ID: 1147915597

View in Genome Browser
Species Human (GRCh38)
Location 17:43883418-43883440
Sequence AGGGTCCTCCCTCAGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 591}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147915595_1147915597 -8 Left 1147915595 17:43883403-43883425 CCTGGGACACCAAGCAGGGTCCT 0: 1
1: 0
2: 1
3: 9
4: 261
Right 1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG 0: 1
1: 0
2: 6
3: 61
4: 591
1147915589_1147915597 2 Left 1147915589 17:43883393-43883415 CCCCAGGAGCCCTGGGACACCAA 0: 1
1: 1
2: 7
3: 48
4: 262
Right 1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG 0: 1
1: 0
2: 6
3: 61
4: 591
1147915594_1147915597 -7 Left 1147915594 17:43883402-43883424 CCCTGGGACACCAAGCAGGGTCC 0: 1
1: 0
2: 0
3: 20
4: 154
Right 1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG 0: 1
1: 0
2: 6
3: 61
4: 591
1147915590_1147915597 1 Left 1147915590 17:43883394-43883416 CCCAGGAGCCCTGGGACACCAAG 0: 1
1: 0
2: 9
3: 42
4: 319
Right 1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG 0: 1
1: 0
2: 6
3: 61
4: 591
1147915591_1147915597 0 Left 1147915591 17:43883395-43883417 CCAGGAGCCCTGGGACACCAAGC 0: 1
1: 0
2: 1
3: 29
4: 302
Right 1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG 0: 1
1: 0
2: 6
3: 61
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147915597 Original CRISPR AGGGTCCTCCCTCAGCCCCC AGG Intronic
900102255 1:966883-966905 AGGGTCTTCCCCTCGCCCCCGGG + Intronic
900142583 1:1144882-1144904 CGAGGCCTCCCTCAGTCCCCTGG + Intergenic
900238715 1:1604681-1604703 AGGGTCCACTCTGAGCCCCGAGG - Intergenic
900338063 1:2174570-2174592 CGGGTCCTCCCTGGGCCTCCTGG - Intronic
900425240 1:2575327-2575349 AGGGTGGTCCCTCTGCCCCCAGG + Intergenic
900569958 1:3353330-3353352 AGGGCCCTGCCATAGCCCCCAGG - Intronic
900689494 1:3971704-3971726 AGGCTCTTCCCACTGCCCCCGGG - Intergenic
901239016 1:7682161-7682183 AGGGTCCCCCCTCACCCCTGAGG - Intronic
901261075 1:7871388-7871410 AGCATCCTCCCTCACCTCCCAGG + Intergenic
901434138 1:9235715-9235737 ATCGTCCTGCCTCAGCCTCCGGG + Intronic
901448054 1:9319969-9319991 AGGGTCCTGCCTCTGACCCCAGG - Intronic
902078518 1:13805544-13805566 TGGGCCCTCACCCAGCCCCCAGG + Intronic
902862197 1:19254415-19254437 AGGGGCCTGCCTCAGCCAGCAGG + Intronic
903101507 1:21034936-21034958 AGGGTCCCCCTGCAGCCCCAGGG - Intronic
903693932 1:25193842-25193864 ATTCTCCTCCCTCAGCCTCCCGG + Intergenic
904111750 1:28131641-28131663 GGGGACCTCCCTTAGCCCACGGG - Intergenic
904296736 1:29524334-29524356 AGGGAGCTCCCTGACCCCCCAGG + Intergenic
906005216 1:42463402-42463424 AGGTTCCTGCCTCAGCCCCAAGG + Intronic
906315564 1:44784573-44784595 CGGGTCCTCGCTCAGCCTCTGGG - Intronic
906466943 1:46090436-46090458 ATTCTCCTCCCTCAGCCTCCCGG + Intronic
908253707 1:62285336-62285358 TGGGTCCACCCTCAGTGCCCAGG + Intronic
910170404 1:84371058-84371080 AGGGCCCTCCCTCAGCTTCCTGG - Intronic
910955268 1:92696528-92696550 ATCCTCCTCCCTCAGCCTCCTGG - Intronic
911904553 1:103550055-103550077 ATTCTCCTGCCTCAGCCCCCCGG - Intronic
913259247 1:116983445-116983467 ATGGCACTCCCTCTGCCCCCAGG + Intronic
913600505 1:120417254-120417276 ATCCTCCTGCCTCAGCCCCCAGG + Intergenic
914192446 1:145423330-145423352 ATCCTCCTGCCTCAGCCCCCAGG - Intergenic
915558532 1:156673550-156673572 GGGGTCAGCCCTCTGCCCCCAGG + Intronic
916304308 1:163312053-163312075 AGGTCCCTCCCTCAACACCCGGG - Intronic
916353507 1:163878627-163878649 TGGGCCCTCCCTCAGCAGCCAGG + Intergenic
917566580 1:176218422-176218444 AGGACCCTCCCTCAGCACCTGGG - Intergenic
917838632 1:178960005-178960027 TGGGTGCTCCCTGAGCCCCCAGG - Intergenic
918480723 1:184974266-184974288 AGGGTGCTCCCCAGGCCCCCGGG + Intronic
