ID: 1147914863

View in Genome Browser
Species Human (GRCh38)
Location 17:43880139-43880161
Sequence GTGCCAATGGGGAGAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147914863_1147914872 5 Left 1147914863 17:43880139-43880161 CCCCCCACTCTCCCCATTGGCAC 0: 1
1: 0
2: 3
3: 18
4: 343
Right 1147914872 17:43880167-43880189 GAGACATGAGCTGGTAATCATGG 0: 1
1: 0
2: 1
3: 9
4: 165
1147914863_1147914871 -4 Left 1147914863 17:43880139-43880161 CCCCCCACTCTCCCCATTGGCAC 0: 1
1: 0
2: 3
3: 18
4: 343
Right 1147914871 17:43880158-43880180 GCACACACAGAGACATGAGCTGG 0: 1
1: 0
2: 2
3: 32
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147914863 Original CRISPR GTGCCAATGGGGAGAGTGGG GGG (reversed) Intronic
900364497 1:2305565-2305587 ATTTTAATGGGGAGAGTGGGGGG + Intronic
901305042 1:8226761-8226783 GTGCCACTGGGGACACAGGGGGG + Intergenic
902392218 1:16113256-16113278 GTGCCCAGGGGGAGACTTGGGGG + Intergenic
902655603 1:17865933-17865955 GTTGTAACGGGGAGAGTGGGCGG - Intergenic
904812012 1:33169530-33169552 GGCACAATGGGGAGAGTGAGAGG - Intronic
904902437 1:33868061-33868083 ATGACAATGGAGAGAGAGGGAGG + Intronic
905196231 1:36279990-36280012 GTGCCAACGGTGAGGCTGGGCGG + Intronic
905289375 1:36911109-36911131 GACCCACTGGGGAGAGAGGGAGG + Intronic
905520906 1:38598957-38598979 AGGCCAAAGGGGAGAGTGGAGGG - Intergenic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
908320165 1:62971127-62971149 GGGCCAATGGAGAGATTGGAAGG + Intergenic
909395797 1:75169477-75169499 GTGTGAATGAGGAGAGTGGGCGG + Intergenic
910352246 1:86311370-86311392 CTGCAAAAGGTGAGAGTGGGAGG + Intergenic
910426934 1:87127845-87127867 GTGCGTATGGCGTGAGTGGGAGG + Intronic
911121071 1:94297102-94297124 GTGTCAAAGGGGTGAGTGAGAGG + Intergenic
913016855 1:114745953-114745975 GTTCCTTTGGGGAGAGGGGGTGG + Intronic
914448669 1:147771936-147771958 GTGACTCTGGGGACAGTGGGTGG + Intronic
916277202 1:163007832-163007854 GTGCCAAGTGTGAGAGTGGTAGG + Intergenic
919130928 1:193449449-193449471 GAGCCAGTGGGGAGTGGGGGTGG + Intergenic
919563712 1:199157459-199157481 GTGCAAATGGGAAGAAAGGGTGG + Intergenic
919799960 1:201348067-201348089 GTGGAAATGGGGAGAGAGTGTGG + Intergenic
919801908 1:201359334-201359356 GTGCCAAAGGGGAGAGGAGCAGG + Intronic
919841705 1:201614058-201614080 GGGCGAGTGGGGAGAGGGGGTGG + Intergenic
920079136 1:203359635-203359657 GGGCCAATGGAGAGAGGGGTAGG - Intergenic
920534432 1:206728569-206728591 GTGCCAAGGGGGCTGGTGGGGGG + Intronic
920810924 1:209284848-209284870 TTGCCCATGGGTAGAGGGGGTGG + Intergenic
922020663 1:221700973-221700995 GTGACAATGGGGTGGGGGGGTGG + Intergenic
1063197883 10:3759986-3760008 GGGCCAAAAGGGAAAGTGGGAGG + Intergenic
1063887711 10:10596381-10596403 GAGACAAAGTGGAGAGTGGGTGG - Intergenic
1066294460 10:34042163-34042185 GTGCCAAGGAGGCCAGTGGGAGG + Intergenic
1066990647 10:42510085-42510107 GTACCAATGGGAAAAGTGTGGGG - Intergenic
1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG + Intergenic
1068405619 10:56585144-56585166 CTGAGAAGGGGGAGAGTGGGAGG - Intergenic
1069159659 10:65078417-65078439 GTGCCAAGGGTGGGACTGGGTGG + Intergenic
1069609225 10:69761490-69761512 GTGGGAATGGAGGGAGTGGGTGG + Intergenic
1070754891 10:78985790-78985812 GTTCCAAAGGGGAGAGGGGCTGG + Intergenic
1072957103 10:99896901-99896923 GTGGCAAGGGGAAGACTGGGAGG + Intronic
