ID: 1147913223

View in Genome Browser
Species Human (GRCh38)
Location 17:43870439-43870461
Sequence TCATAGTTCTGATGGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147913223_1147913236 23 Left 1147913223 17:43870439-43870461 CCAAATTCCCATCAGAACTATGA No data
Right 1147913236 17:43870485-43870507 CTTTGGGGAAATCAAAATAAGGG No data
1147913223_1147913237 26 Left 1147913223 17:43870439-43870461 CCAAATTCCCATCAGAACTATGA No data
Right 1147913237 17:43870488-43870510 TGGGGAAATCAAAATAAGGGTGG No data
1147913223_1147913235 22 Left 1147913223 17:43870439-43870461 CCAAATTCCCATCAGAACTATGA No data
Right 1147913235 17:43870484-43870506 GCTTTGGGGAAATCAAAATAAGG No data
1147913223_1147913228 6 Left 1147913223 17:43870439-43870461 CCAAATTCCCATCAGAACTATGA No data
Right 1147913228 17:43870468-43870490 ATGAACCCCCATGGATGCTTTGG No data
1147913223_1147913227 -3 Left 1147913223 17:43870439-43870461 CCAAATTCCCATCAGAACTATGA No data
Right 1147913227 17:43870459-43870481 TGAGGTGATATGAACCCCCATGG No data
1147913223_1147913229 7 Left 1147913223 17:43870439-43870461 CCAAATTCCCATCAGAACTATGA No data
Right 1147913229 17:43870469-43870491 TGAACCCCCATGGATGCTTTGGG No data
1147913223_1147913230 8 Left 1147913223 17:43870439-43870461 CCAAATTCCCATCAGAACTATGA No data
Right 1147913230 17:43870470-43870492 GAACCCCCATGGATGCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147913223 Original CRISPR TCATAGTTCTGATGGGAATT TGG (reversed) Intergenic
No off target data available for this crispr