919902853 1:202056931-202056953 AGGGTCCTGCCCCACCCCGCAGG - Intergenic
920576946 1:207068449-207068471 ATTGTCCTCCCTGATCCCCCGGG - Intronic
921862849 1:220057205-220057227 ATCCTCCTGCCTCAGCCCCCTGG + Intergenic
922758486 1:228109626-228109648 TGGATCCTCCCTCAGCCCTGCGG - Intergenic
922758497 1:228109667-228109689 TGGGTCCTCCCTCAGCCCTCCGG - Intergenic
922818181 1:228466021-228466043 AGGGTACTGCCTCAGCTCACAGG - Intergenic
923713900 1:236408858-236408880 ATTCTCCTCCCTCAGCCTCCTGG + Intronic
924226722 1:241928103-241928125 AGTCTCCTGCCTCAGCCTCCCGG + Intergenic
1062860126 10:804421-804443 AGGGTCCTCCCTGAGGAGCCAGG - Intergenic
1064053594 10:12079189-12079211 AAGCTCCTCCCTCAGCCTCTTGG + Intronic
1065065630 10:21960663-21960685 AGGGTCTTCCCTCTGTCCTCTGG - Intronic
1065118786 10:22508043-22508065 AGTATCCTGCCTCAGCCTCCTGG + Intergenic
1065585599 10:27214454-27214476 AAGTTCCTGCCTCAGCCTCCTGG + Intronic
1066105005 10:32148682-32148704 ATCCTCCTGCCTCAGCCCCCTGG + Intergenic
1066118302 10:32259597-32259619 ATCCTCCTCCCTCAGCCTCCTGG + Intergenic
1067433842 10:46263925-46263947 GTGGTGCTCCCTCAGGCCCCAGG + Intergenic
1067799979 10:49352215-49352237 AGGGTCCTTCCTGTGACCCCAGG - Intergenic
1068253126 10:54470047-54470069 TGGGCCTTCCCTCAGCCCCCCGG + Intronic
1068534314 10:58223720-58223742 AGGTTCCTCCCTCAGCACATGGG - Intronic
1068811862 10:61264779-61264801 AGGTTCCTCCCTCAACACCTGGG + Intergenic
1069013129 10:63397318-63397340 ATTCTCCTGCCTCAGCCCCCCGG + Intronic
1069063214 10:63915609-63915631 AGGTTCCTCCCTCAACACCTGGG - Intergenic
1070384626 10:75913348-75913370 ATTCTCCTGCCTCAGCCCCCCGG - Intronic
1070749583 10:78955989-78956011 GGGGTCCTGCCCCTGCCCCCTGG - Intergenic
1070940028 10:80336468-80336490 TGGTTCCTCCCTGAGCCCCCAGG + Intronic
1071245195 10:83754105-83754127 AGAATCCTGCCTCAGCACCCAGG - Intergenic
1072259191 10:93651572-93651594 AGGTTCCTCCCTCAACACCTGGG + Intronic
1072662291 10:97370425-97370447 AGTGTCCACCCCCAGCCCCCTGG + Intronic
1073101974 10:101011145-101011167 AGTCTCCTGCCTCAGCCTCCCGG + Intronic
1073126269 10:101152078-101152100 AGACTCCTGCCTCAGCCTCCCGG + Intergenic
1074050343 10:109876014-109876036 AGGCCCCTGCCTCAGCCTCCAGG + Intronic
1074249594 10:111731178-111731200 AGGGGTCTCCCTCAGCCCTGTGG - Intergenic
1074478613 10:113796840-113796862 AGTCTCCTGCCTCAGCCTCCAGG - Intergenic
1074538357 10:114344988-114345010 ATTCTCCTGCCTCAGCCCCCCGG - Intronic
1075645594 10:124093934-124093956 AGTCTCCTGCCTCAGCCTCCCGG + Intergenic
1076253289 10:128999715-128999737 AGGCCTCTCCCTCAGCACCCGGG - Intergenic
1076368461 10:129936726-129936748 AGGGTCCCCCCATAGCCCCCTGG - Intronic
1076368477 10:129936764-129936786 AGGGTCCCCCCACAGCCCCCTGG - Intronic
1076529208 10:131133460-131133482 TGGGTCCTGCCACAGCCCACAGG - Intronic
1076606459 10:131692737-131692759 AGGGTCCTCCCGCAGAGCCGTGG + Intergenic
1077268890 11:1665945-1665967 CGGGCCCGCCCTCAGCCTCCAGG - Intergenic
1077271862 11:1685235-1685257 CGGGCCCGCCCTCAGCCTCCAGG + Intergenic
1077315964 11:1919479-1919501 AAGGTCCTCCCTCCGCCTCCAGG - Intergenic
1077370077 11:2177667-2177689 AGGGTCCTGACTCAGCCCCTTGG + Intergenic
1078549448 11:12270170-12270192 AGGGCCCTCCCTCATCCTGCTGG + Intergenic
1079097933 11:17522942-17522964 AGGCCCCTTGCTCAGCCCCCGGG + Intronic
1079450557 11:20597233-20597255 AGCGCCCCCGCTCAGCCCCCAGG - Intergenic
1080387026 11:31816404-31816426 AGAGTCCTCGCTCCGCGCCCAGG - Intronic
1080429950 11:32189124-32189146 AGGTCTCTCCCTCAGCCCCTGGG - Intergenic
1081694196 11:45098266-45098288 AGGGTCCTTCCTTAGCACACAGG - Intronic
1081782778 11:45724615-45724637 AGTCTCCTGCCTCAGCCTCCCGG - Intergenic