1074029621 10:109673247-109673269 CTCAGAATGGGGAGAGTGGGAGG + Intergenic
1074646344 10:115457349-115457371 GAACCAATCGAGAGAGTGGGTGG + Intronic
1075654916 10:124154932-124154954 GTGAGCATGGGGTGAGTGGGGGG - Intergenic
1076129937 10:128006858-128006880 GTGACAATGGGGAGGTTGGAAGG - Intronic
1076140729 10:128077046-128077068 GTGGAAATGGGGACAGTTGGGGG - Intronic
1076521779 10:131085738-131085760 GAGCAAGTGGGGAGAGTGAGGGG - Intergenic
1076524390 10:131102332-131102354 GTTCCAATGAGCAGAGTGGTGGG + Intronic
1076581794 10:131516987-131517009 GTGGCAATGGGAAGGGTGGTTGG - Intergenic
1077190672 11:1254870-1254892 GGGCCAGTGCGGTGAGTGGGCGG + Exonic
1077192426 11:1260986-1261008 GTCCCCCTGGGGAGGGTGGGTGG + Intronic
1077331966 11:1987795-1987817 ACGCCAATGGGGGGCGTGGGAGG - Intergenic
1077337226 11:2010832-2010854 GTGCACATGGGGAGGGAGGGAGG - Intergenic
1077417045 11:2428977-2428999 GTGACAATGGTGACAGTGGAGGG + Intergenic
1077469412 11:2750024-2750046 GTGAAAATGGGGTGAGAGGGAGG + Intronic
1077642495 11:3894393-3894415 GTCCCAAGGGGTGGAGTGGGGGG + Intronic
1078536924 11:12182772-12182794 GAGCCAAGGTGGACAGTGGGAGG - Intronic
1078742263 11:14077977-14077999 GTAGAAATGGGGAGAGAGGGCGG + Intronic
1080620717 11:33985568-33985590 GAGACAGTGGGGAGAGGGGGAGG - Intergenic
1081672467 11:44949795-44949817 GCGACTTTGGGGAGAGTGGGGGG + Intronic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1083257446 11:61505374-61505396 GTGCCTATGGGGACATTGGAGGG + Intergenic
1083293813 11:61704565-61704587 TTGCCTCTGGGGAGAGTGAGGGG + Intronic
1083470674 11:62881773-62881795 GGGCAAAGGGGGAGAGAGGGAGG - Intronic
1083823564 11:65185919-65185941 GTGGCAATTTGGGGAGTGGGTGG + Exonic
1083856135 11:65393971-65393993 GGGCCAATCGGGAGAGGGGAGGG + Intronic
1084023323 11:66431623-66431645 GTGGCAAGGGGAAGAGTGGCTGG + Intergenic
1084218358 11:67663658-67663680 GTGCCATTCGGGGGAGTCGGTGG - Exonic
1086166980 11:83790636-83790658 GTAGCAATGGTGAGAGTGGAGGG + Intronic
1086243210 11:84720772-84720794 GTGTGACTGGGGAGAGTAGGCGG - Intronic
1086496616 11:87410605-87410627 GTGGCTATGGGGAGGGAGGGAGG - Intergenic
1089043899 11:115481917-115481939 GTGTCAATGAGGGGAGCGGGAGG - Intronic
1090462902 11:126907787-126907809 GAGCCAGAGGGGAGAATGGGAGG - Intronic
1090588534 11:128239568-128239590 CTGCCAATGGGGGGACTGTGTGG + Intergenic
1091250738 11:134141752-134141774 GTGCCAAGGGGCACAGAGGGAGG + Intronic
1202814947 11_KI270721v1_random:42971-42993 ACGCCAATGGGGGGCGTGGGAGG - Intergenic
1202820210 11_KI270721v1_random:66014-66036 GTGCACATGGGGAGGGAGGGAGG - Intergenic
1091777828 12:3196132-3196154 GTGCTCATGGTGAGAGAGGGAGG + Intronic
1091793088 12:3282694-3282716 GAGCCAAGGTGGGGAGTGGGAGG - Intronic
1092617115 12:10225713-10225735 GTGCCCATGGAGTGGGTGGGAGG + Intergenic
1093214693 12:16348958-16348980 GTGCCTCTCGGGAGAGTGGTGGG - Intronic
1093381085 12:18493940-18493962 GGACCAAGTGGGAGAGTGGGAGG + Intronic
1094297164 12:28920072-28920094 GTGTCAAGGGAGAGATTGGGTGG - Intergenic
1094748887 12:33381672-33381694 CAGGCAACGGGGAGAGTGGGAGG + Intronic
1095398583 12:41789356-41789378 GAGCCAATGGAGAGAGTGTTGGG + Intergenic
1096550764 12:52370215-52370237 GTTCCACTGGGCAGAGTGGTTGG - Intergenic
1096828611 12:54297932-54297954 CTGCCAGTGGGCAGAGTGGGTGG + Intronic
