronic
1045031941 8:98145306-98145328 GCCTGCTGGGTCTGATGGCTAGG - Intronic
1047705430 8:127494607-127494629 ACCTCCTGGCTGTGAGGCCTTGG + Intergenic
1048162678 8:132035424-132035446 GCCTCCTAGCTCTGTGACCTTGG - Intronic
1049008267 8:139871463-139871485 GCCTTCTGGCTCGCGGGGCTGGG - Intronic
1049209120 8:141377191-141377213 GCCTCCTATCACTGCGGGCAGGG + Intergenic
1049218136 8:141417098-141417120 GACTCCTGGCTCTGCCTCCTGGG - Intronic
1049343551 8:142126674-142126696 GCCTCCTGGCTCCCCGCGCCTGG - Intergenic
1049576815 8:143393468-143393490 GCCTGCTGGCCCTGAGGGCCGGG - Intergenic
1049752079 8:144289733-144289755 ACCTCTTGGCTCTGGGGCCTTGG - Intronic
1049777670 8:144414018-144414040 GCCTCCTGGCTATGCTGGCCGGG - Exonic
1049896326 9:114264-114286 GCCTCCCGGCCCTTCGCGCTCGG + Intergenic
1057306008 9:93912382-93912404 GGCTCCAGGCTTGGCGGGCTTGG - Intergenic
1057555720 9:96086007-96086029 GCTTCCTGGCTCTGCTGCCCAGG - Intergenic
1057577424 9:96254669-96254691 GCACACTGGCTCTGTGGGCTGGG - Intronic
1059411577 9:114135916-114135938 CCCTCCAGGCTCTGCAGCCTTGG + Intergenic
1059492625 9:114681813-114681835 GGCTTCTGGCGCTGCGGGCGGGG + Intergenic
1059998682 9:119938807-119938829 GCCTTCTTGCTCTGTGAGCTTGG - Intergenic
1060016069 9:120087572-120087594 CCCTCCTGGCTCTGTGGCCTTGG + Intergenic
1061952458 9:133944011-133944033 GGCTCCTGGCTCTGGGGTCTTGG - Intronic
1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG + Intronic
1187490293 X:19744985-19745007 GCCTCTTGGGTCCGCGGGCACGG - Intronic
1189322243 X:40094175-40094197 GCCTCCGGGCCCAGCGAGCTGGG - Intronic
1189759436 X:44306175-44306197 GTCTCCTGGAGCTGGGGGCTGGG - Intronic
1190285909 X:48961346-48961368 ATCTCCTGGCTCTGTGGGTTTGG - Intergenic
1194393240 X:93346884-93346906 GCCTCATGGCTCTGATGACTGGG + Intergenic
1195969764 X:110460571-110460593 GCCTCTTAGCTCTGCAGCCTTGG - Intergenic
1196823345 X:119721380-119721402 AGCTCATGGCTCTGCAGGCTGGG + Intergenic
1197945110 X:131830611-131830633 GCCTTCAGGCTCTGGGGCCTAGG - Intergenic
1198450911 X:136766922-136766944 GCGTCCTCGCTCTGCGTCCTTGG + Intronic
1199098500 X:143769453-143769475 GCCTCCAGTCTCTTCTGGCTTGG - Intergenic
1199798980 X:151230821-151230843 GCCTCCTGCCTCTGGGACCTGGG - Intergenic
1199828376 X:151523509-151523531 GCTTCGTGGCTCTTGGGGCTAGG - Intergenic
1202115847 Y:21468302-21468324 GCCTCCTCGCTCTGCGCCCCTGG - Intergenic