1081789000 11:45769503-45769525 CGAGGCCTCCCTCAGCCCCCAGG + Intergenic
1081944147 11:46974124-46974146 ATCCTCCTGCCTCAGCCCCCTGG - Intronic
1082000723 11:47392633-47392655 ATGGTACTGCCACAGCCCCCAGG - Intergenic
1084336917 11:68463811-68463833 TGGTTCCCCCCTCACCCCCCAGG + Intronic
1084673763 11:70622553-70622575 GGGGCCCTCCCTCAGCTCCAGGG + Intronic
1085023273 11:73222164-73222186 AGGGACCTCCCTCAGACTTCTGG + Intronic
1085201281 11:74703731-74703753 AGAGTCCTCCCTCACCCTTCAGG + Intronic
1085743711 11:79097360-79097382 TGGTTCCTTCCTCAGCCTCCAGG - Intronic
1086220837 11:84441251-84441273 ATCTTCCTCCCTCAGCCTCCAGG + Intronic
1086887728 11:92224515-92224537 CGAGTCTTCCCTCAGCCCTCTGG - Intergenic
1087094128 11:94304299-94304321 AGTGTCCTCGCACAGCCCACAGG - Intergenic
1087318625 11:96633813-96633835 ATTCTCCTGCCTCAGCCCCCGGG - Intergenic
1088163280 11:106900288-106900310 AGCCTCCTACCTCAGCCTCCTGG + Intronic
1088469129 11:110175594-110175616 AGGGTCCCCCTTCAGCCCCTGGG + Intronic
1089195798 11:116693375-116693397 TGGGCCCTCCCCCAGCCTCCTGG - Intergenic
1090613838 11:128496859-128496881 AGTGTCCCTCCTCAGCCCCTCGG + Intronic
1091477366 12:788778-788800 ATTCTCCTCCCTCAGCCTCCTGG - Intronic
1091979012 12:4850624-4850646 AGTGTCCTTCCTCACCCCGCTGG - Intronic
1092244177 12:6853998-6854020 AGGGTCTTCCCTCAGATCCAAGG - Intronic
1092852782 12:12646234-12646256 ATGCTCCTGCCTCAGCCTCCTGG + Intergenic
1093923875 12:24889868-24889890 AAGGTCCTGCCTCATACCCCAGG + Intronic
1094164232 12:27425843-27425865 CCTGTCCTCCCTCAGGCCCCAGG + Intergenic
1094169575 12:27478634-27478656 AGGCTGGTCCCTAAGCCCCCAGG + Intronic
1095679856 12:44961070-44961092 AGGGGCATTCCTCAGTCCCCTGG - Intergenic
1096281245 12:50255994-50256016 ATTGTCCTGCCTCAGCCTCCTGG + Intronic
1097043698 12:56171793-56171815 AGAGGCCTCCCTAGGCCCCCTGG - Exonic
1098572260 12:72001530-72001552 ATTCTCCTGCCTCAGCCCCCCGG + Intronic
1098882947 12:75935267-75935289 ATACTCCTGCCTCAGCCCCCCGG - Intergenic
1099417153 12:82404835-82404857 ATTCTCCTGCCTCAGCCCCCAGG - Intronic
1099952969 12:89324529-89324551 AGCGACTTCCCTCAGGCCCCAGG + Intergenic
1100247914 12:92782845-92782867 AGGGTCCTGCCTCATACCCTGGG + Intronic
1100454023 12:94734181-94734203 AGGGTGCTGCCCCAGCCCCATGG - Intergenic
1101572790 12:105970464-105970486 GTGGTCCTCCCTGACCCCCCTGG + Intergenic
1101840558 12:108324754-108324776 AGGGTGCACCCTCAGCCCTCAGG - Intronic
1101845571 12:108360585-108360607 AGGGGCTTCCCACAGTCCCCAGG - Intergenic
1101899697 12:108782282-108782304 AGGGTCCTCCCTCTCCCACCAGG + Intergenic
1103057395 12:117832685-117832707 AGGGTGCTCCTTCAGACCCCAGG + Intronic
1103734631 12:123052007-123052029 AGTCTCCTGCCTCAGCCTCCCGG + Intronic
1103737567 12:123070294-123070316 AGGGACCTGCTTCAGCTCCCAGG - Intronic
1103752307 12:123173476-123173498 AGGGTCCTGCCTCATCCTCTGGG + Intronic
1104014045 12:124950550-124950572 AGCTTCCTCCCCCGGCCCCCAGG - Exonic
1104019705 12:124983676-124983698 ATTGTCCTGCCTCAGCCTCCCGG - Intronic
1104288611 12:127447783-127447805 AGGGGCCTGCCTCAGCACCGGGG - Intergenic
1104671412 12:130683139-130683161 AGGGTCCACCCCAACCCCCCTGG - Intronic
1104980406 12:132570907-132570929 GGCTTCCTCCCTCGGCCCCCAGG + Intronic
1105480914 13:20774345-20774367 AGTCTCCTGCCTCAGCCTCCTGG - Intergenic
1105498646 13:20952679-20952701 ATGCTCCTGCTTCAGCCCCCTGG + Intergenic
1106351099 13:28931341-28931363 AGGTTCCTCCCTCAACACCTGGG - Intronic
1107459810 13:40591029-40591051 GGGGTCCTCCATCTGTCCCCAGG - Intronic
1107831236 13:44374788-44374810 CGAGACCTCCCTCAGCCCCTAGG + Intronic
1108156695 13:47592428-47592450 AGGGCCATCCCTGAGACCCCAGG - Intergenic
1108574279 13:51778116-51778138 AGGGGCCTCCCTCTGAACCCTGG + Intronic