1097808181 12:63988458-63988480 GTGCCAATGGGAAGAATGGGAGG + Intronic
1102157520 12:110742860-110742882 GTTCCAGTGGGGAGAGAAGGAGG - Exonic
1103902090 12:124308652-124308674 GTGAAAATGGGGAGAGATGGAGG - Intronic
1105274033 13:18904461-18904483 GTGGCAAGCGGGAGAGTGGAAGG - Intergenic
1105782128 13:23714729-23714751 GTGCCAAAGGGAAAAGTGGATGG - Intergenic
1106857830 13:33872136-33872158 GTGACAAAGGGCAGAGTGTGTGG + Intronic
1106882035 13:34142375-34142397 GTACAAATAGGGAGAATGGGTGG + Intergenic
1108719969 13:53121017-53121039 GTGTACTTGGGGAGAGTGGGTGG + Intergenic
1110417517 13:75268724-75268746 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
1110941991 13:81362651-81362673 GTGCCACTGGGGTATGTGGGGGG - Intergenic
1111174281 13:84572715-84572737 GAGGCAATGGGAAAAGTGGGAGG + Intergenic
1112228145 13:97561273-97561295 GTGAGAATGGAGTGAGTGGGAGG + Intergenic
1114360373 14:21965662-21965684 GGGAGACTGGGGAGAGTGGGGGG + Intergenic
1115149943 14:30272976-30272998 GTTCAAATGTGGAGGGTGGGAGG - Intergenic
1118576466 14:67246451-67246473 CAGCCACTGGGGAAAGTGGGAGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119429359 14:74555763-74555785 GTGCAAAGGCAGAGAGTGGGTGG - Intronic
1119509006 14:75196608-75196630 GGGCCAGTGGTGAGAGTGGGAGG - Intergenic
1122050417 14:99055592-99055614 GTGCAAATGCACAGAGTGGGAGG - Intergenic
1122133499 14:99619717-99619739 GGGCAAATGGGGAGGATGGGGGG - Intergenic
1122291017 14:100680538-100680560 GTGACAATGGGGGGAGGCGGAGG - Intergenic
1122745845 14:103896788-103896810 GGGCCTGTGGGGGGAGTGGGAGG + Intergenic
1122770024 14:104093740-104093762 GTGGGAATGGGGAGTGTGGGTGG + Intronic
1122898148 14:104770595-104770617 GTGCCAATGATCAGGGTGGGAGG - Intronic
1123795085 15:23763143-23763165 CAGCCAAAGGGGAGGGTGGGGGG + Intergenic
1125310515 15:38373675-38373697 GTGCAAATGGGGTGACTGTGTGG - Intergenic
1125966236 15:43877562-43877584 AGGACAATGGGGAGAGAGGGTGG + Intronic
1128254489 15:66186674-66186696 CTGTCCATGGGGTGAGTGGGTGG - Intronic
1129903650 15:79170875-79170897 TTGCCAGTGGGGAGAGGGGTTGG + Intergenic
1130148211 15:81291726-81291748 GGGCTAATGGGGAGGGAGGGAGG + Intronic
1130448118 15:84023408-84023430 GTGCCTTGGAGGAGAGTGGGAGG + Intronic
1130985442 15:88841923-88841945 GTGTCAGTGGGGAGATGGGGAGG - Intronic
1131525882 15:93152239-93152261 GTGCAAGTGGGAAGAGGGGGTGG + Intergenic
1132243251 15:100276369-100276391 GTGCCTGGTGGGAGAGTGGGAGG + Intronic
1132588976 16:718156-718178 GTGACAATGGGGCCAGTGGCGGG - Exonic
1132689087 16:1174505-1174527 GTGGCCATGGGGAGGGAGGGAGG + Intronic
1132757704 16:1493961-1493983 GTGCCACTGGCGCGAGAGGGAGG - Intronic
1132808947 16:1788508-1788530 GAGCCAATGGTGGGAGTGGAAGG + Intronic
1133319493 16:4904093-4904115 GTGGCAATGGGAGGGGTGGGAGG + Intronic
1133801826 16:9091314-9091336 GAGCCAAGGGGGCGGGTGGGGGG - Intergenic
1134374299 16:13656573-13656595 GGGCCAATGCAGAGAGTGGTGGG + Intergenic
1135975800 16:27108397-27108419 GTGCCAGTGGGCAGAGGGTGCGG + Intergenic
1137912364 16:52391134-52391156 GAGTCAACAGGGAGAGTGGGAGG - Intergenic
1138418232 16:56883743-56883765 GTGCCAAGGGGGTGAGATGGAGG - Intronic
1139353001 16:66349261-66349283 GGGCTAGTGGGGAGAGTTGGAGG + Intergenic
1139483653 16:67244608-67244630 GGCCCAATGGGGTGTGTGGGTGG + Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140314469 16:73881487-73881509 GTAACCATGGGCAGAGTGGGGGG - Intergenic
