ID: 1147912713

View in Genome Browser
Species Human (GRCh38)
Location 17:43865802-43865824
Sequence CACCTTGAAGTGATACTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147912713_1147912725 23 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912725 17:43865848-43865870 ACAGCTGGGACGGCACCATGGGG No data
1147912713_1147912723 21 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912723 17:43865846-43865868 TGACAGCTGGGACGGCACCATGG No data
1147912713_1147912718 -4 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912718 17:43865821-43865843 GGTGTGGCAAGCAAGCACCTGGG No data
1147912713_1147912726 27 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912726 17:43865852-43865874 CTGGGACGGCACCATGGGGCTGG No data
1147912713_1147912719 8 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912719 17:43865833-43865855 AAGCACCTGGGTCTGACAGCTGG No data
1147912713_1147912720 9 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912720 17:43865834-43865856 AGCACCTGGGTCTGACAGCTGGG No data
1147912713_1147912717 -5 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912717 17:43865820-43865842 AGGTGTGGCAAGCAAGCACCTGG No data
1147912713_1147912724 22 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912724 17:43865847-43865869 GACAGCTGGGACGGCACCATGGG No data
1147912713_1147912722 13 Left 1147912713 17:43865802-43865824 CCCGCCAGTATCACTTCAAGGTG No data
Right 1147912722 17:43865838-43865860 CCTGGGTCTGACAGCTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147912713 Original CRISPR CACCTTGAAGTGATACTGGC GGG (reversed) Intergenic
No off target data available for this crispr