1109331917 13:60941273-60941295 AGGGTCCTCCCTCACCTACTAGG + Intergenic
1109835481 13:67851257-67851279 AGTGACATCCCTCAGCCTCCTGG + Intergenic
1110433503 13:75454126-75454148 ATCTTCCTACCTCAGCCCCCTGG + Intronic
1111051015 13:82883298-82883320 AGGTTCCTCCCTCAACACACGGG - Intergenic
1111990032 13:95107148-95107170 ATTGTCCTGCCTCAGCCTCCCGG - Intronic
1112263272 13:97898168-97898190 AGGTTCCTCCCTCAACACCTGGG + Intergenic
1112340168 13:98546507-98546529 AGGGACTTCCTTCAGTCCCCTGG + Intronic
1113851898 13:113422747-113422769 AGGGCCCTCTCGCAGCCCCTGGG - Exonic
1114628905 14:24147085-24147107 AGGGTCTTCCCTCTGCCTTCAGG + Exonic
1115122179 14:29950932-29950954 AGGTCCCTCCCTCAGCGCCTGGG - Intronic
1116433832 14:44875166-44875188 ATTCTCCTGCCTCAGCCCCCTGG - Intergenic
1117105748 14:52395609-52395631 AGGGACCTGCCTCAGTCACCAGG + Intergenic
1120391240 14:83911033-83911055 AGGTTCCTCCCTCAACACCTGGG - Intergenic
1120845846 14:89124206-89124228 AGGCTCCACCCTCTGCACCCTGG + Intergenic
1121042224 14:90758595-90758617 AAGGTCGTCCCGCAGCCCCTCGG - Intronic
1121043427 14:90769905-90769927 ACTCTCCTGCCTCAGCCCCCTGG - Intronic
1121457363 14:94046980-94047002 AGCTTCCTCCTTCAGCCACCTGG + Exonic
1121529595 14:94643261-94643283 AGGCTCCGGGCTCAGCCCCCAGG + Intergenic
1121817917 14:96942598-96942620 AAAGTCCTCCCCCAGTCCCCAGG - Intergenic
1122229460 14:100298393-100298415 AGGGCCCTTCCTCAGGCCTCTGG + Intronic
1122557154 14:102587187-102587209 ATGCTCCTGCCTCAGCCTCCAGG + Intergenic
1122634681 14:103124407-103124429 AAGGTCCTGCTGCAGCCCCCTGG - Intronic
1122994083 14:105253260-105253282 AGTGTCCTCCCCCAGCCAGCAGG - Intronic
1123710636 15:22984511-22984533 ATTCTCCTGCCTCAGCCCCCGGG - Intronic
1124214301 15:27793840-27793862 AGGGCCATCTCCCAGCCCCCTGG - Intronic
1124914819 15:33959541-33959563 GGGGGCCTCCCTCTGCCCCTAGG - Intronic
1125482227 15:40088750-40088772 AGTGACCTCCCTCAGCCCCCAGG - Exonic
1125501424 15:40242164-40242186 GGAGTCCTCCCTGAGCCCTCAGG - Intronic
1125972992 15:43927272-43927294 GGGGACCTCCCCCAGCCCACTGG + Intronic
1125974558 15:43939662-43939684 ATCCTCCTACCTCAGCCCCCTGG + Intronic
1126060536 15:44776739-44776761 ATTCTCCTGCCTCAGCCCCCAGG + Intergenic
1126142084 15:45447040-45447062 ATGCTCCTGCCTCAGCCTCCTGG + Intronic
1126413915 15:48398395-48398417 AGGGTCTTCCTCCATCCCCCCGG + Intergenic
1126760119 15:51962054-51962076 ATTCTCCTCCCTCAGCCTCCTGG - Intronic
1126844535 15:52746470-52746492 GTGGGCCTCCCTCAGCCCACTGG - Intergenic
1128079937 15:64850932-64850954 AGGCTCCCCCTTCTGCCCCCAGG - Intronic
1128969829 15:72098728-72098750 ACCCTCCTGCCTCAGCCCCCTGG - Intronic
1129280993 15:74484931-74484953 ACTTTCCTGCCTCAGCCCCCCGG + Intergenic
1129539034 15:76336485-76336507 AGGATCCTCTCTCATGCCCCGGG - Intergenic
1129602544 15:77008783-77008805 AGGCTCCTCACACAGCCCCCAGG + Intronic
1129673788 15:77621613-77621635 AGGGCCTTCCCTCAGCCCTGGGG - Intronic
1129736251 15:77966534-77966556 AGGGTACTGCCTCAGCCACCAGG + Intergenic
1130737932 15:86570228-86570250 GGGGACCTCCCCCAGCCCACTGG - Intronic
1131050918 15:89347261-89347283 ATGGTCCTCACCCAGGCCCCAGG - Intergenic
1132488519 16:210942-210964 ATTGTCCTGCCTCAGCCTCCCGG - Intronic
1132634370 16:936219-936241 AGCCTCCTTCCTCAGCCCACGGG - Intronic
1132634384 16:936260-936282 AGCCTCCTTCCTCAGCCCACGGG - Intronic
1132634436 16:936422-936444 AGCCTCCTTCCTCAGCCCACGGG - Intronic
1132634490 16:936584-936606 AGCCTCCTTCCTCAGCCCACGGG - Intronic
1132806218 16:1776291-1776313 GGGGTCCTCCCCCACCGCCCAGG - Exonic
1132870597 16:2114134-2114156 AGGCTCCACCACCAGCCCCCAGG - Intronic
1133290301 16:4716252-4716274 ATTCTCCTGCCTCAGCCCCCCGG - Intronic