1140323073 16:73972652-73972674 GTGCTAATGGGGAGGGAGGCTGG - Intergenic
1141245441 16:82302686-82302708 GTGCCAGTGGGGAGGGGAGGAGG - Intergenic
1141253839 16:82382749-82382771 GTAACAATGGGGAGGGTGAGGGG + Intergenic
1141380188 16:83569260-83569282 GTTCCAATGGGGAGAGGGAGGGG - Intronic
1141878929 16:86845376-86845398 GTGCCACAGGGGTGAGTGTGAGG - Intergenic
1141878999 16:86845680-86845702 GTGCCACAGGGGTGAGTGTGAGG - Intergenic
1141879017 16:86845768-86845790 GTGCCACAGGGGTGAGTGCGAGG - Intergenic
1144373045 17:14611202-14611224 TAGCCACTGTGGAGAGTGGGAGG + Intergenic
1144453218 17:15398367-15398389 GTGCTAATGGAGACAGTGAGAGG - Intergenic
1144718193 17:17449035-17449057 GTGCCAGTGTGGACAGTGGTGGG + Intergenic
1146004025 17:29149495-29149517 GTGCCAATGCAGGGACTGGGTGG - Intronic
1147235061 17:39051143-39051165 ATGCCTATGGGGGGAGTGGCGGG + Intergenic
1147247519 17:39132068-39132090 GGGCCATGGGGGAGATTGGGAGG + Intronic
1147649283 17:42053006-42053028 GAGCCAAAGTGGAGAGTGAGAGG + Intronic
1147914863 17:43880139-43880161 GTGCCAATGGGGAGAGTGGGGGG - Intronic
1148687579 17:49509322-49509344 ATGCCAATGGGGTGAAGGGGAGG - Intronic
1149223724 17:54444308-54444330 GTGCAAATGGGGAGTTAGGGAGG - Intergenic
1150363023 17:64554429-64554451 GTGGCTATGGGGAGAGGGAGTGG + Intronic
1150586381 17:66522195-66522217 GTGCCCCTGGGGAGAGCTGGTGG + Intronic
1150632164 17:66887410-66887432 GTGCCAGTGGAGAGGGAGGGGGG - Intergenic
1151571027 17:74925399-74925421 GGATCAATGGGGAGGGTGGGAGG - Intronic
1151712549 17:75814969-75814991 GTGACAATGGGGAGTGGTGGTGG + Intronic
1152383674 17:79956008-79956030 GTGCCAAGAGGAAGAGTGAGGGG - Intronic
1152520454 17:80853025-80853047 GTGCCAATACGGAGATGGGGAGG - Intronic
1152822765 17:82445611-82445633 TGGCCCCTGGGGAGAGTGGGAGG - Intronic
1154197001 18:12274068-12274090 GTGACAATGGGGGGAGGGGCAGG - Intronic
1154465744 18:14641709-14641731 GTGGCAAGCGGGAGAGTGGAAGG - Intergenic
1157296919 18:46451983-46452005 TTGCCAGTGGGGAGGGAGGGAGG + Intronic
1157392709 18:47316333-47316355 GTGCAAGTGGTGAGAGTTGGTGG - Intergenic
1157997212 18:52572612-52572634 GTGCTAAGGGGGAGAGGGAGTGG + Intronic
1159590195 18:70325589-70325611 GTAGCAATGGTGAGAGTGGAGGG - Exonic
1160168462 18:76532850-76532872 CTGCAAATAGGGAGAGTGGCAGG + Intergenic
1160905864 19:1451530-1451552 GTGCCCAAGGGCAGGGTGGGAGG - Exonic
1161550555 19:4910016-4910038 GGGCCAATGGGGAGCGAGCGGGG + Intronic
1161642486 19:5432897-5432919 GGGCAACTGGGGAGGGTGGGAGG + Intergenic
1162327049 19:10005773-10005795 GTGAGCATGGGGAGAGTGGGCGG - Intronic
1162693750 19:12455228-12455250 TCACCAATGGGGTGAGTGGGAGG - Intronic
1162718380 19:12647765-12647787 GAGCCAATGGGGAGATGGGTCGG + Intronic
1163442790 19:17330019-17330041 GGGCCAAGGGGGGGAGTGAGGGG + Intronic
1164591195 19:29508048-29508070 GCTCCAATGGGGAGAGAAGGTGG + Intergenic
1165996446 19:39847135-39847157 GAGACAATGAGGAGGGTGGGTGG + Intergenic
1166096600 19:40543152-40543174 GCGAAAATGGGGAGAGTGGCCGG + Intronic
1166165268 19:40983236-40983258 GGGGCAATGGGAAGAGAGGGGGG + Intergenic
1166297826 19:41897384-41897406 GTGGCCATGGGGAGAGGGGAGGG - Intronic
1166370460 19:42297482-42297504 GGGCAAGTGGGGAGGGTGGGAGG + Intronic
1166529451 19:43533930-43533952 GGGCCTATGGGCACAGTGGGCGG - Intronic