1133728562 16:8559147-8559169 ATTGTCCTGCCTCAGCCTCCTGG + Intergenic
1133897882 16:9946511-9946533 ATGGGCCTCCCTGAGCCACCTGG + Intronic
1134521935 16:14922770-14922792 AGGCTCCACCACCAGCCCCCAGG + Intronic
1134709604 16:16321421-16321443 AGGCTCCACCACCAGCCCCCAGG + Intergenic
1134716818 16:16361450-16361472 AGGCTCCACCACCAGCCCCCAGG + Intergenic
1134949998 16:18347224-18347246 AGGCTCCACCACCAGCCCCCAGG - Intergenic
1134957934 16:18390709-18390731 AGGCTCCACCACCAGCCCCCAGG - Intergenic
1135436271 16:22428751-22428773 AGGCCCGTCCCTCACCCCCCAGG - Intronic
1136590809 16:31216622-31216644 GGGGTCCTCCCTCAGACCTCCGG - Intronic
1138585476 16:57967246-57967268 AGGGTGCTGCCTCAGCCCCCAGG - Exonic
1138615076 16:58158648-58158670 AGGCTTCTCCATCAGCACCCTGG - Intronic
1139283341 16:65788529-65788551 AGGGTGGTCCCTCAGCACCCAGG + Intergenic
1139583306 16:67885647-67885669 AGGCTCATCCCCCAGCCCCCAGG - Intronic
1139808202 16:69588057-69588079 ATTCTCCTGCCTCAGCCCCCTGG + Intronic
1139821778 16:69726700-69726722 AGGCCCCTCCTTCATCCCCCAGG - Exonic
1139916492 16:70431422-70431444 AGGGTCCCCTCTCTGCCCCTGGG + Intronic
1140218815 16:73028767-73028789 GGGGCCCTCCCACAGCCCCGGGG + Intronic
1140440597 16:74984865-74984887 AGGGTCTCCCCGTAGCCCCCCGG + Intronic
1140897224 16:79335471-79335493 AGGGTCCTTCCTGTCCCCCCTGG - Intergenic
1141334309 16:83140558-83140580 ATTTTCCTGCCTCAGCCCCCAGG + Intronic
1141538646 16:84700469-84700491 AGGGGACTCCCGGAGCCCCCGGG - Intronic
1141595490 16:85094749-85094771 AGGGGCATCCCCCAGACCCCAGG + Intergenic
1142114269 16:88348239-88348261 AGGGAGCTCCCGCAGCCACCAGG - Intergenic
1142237542 16:88929343-88929365 CGGGTCCTCCCGCAGGCCCGTGG - Intronic
1142247013 16:88974850-88974872 AGGGGCCTCCCAAGGCCCCCAGG - Intronic
1142264801 16:89058729-89058751 GGGCTCCTGCCTCAGCCTCCAGG - Intergenic
1142338758 16:89507612-89507634 AGGGTCCGCCCTCCGGGCCCGGG - Intronic
1142610607 17:1107705-1107727 AGAGGCCTCCCTGAGCCCACGGG + Intronic
1142809785 17:2390186-2390208 AGGGTGCTTACTCAGCCCCAGGG + Intronic
1143214269 17:5212525-5212547 ATTGTCCTGCCTCAGCCTCCTGG - Intronic
1143544593 17:7588813-7588835 AGCTTCCTCTCCCAGCCCCCAGG - Intronic
1143549284 17:7619597-7619619 ATTGTCCTGCCTCAGCCTCCTGG - Intronic
1143553815 17:7648460-7648482 CGGTTCCTCCCTCAGTCTCCCGG - Intronic
1143729757 17:8874417-8874439 AGGGCTCTCCCACAGCCTCCAGG - Intergenic
1143736213 17:8913603-8913625 AGTCTCCTGCCTCAGCCTCCCGG - Intronic
1143893324 17:10118595-10118617 ATTCTCCTGCCTCAGCCCCCAGG - Intronic
1144550447 17:16236672-16236694 AGTCTCCTGCCTCAGCCTCCTGG + Intronic
1144579839 17:16452248-16452270 AGCCTCCTACCTCAGCCTCCCGG - Intronic
1144726460 17:17504902-17504924 AGGGTCACCCCTCAGCCCCCAGG - Intergenic
1145248917 17:21286843-21286865 AGGGACCTCCCTCAGGCCCAGGG + Intronic
1145259104 17:21344109-21344131 AGGGGCCTCCCGCAGGGCCCTGG - Intergenic
1145317514 17:21743894-21743916 AGGGGCCTCCCGCAGGGCCCTGG + Intergenic
1146129368 17:30258072-30258094 ATCCTCCTGCCTCAGCCCCCTGG + Intronic
1146323769 17:31867848-31867870 ATTCTCCTGCCTCAGCCCCCCGG - Intronic
1146801475 17:35827227-35827249 ATTCTCCTCCCTCAGCCTCCAGG - Intronic
1147353479 17:39870148-39870170 AGTCTCCTCCCTCAGCCTCCCGG + Intronic
1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG + Intronic
1148023663 17:44570230-44570252 ATTGTCCTGCCTCAGCCTCCTGG + Intergenic
1148470722 17:47891511-47891533 AGGACCCTCCCTCAGCATCCTGG + Intergenic
1148635753 17:49148191-49148213 ATTGTCCTGCCTCAGCCTCCTGG - Intronic
1149150877 17:53562250-53562272 ATTCTCCTGCCTCAGCCCCCTGG - Intergenic
1149482930 17:57018094-57018116 GGGGGCCTTCCTGAGCCCCCAGG - Intergenic
1149637489 17:58182725-58182747 ATTCTCCTGCCTCAGCCCCCAGG + Intergenic
1149685139 17:58530921-58530943 AGGGAGCTCCCTGGGCCCCCTGG - Intronic
1150529063 17:65958444-65958466 AGGGACCTTCCCCAACCCCCAGG - Intronic
1150559602 17:66283095-66283117 GGGGACCTCCCTCAGCCCACTGG - Intergenic
1150904864 17:69326845-69326867 ACAGACCTCCCTCAGCTCCCGGG - Intronic
1151286192 17:73113363-73113385 AGGGTCCTCCTCCAAGCCCCTGG + Intergenic
1151334434 17:73431749-73431771 ATGGTCCCCCCACAGGCCCCTGG + Intronic
1151579335 17:74969299-74969321 ATTCTCCTGCCTCAGCCCCCGGG + Intronic
1151911539 17:77086681-77086703 ATGGCCCTACCTCTGCCCCCTGG - Intergenic
1151941925 17:77298057-77298079 AGGGTCCTCCATCTGGCCCCAGG - Intronic
1152029221 17:77831243-77831265 AGGCTCATCCCTCAGGACCCAGG - Intergenic
1152147483 17:78577040-78577062 AAGGCCTTGCCTCAGCCCCCTGG - Intronic
1152252146 17:79217866-79217888 CGGCTCCTCCCTAAGCCCCGTGG - Intronic
1152363540 17:79843159-79843181 AGGGTGCCCCCCCAACCCCCGGG + Intergenic
1152566030 17:81100836-81100858 AGGGTCCTCCCCTGGCTCCCAGG + Intronic
1152603611 17:81277909-81277931 AGAGTCCTCGTTCAGCCCCATGG - Intronic
1152815410 17:82404845-82404867 ATTGTCCTGCCTCAGCCTCCGGG + Intronic
1152927790 17:83095540-83095562 AGGGTCCTCCCTGGAACCCCTGG - Intergenic
1152927838 17:83095698-83095720 AGGGTCCTCCCTGGAACCCCCGG - Intergenic
1152931462 17:83112181-83112203 AGGGTCCTCTCTCCACCCCCGGG + Intergenic
1153227553 18:2909910-2909932 GGCGTCCTCCCTGAGCCCACGGG - Intronic
1153707986 18:7766683-7766705 AGTGGCCTCCCTGAGCTCCCTGG - Intronic
1154016525 18:10623531-10623553 ATTCTCATCCCTCAGCCCCCTGG + Intergenic
1155205655 18:23555815-23555837 CAGCTCCTTCCTCAGCCCCCAGG + Intronic
1155584956 18:27354095-27354117 ATTGTCCTGCCTCAGCCTCCCGG - Intergenic
1155860483 18:30891472-30891494 AGTCTCCTGCCTCAGCCTCCTGG - Intergenic
1156572857 18:38278947-38278969 AGGTTCCTCCCTCAACACCTGGG + Intergenic
1156842757 18:41628888-41628910 ATTCTCCTGCCTCAGCCCCCTGG + Intergenic
1158345924 18:56517225-56517247 GGGGACCTCGCTCAGCCCCTTGG - Intergenic
1158748189 18:60226599-60226621 TGGGTCCAACCTCAGGCCCCTGG + Intergenic
1158842731 18:61405478-61405500 ATCCTCCTGCCTCAGCCCCCTGG - Intronic
1158986700 18:62825031-62825053 ATTGTCCTCCCTCAGTCTCCCGG + Intronic
1159703788 18:71661918-71661940 AGTTTCCTCCCTCAACACCCGGG - Intergenic
1160832902 19:1111788-1111810 TGGGTCCTCCCCCAGACCCCTGG + Intronic
1160848916 19:1180419-1180441 GGGCACCTCCCTCGGCCCCCTGG - Intronic
1160998638 19:1897397-1897419 ATTCTCCTGCCTCAGCCCCCCGG + Intergenic
1161068205 19:2248409-2248431 GGGGTCCACCCTCAGCCTCCGGG + Exonic
1161157717 19:2741823-2741845 AGGGTCCTGCCCCATCACCCAGG + Intergenic
1161778332 19:6275943-6275965 AGGCTCCTCCCCCTCCCCCCTGG - Intronic
1161872215 19:6878940-6878962 AGTCTCCTGCCTCAGCCTCCCGG + Intergenic
1161884090 19:6980206-6980228 ATTCTCCTGCCTCAGCCCCCTGG + Intergenic
1162058027 19:8076866-8076888 AGCCTCCTACCTCAGCCTCCTGG + Intronic
1162385041 19:10355853-10355875 ATTGTCCTGCCTCAGCCTCCTGG - Intronic
1162397151 19:10423894-10423916 AGGGTCCTCCCCCATTCCCAGGG + Intronic
1163233726 19:16019611-16019633 AGGGGCCTCAGTCAGTCCCCAGG + Intergenic
1163325398 19:16600149-16600171 TAGGTCCCCCCTCATCCCCCCGG + Intronic
1163418460 19:17201125-17201147 ATCTTCCTGCCTCAGCCCCCAGG - Intronic
1163570035 19:18075848-18075870 AGAGTCCTGCCTCTGCCCCCTGG - Exonic
1163571529 19:18085040-18085062 AGCGACCTCCCTCAGCCACTGGG + Intronic
1163636104 19:18437832-18437854 CGCCTCCTTCCTCAGCCCCCTGG + Intronic
1163714010 19:18863698-18863720 AGAGCCCTCCCTCAGCTCACGGG - Intronic
1163724295 19:18913713-18913735 AGGGTGCTCGCCCAGGCCCCTGG + Intronic