1166529496 19:43534086-43534108 GGGCCTATGCGCAGAGTGGGCGG - Intronic
1166702610 19:44891045-44891067 GAGCCAATGGGAAGGGTGGGAGG + Intronic
1166881655 19:45933909-45933931 ATGGCAATGTGGGGAGTGGGAGG + Exonic
1166997645 19:46727411-46727433 ATGCCAATGGGGACAGTGTGGGG + Intronic
1167144833 19:47675522-47675544 GTGCTACTGGAGAGACTGGGGGG + Intronic
1167538436 19:50070347-50070369 GTGACACTGGGGAGAGTGTCAGG + Intergenic
1167992737 19:53374214-53374236 TTGAGAGTGGGGAGAGTGGGAGG - Intronic
1168654664 19:58118380-58118402 GCGCCCATGCGGAGAGTCGGAGG - Exonic
925098942 2:1229683-1229705 GAGCCAATGGAGGGGGTGGGAGG + Intronic
925849899 2:8069882-8069904 GAGCCGAAGGGGAGAGTGGATGG + Intergenic
929252943 2:39779328-39779350 ATGCCAAAGGGGAGAGGGAGAGG + Intergenic
929756017 2:44765682-44765704 GTTGCAGTGGGGAGAATGGGAGG - Intronic
930225539 2:48788717-48788739 GTAGAAATGGGGAGAGTAGGAGG - Intergenic
930719748 2:54627761-54627783 GGGGCAGTGGGGAGCGTGGGCGG - Intronic
931636091 2:64341761-64341783 CAGCCAATGGGGAGTGAGGGAGG + Intergenic
935106503 2:100049788-100049810 AATCCAATGGGCAGAGTGGGAGG + Intronic
935353741 2:102178581-102178603 GTGCCAGTGTGGAGTGAGGGGGG - Exonic
937596882 2:123684049-123684071 GAGCCCATGGAGTGAGTGGGAGG - Intergenic
937764072 2:125639602-125639624 GTGGCAATGGGAAGAATTGGTGG - Intergenic
938550960 2:132382181-132382203 GGGCCAATGGGCAGAATGAGAGG + Intergenic
939972511 2:148678485-148678507 GAGCCCATGGAGGGAGTGGGAGG + Intronic
940385833 2:153070304-153070326 GTGCTCATGGGGAGAGTGGGTGG + Intergenic
940652840 2:156454677-156454699 GTACCAGAGGGCAGAGTGGGAGG + Intronic
941237708 2:162995952-162995974 GTGCCTATGGTGGGAGTGGCAGG - Intergenic
942202093 2:173581625-173581647 AGGGCATTGGGGAGAGTGGGTGG + Intergenic
944481321 2:200160562-200160584 GTGCCAGTGGGGAAACTTGGAGG + Intergenic
945955455 2:216082012-216082034 ATGCCATTGGGGAGGGTGGAAGG + Intronic
946992993 2:225357065-225357087 CTGCCAATGGTGAGAGCAGGTGG - Intergenic
947402167 2:229742143-229742165 GAGACAATGGGGAGAGGGAGAGG - Intergenic
948183135 2:235998852-235998874 GTGACCATGGTGAGAGTTGGTGG + Intronic
948550807 2:238772108-238772130 ATGCCGAGGGGGAGAGTGGAAGG - Intergenic
1168846289 20:946914-946936 GTCCCACTGGGGAGGGTGGCTGG + Intergenic
1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG + Intronic
1172475445 20:35234068-35234090 TGACCAATGGGGAGAATGGGTGG - Intronic
1172481953 20:35276666-35276688 GAGCCAATGGGGAGCCTGGCGGG - Exonic
1172554892 20:35832259-35832281 GTGCAAAAGGGGAGAGGGAGAGG - Intronic
1172644675 20:36462020-36462042 GAGCCCTTGGGGAGAGTGGAAGG - Intronic
1172767004 20:37356303-37356325 GTGCCAATGGGTAGAGGGCCTGG + Intronic
1172771522 20:37384962-37384984 GTGCCTGTGGGGAGAGTGAACGG - Intronic
1172802932 20:37590983-37591005 GTGCCACTGGGGAGATGGGTGGG + Intergenic
1176096147 20:63345439-63345461 GTGCCCCTGGGGACACTGGGGGG + Exonic
1176229420 20:64024398-64024420 TTTACAATGGGGAGAGTGTGGGG - Intronic
1176808845 21:13516881-13516903 GTGGCAAGCGGGAGAGTGGAAGG + Intergenic
1178878972 21:36433610-36433632 TTGCCAGTGGGGGGAGTGGTTGG + Intergenic
1178939079 21:36889952-36889974 GTGCCAAGGGAGAGACTGGGTGG + Intronic
1179457647 21:41509905-41509927 GTGCCAAAGGAGGGAGTGAGAGG - Intronic
1180195049 21:46189030-46189052 CTGCCTGTGGGGCGAGTGGGAGG - Exonic
1182393761 22:30020532-30020554 GCGCCAATGGGGAGGCTGGTAGG + Exonic