1163725592 19:18921566-18921588 GGGTTCCTCCCTGAGCCCCCAGG - Intronic
1163731572 19:18952655-18952677 AGTTTCCTCCCTCAGGCCCTGGG - Intergenic
1163822501 19:19504097-19504119 ATCCTCCTCCCTCAGCCTCCTGG - Intronic
1164147132 19:22518949-22518971 AGGCTCCTCCCTCAGTGCCCTGG + Intronic
1164159500 19:22617380-22617402 AGGCTCCTCCCTCAGTGCCCTGG - Intergenic
1164182427 19:22831448-22831470 ATTGTCCTGCCTCAGCCTCCTGG - Intergenic
1164724493 19:30457163-30457185 AAGGTGCTCCCACAGGCCCCAGG - Intronic
1165093882 19:33400291-33400313 AGGGCCCGCCCTCAGCACACAGG - Intronic
1165336637 19:35174833-35174855 ATTTTCCTGCCTCAGCCCCCCGG - Intergenic
1165761015 19:38321130-38321152 AGGGTCCTCGCTAAGGCGCCAGG - Intronic
1166081177 19:40444729-40444751 AGCGTCCTCCCTCGGAACCCCGG - Intergenic
1167149915 19:47702471-47702493 GGTGTCCGCCCTCAGCCTCCTGG + Exonic
1167208452 19:48118071-48118093 AATGTCCTGCCTCAGCCCCCAGG - Intronic
1167448496 19:49553561-49553583 TGGCTCCTGCCTCAGCCTCCTGG - Intergenic
1168220976 19:54960260-54960282 ATTCTCCTCCCTCAGCCTCCTGG + Intronic
1168326376 19:55540786-55540808 AGGCCCTTCCCCCAGCCCCCAGG - Exonic
1168495488 19:56844712-56844734 ATTCTCCTCCCTCAGCCTCCTGG + Intergenic
925213561 2:2072647-2072669 AGGTTCCTCCCTCAACTCCTGGG - Intronic
925339374 2:3125734-3125756 GGGGCCCTGCCTCAGCCCCCTGG + Intergenic
925356961 2:3248485-3248507 ATTGTCCTGCCTCAGCCTCCTGG - Intronic
925688303 2:6494994-6495016 AGTTTCCTGCCTCAGCCTCCTGG - Intergenic
925752301 2:7099739-7099761 AGGTTCCTCCCTCAGCACCTGGG - Intergenic
926010323 2:9401424-9401446 AGGGACGTGGCTCAGCCCCCAGG - Intronic
926218257 2:10918837-10918859 CTGCTCCTCCCACAGCCCCCAGG + Intergenic
926225099 2:10961601-10961623 AGGGTCCTCCCTGGGCCTCCAGG - Intergenic
926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG + Intronic
926325074 2:11778341-11778363 AGGGACCACCCTCTGCCCCTTGG + Intronic
927870364 2:26619249-26619271 CGGAGCCTCCCTCACCCCCCGGG - Intronic
927908621 2:26880558-26880580 AGCTTCCTCTCTCAGCCCCAAGG + Intronic
929597405 2:43185046-43185068 AGGGTTCTCCCACAGCCCCAGGG + Intergenic
929947741 2:46383111-46383133 AGGGTTCTCCCTAAAGCCCCAGG - Intronic
930163454 2:48180937-48180959 ATCCTCCTGCCTCAGCCCCCTGG + Intergenic
931677400 2:64711068-64711090 AGTCTCCTGCCTCAGCCTCCTGG - Intronic
932478968 2:72027426-72027448 AGGGTCAGTCCTCAGCCCCATGG - Intergenic
933054292 2:77642722-77642744 AGGGTGATATCTCAGCCCCCTGG + Intergenic
934130896 2:88947745-88947767 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934132909 2:88966707-88966729 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934135536 2:88992853-88992875 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934137467 2:89010426-89010448 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934140322 2:89040667-89040689 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934140911 2:89046435-89046457 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934146548 2:89100303-89100325 AGAGTCCTCGCTCAGCTCCTGGG - Intergenic
934148287 2:89117786-89117808 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934153321 2:89171181-89171203 AGGGTCCCCACTCAGCTCCAGGG - Intergenic
934166354 2:89297707-89297729 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934168576 2:89320068-89320090 AGGGTCCCCGCTCAGCTCCTGGG - Intergenic
934198711 2:89862514-89862536 AGGGTCCCCGCTCAGCTCCTGGG + Intergenic
934200922 2:89884749-89884771 AGGGTCCCCGCTCAGCTCCTGGG + Intergenic
934213914 2:90010750-90010772 AGGGTCCCCACTCAGCTCCAGGG + Intergenic
934222720 2:90100272-90100294 AGGGTCCTCGCTCAGCTCCTGGG + Intergenic
934228321 2:90154107-90154129 AGGGTCCCCGCTCAGCTCCTGGG + Intergenic