1182437681 22:30341101-30341123 GTGCCAAGGGGGCGAGGGGTGGG + Intronic
1182558712 22:31142713-31142735 GTGCCAGTGGGGAGTAGGGGTGG + Intergenic
1182791581 22:32957550-32957572 GTGCCGGTGGGGAGAGCGCGGGG - Intronic
1183796432 22:40122337-40122359 GTGCCACTGGGCAGAGGGGCCGG + Intronic
1185072130 22:48662177-48662199 GTGCCTGTGGGGACAGCGGGAGG + Intronic
1185272557 22:49935746-49935768 GGGGCAAAGGGGAGGGTGGGGGG + Intergenic
1185337334 22:50276513-50276535 GTGCTGAGGGGGAGAGAGGGTGG - Intronic
949376907 3:3400793-3400815 GGGGGAGTGGGGAGAGTGGGTGG + Intergenic
950230397 3:11271060-11271082 CTGCCTTTGGGGAGGGTGGGGGG + Intergenic
950613703 3:14142092-14142114 CTGCCAATGGGCTGAGTGGCTGG - Exonic
950966769 3:17152155-17152177 GCCCCCATGGGGAGACTGGGAGG + Intergenic
952304092 3:32130130-32130152 CTGCGAACAGGGAGAGTGGGAGG + Intronic
952795278 3:37233279-37233301 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
953002925 3:38951427-38951449 GAGCCCATGGAGGGAGTGGGAGG - Intergenic
953124478 3:40078011-40078033 GAGCCCATGGAGAGGGTGGGAGG + Intronic
953440294 3:42910339-42910361 GTGCAAAGAGGGAGAGGGGGAGG + Intronic
954143260 3:48621237-48621259 GTACTAAAGGGGAGAGTTGGGGG + Intronic
954584071 3:51719094-51719116 GAGCTTATGGGGAGAGGGGGTGG + Intergenic
954636131 3:52071793-52071815 GTGCCAGTGGGGATGGTGGGGGG - Intergenic
955505745 3:59631615-59631637 GTGTTGATGGGGAGAGTGAGTGG - Intergenic
955845561 3:63159405-63159427 GTGGCATTGGGGAAGGTGGGTGG - Intergenic
956692869 3:71893923-71893945 ATGCAAATGGTGACAGTGGGTGG - Intergenic
958828945 3:99064945-99064967 GTGAAAATGGTGAGAGTGCGGGG - Intergenic
959671166 3:108978900-108978922 GTGCCATATGGGAGGGTGGGAGG - Intronic
962411450 3:135144654-135144676 GTGCCAAAGGGGAATGTGGGGGG - Intronic
963305973 3:143653394-143653416 TTGCCAAGGGGGAAAGAGGGAGG + Intronic
963862207 3:150323244-150323266 GAGCCCATGGAGGGAGTGGGAGG - Intergenic
966837301 3:184059065-184059087 GGGCAAATGGGGAGTGGGGGAGG - Intronic
969313933 4:6370382-6370404 CTGCAAATGGGGAGGGTGTGGGG - Intronic
971677955 4:29659330-29659352 GTGCTTTTGGGGAGGGTGGGAGG - Intergenic
973633871 4:52844084-52844106 ATGCGAATGGGGAGAGAGTGCGG - Intergenic
973817127 4:54629579-54629601 GTGCCAATGGAGAGGAAGGGGGG + Intergenic
974484751 4:62491980-62492002 GAGCCCATGGAGAGGGTGGGAGG + Intergenic
976441892 4:85085485-85085507 GCGCCCATGGGGAGTGTGTGAGG + Intergenic
977290873 4:95162895-95162917 GTTCCAAAGGGGACAGTAGGTGG + Exonic
978595630 4:110374283-110374305 CTGTCACTGGGGTGAGTGGGAGG - Intronic
978819065 4:112944580-112944602 GTCCCAATGGGGAAGGGGGGTGG - Intronic
979759093 4:124377562-124377584 GAGGCAAAGGGGAGAGAGGGAGG - Intergenic
982202708 4:152975271-152975293 GAGCCAATGGCGAGAGAGGAGGG - Exonic
982740784 4:159054813-159054835 GTGGCAAGGGGCAGGGTGGGAGG - Intergenic
983573766 4:169238056-169238078 TAGCCAATGGGCAGAGTGTGAGG - Intronic
985704314 5:1391698-1391720 GTGACGATGGGGACGGTGGGAGG + Intergenic
987067817 5:14307200-14307222 GAGGCAGTGGGGAGAGAGGGTGG - Intronic
988027706 5:25720172-25720194 GTGCAAATAAGGAGAGTTGGAGG - Intergenic
990208314 5:53453895-53453917 GTGCCATTGGGGAGGGGGTGGGG - Intergenic
990490102 5:56295601-56295623 GAGCCCATGGAGGGAGTGGGAGG - Intergenic
992442751 5:76811179-76811201 GGGAAAATGGGGAGAGTAGGAGG + Intergenic
994344131 5:98664705-98664727 CTGGTAATGGGGAGACTGGGTGG + Intergenic
996234255 5:121107454-121107476 GAGCCCATGGAGGGAGTGGGAGG - Intergenic
996933573 5:128921012-128921034 GTGCCAAGTGGTAGAGTGGCAGG - Intronic
997420791 5:133765212-133765234 ATGCCAGTGGGGAGAGGGGGAGG + Intergenic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999766407 5:154744299-154744321 GTGTCATAGGTGAGAGTGGGAGG - Intronic
1001142120 5:169153202-169153224 GGGCCAATGGGGAGGGGAGGAGG + Intronic
1001500618 5:172230197-172230219 GTGGCAATGGGGAGAGTAAGAGG - Intronic
1003100227 6:3171041-3171063 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
1005636672 6:27759411-27759433 CTAGCAATGGGGAGAGTGGCTGG - Intergenic
1006092048 6:31633879-31633901 GGGCCAATGGTGAGAGGGGTGGG + Exonic
1006912075 6:37570061-37570083 ATGGGAATGGGGATAGTGGGTGG - Intergenic
1006919656 6:37619113-37619135 GAGCCAATGGGTAGACAGGGGGG - Intergenic
1007748515 6:44057624-44057646 GAGACAATGAGGAGACTGGGAGG - Intergenic
1008264002 6:49401289-49401311 GTGCCAAGAGTGAGAGTGGAAGG - Intergenic
1011672865 6:89700761-89700783 CTGCCCTTGGGGAGAGTGGATGG - Exonic
1013425557 6:110009594-110009616 AAGCCAATGGGGAGAGTTTGGGG - Intergenic
1013983167 6:116157720-116157742 GTTGAAATGGTGAGAGTGGGTGG + Intronic
1016791117 6:148067866-148067888 ATGCGAATGGGGAAACTGGGAGG - Intergenic
1017493306 6:154962850-154962872 CTGCCAATGGCCACAGTGGGAGG - Intronic
1018298785 6:162377741-162377763 GTGCTAATCGGGAGAGTAAGAGG + Intronic
1019322216 7:420922-420944 GTGGGACGGGGGAGAGTGGGCGG - Intergenic
1019983500 7:4638908-4638930 ATAGCAATGGGGAGATTGGGAGG - Intergenic
1021247141 7:18277400-18277422 GTGCAAATTGGAAGAGTGGAAGG + Intronic
1023202328 7:37712168-37712190 GTCCCAAGGGGGAGAGTGGGTGG + Intronic
1023256592 7:38318645-38318667 GTGGCCATGGGGAAGGTGGGTGG - Intergenic
1023315206 7:38929210-38929232 TTGTCAATGGGGACAGGGGGAGG - Intronic
1023996479 7:45161882-45161904 GTGCCCATTGGGATGGTGGGCGG + Intronic
1025035884 7:55592264-55592286 GTACACATGGGGAGTGTGGGGGG + Intergenic
1027132300 7:75599501-75599523 GTGCCAAGGGAGTGAGTGGCAGG - Intronic
1027260113 7:76458850-76458872 GTATCAAGAGGGAGAGTGGGGGG - Intergenic
1027311488 7:76956954-76956976 GTATCAAGAGGGAGAGTGGGGGG - Intergenic
1027564005 7:79768048-79768070 GTGCCCATGGAGGGAGTGAGAGG + Intergenic
1027682285 7:81235890-81235912 GTTCCAATGGGGAAAGTGGAAGG - Intergenic
1030747412 7:113184061-113184083 TTGTCAATGGGCAGAGTGAGTGG - Intergenic
1031847119 7:126819226-126819248 GTGAGAAAGGGGAGAGTGAGGGG - Intronic
1032342604 7:131089450-131089472 CTGCTAGTGGGGAGAGTAGGGGG - Intergenic
1033292701 7:140101257-140101279 TGGACAAAGGGGAGAGTGGGAGG - Intronic
1033650844 7:143342171-143342193 GATCTGATGGGGAGAGTGGGAGG + Intronic
1033708262 7:143909950-143909972 GTGCCAAGAGTGAGAGTGGGTGG + Intergenic
1033738123 7:144244945-144244967 GTCTCAATGGGGGGGGTGGGGGG - Intergenic
1033744930 7:144306008-144306030 GTCTCAATGGGGGGGGTGGGGGG + Intergenic
1033911752 7:146272328-146272350 GTGCCATTGGAGAGACAGGGTGG - Intronic
1033943280 7:146681601-146681623 GTGGGAAAGGGGAGAGTGGGAGG + Intronic
1034071861 7:148193880-148193902 CTCCACATGGGGAGAGTGGGAGG - Intronic
1035554170 8:553263-553285 GTGCCAGTGGTGACAGTGGTGGG + Intergenic
1036813558 8:11884919-11884941 GTGCAAATGGAGAGAGGGGAGGG - Intergenic
1037710741 8:21353475-21353497 GTACCACTGGGGAGGCTGGGAGG + Intergenic
1039228855 8:35420637-35420659 GGGACAAAGGGGAGAGTAGGAGG - Intronic
1041358819 8:57028963-57028985 GTGGCAATATTGAGAGTGGGGGG + Intergenic
1041488183 8:58402077-58402099 GTTCCAAAGGGGAGAATGTGTGG - Intergenic
1042602925 8:70516710-70516732 GGGGAAATGGGGAGATTGGGAGG - Intergenic
1042702497 8:71631539-71631561 GAGCAAATGGGGAGGCTGGGGGG - Intergenic
1042783242 8:72516229-72516251 TTACCTCTGGGGAGAGTGGGAGG + Intergenic
1043485967 8:80699833-80699855 GGTCCAGTGGGCAGAGTGGGTGG - Intronic
1043629304 8:82308527-82308549 GAGACAATGGGGAAAGTAGGGGG + Intergenic
1043954303 8:86342959-86342981 GTGCGAATGGGCAGGGCGGGAGG + Intronic
1045709548 8:104966998-104967020 GTGTGAGTGGGGAAAGTGGGAGG - Intronic
1047434689 8:124826376-124826398 GTTTCAATGGGGAGAGTGCCTGG - Intergenic
1047685581 8:127302028-127302050 ATGGCAATGGGGAGACAGGGTGG + Intergenic
1048282345 8:133114650-133114672 GTCCCAGTGGGAAGAATGGGTGG + Intronic
1048379668 8:133854103-133854125 GAGGCAAGGGGCAGAGTGGGAGG + Intergenic
1049764976 8:144350979-144351001 GTGGCTATGGGGAGAGGGGTTGG - Intergenic
1051847286 9:21465657-21465679 GTGCCAGTGGCCAGGGTGGGTGG + Intergenic
1052990448 9:34516300-34516322 GTGCCAAGGGAGACTGTGGGAGG + Intronic
1056287967 9:85110452-85110474 GTGCCATGGGGGAGAGTGATAGG - Intergenic
1058347898 9:103986293-103986315 GTACCAAGAGAGAGAGTGGGAGG + Intergenic
1059004923 9:110391857-110391879 TCGCCAATGTGGAGGGTGGGGGG + Intronic
1059570227 9:115426308-115426330 GTGACAATGGAGAGAGCAGGTGG - Intergenic
1061131873 9:128713033-128713055 GTCCCTGTGGGGAGAGTGAGCGG - Exonic
1061216573 9:129225199-129225221 GTCCCAAGGGGGAGAGGGAGGGG - Intergenic
1061238833 9:129357672-129357694 GTGCCAGTGGGGAGACGGAGGGG - Intergenic
1061539724 9:131271642-131271664 CTGCCAAAGGGCAGACTGGGCGG - Intronic
1061889943 9:133613584-133613606 GTGCCAGCGGACAGAGTGGGAGG + Intergenic
1062501452 9:136853702-136853724 GTGCCCAAGGGGAGGGCGGGTGG + Intronic
1185452598 X:290797-290819 GACGCAATGGGGAGAGTGGGAGG + Intronic
1186020148 X:5245637-5245659 GTGGCAATGGCTAGTGTGGGAGG + Intergenic
1186293764 X:8126341-8126363 GTGTCTAGGTGGAGAGTGGGAGG - Intergenic
1187389255 X:18875192-18875214 GTGGCAATGGGGGCAGTTGGGGG - Intergenic
1187772251 X:22713074-22713096 GTTCCAGTGGGGAGAGAAGGAGG + Intergenic
1189229798 X:39443361-39443383 GGGACAATGGGGAGGGTGGTAGG + Intergenic
1189288031 X:39866018-39866040 GTGTCAAGGTGGAGAGTGGGAGG + Intergenic
1190578616 X:51868494-51868516 GTGTCAATGGGGACAGTGTAAGG + Intronic
1191039970 X:56068555-56068577 TTGCCAGTGGTGCGAGTGGGTGG - Intergenic
1192464906 X:71347884-71347906 GTGGCGATGGGGGGAGGGGGAGG - Intergenic
1195402426 X:104475688-104475710 GTCTGAATGGGGAGTGTGGGTGG - Intergenic
1196684249 X:118496635-118496657 CTGCAACTGGGGAGAGAGGGTGG + Intronic
1197822882 X:130559559-130559581 GTGGGACTGGGGAGAGTGGCAGG - Intergenic
1198108801 X:133484637-133484659 GTGCAAAGAGGGAGAGGGGGAGG + Intergenic
1198573073 X:137978961-137978983 TTGGGAATGGTGAGAGTGGGGGG + Intergenic
1199852804 X:151737466-151737488 GGAGCAATGGAGAGAGTGGGTGG - Intergenic
1200234672 X:154462491-154462513 CTGGCAATGGTGAGGGTGGGCGG - Intronic
1201583872 Y:15539116-15539138 GTGCCAAGCGTGAGAGTGGATGG + Intergenic