934231781 2:90190222-90190244 AGGGTCCCCGCTCAGCTCCTGGG + Intergenic
934234771 2:90220917-90220939 AGGGTCCCCGCTCAGCTCCTGGG + Intergenic
934574258 2:95390557-95390579 TGGGCCCTCCCCCAGCCCTCTGG + Intergenic
934818893 2:97354878-97354900 AGGGTCCCCGCTCAGCTCCTGGG + Intergenic
935386221 2:102502528-102502550 GGGGCCCTCCCTCAGCCCTAGGG - Intronic
935976455 2:108583799-108583821 ATTGTCCTGCCTCAGCCTCCCGG + Intronic
936144781 2:109973352-109973374 TGGGTCTTTCCTCAGACCCCTGG + Intergenic
936181467 2:110271315-110271337 TGGGTCTTTCCTCAGACCCCTGG + Intergenic
936199905 2:110398117-110398139 TGGGTCTTTCCTCAGACCCCTGG - Intergenic
936547646 2:113406405-113406427 AGGGTCCCCGCTCAGCTCCTGGG + Intergenic
937882481 2:126878717-126878739 TGGGTCCTGCCTCAGTTCCCAGG + Intergenic
938157431 2:128953129-128953151 AGCTTCCTGCCTCAGCCTCCAGG - Intergenic
938499490 2:131823016-131823038 AGAGACCTCCCTCAGGCCCTAGG + Intergenic
940087276 2:149874181-149874203 AGGGTGCTCCCTCAGGCTCTAGG - Intergenic
940129789 2:150368494-150368516 GGGGTCTTCCCTCAGTTCCCTGG - Intergenic
940297188 2:152139448-152139470 GGCCTCCTCCCTCAGCCTCCTGG - Intronic
940447459 2:153793076-153793098 ATTGTCCTGCCTCAGCCTCCAGG + Intergenic
940968970 2:159873272-159873294 ATGGTCTTGCCACAGCCCCCTGG + Intronic
942176494 2:173339659-173339681 ATTCTCCTGCCTCAGCCCCCTGG + Intergenic
943074104 2:183173973-183173995 ATTGTCCTGCCTCAGCCTCCTGG + Intergenic
943247378 2:185473153-185473175 CCCGCCCTCCCTCAGCCCCCTGG - Intergenic
943620498 2:190142701-190142723 GGGGACCTCCCCCAGCCCGCTGG - Intronic
943828002 2:192420683-192420705 AGGTTCCTCCCTCAACACCGAGG - Intergenic
943875436 2:193061529-193061551 AGGCTTCTGCCTCAGCCACCAGG - Intergenic
944237414 2:197453141-197453163 TGGGGCTTCCCGCAGCCCCCGGG + Intergenic
944629337 2:201607533-201607555 ATGATCCTACCTCAGCCCACAGG - Intronic
945579404 2:211573561-211573583 ATTGTCCTGCCTCAGCCTCCCGG - Intronic
946782575 2:223206138-223206160 TGGGTCCATCCTCAGGCCCCAGG - Intergenic
946836941 2:223782116-223782138 ATTCTCCTGCCTCAGCCCCCTGG + Intronic
946876134 2:224131675-224131697 AAACTCCTCCCTCTGCCCCCAGG + Intergenic
946919088 2:224559345-224559367 ATTCTCCTCCCTCAGCCTCCCGG - Intronic
947093495 2:226540450-226540472 AGGCTCCTCCCTCAACACCTGGG + Intergenic
947139993 2:227011838-227011860 AGGGTGATCCCACAGCCACCAGG + Intronic
947430565 2:230024189-230024211 ATTCTCCTCCCTCAGCCTCCTGG + Intergenic
947522957 2:230862540-230862562 ATGGACCTCCCGCAGCCTCCTGG + Intergenic
948014258 2:234675036-234675058 AGGGATCTCCCCCAGCCCACTGG - Intergenic
948407641 2:237734385-237734407 AGTCTCCTGCCTCAGCCTCCTGG + Intronic
948791562 2:240380749-240380771 AGGTTCCTCCCTCAACACCTGGG - Intergenic
948809887 2:240469041-240469063 AGGGGCCCCGCTGAGCCCCCAGG - Intergenic
1168973562 20:1947470-1947492 AGGGTCCTCCCTCAGGGCCTCGG - Intergenic
1169012336 20:2260979-2261001 ATCCTCCTGCCTCAGCCCCCTGG + Intergenic
1170855714 20:20052228-20052250 AGGGGCATCCCTCAGCCCTGAGG - Intronic
1171311478 20:24148604-24148626 CACTTCCTCCCTCAGCCCCCAGG + Intergenic
1171412828 20:24958234-24958256 AGGGTCCTCGCTCTGCAGCCTGG + Intronic
1172118215 20:32583911-32583933 GGGGCGCCCCCTCAGCCCCCCGG - Intronic
1172142853 20:32735748-32735770 AGGCTCCTGCCTCAGCCTCCTGG + Intronic
1172200063 20:33119322-33119344 GGGGACCTCCCCCAGCCCACCGG - Intergenic
1172658064 20:36548998-36549020 AGCCCCATCCCTCAGCCCCCTGG - Intronic
1173634875 20:44546657-44546679 ATTCTCCTGCCTCAGCCCCCCGG + Intronic
1174023892 20:47556039-47556061 ATTCTCCTGCCTCAGCCCCCTGG + Intronic
1174245928 20:49180428-49180450 ATTCTCCTGCCTCAGCCCCCGGG + Intronic
1174403131 20:50286707-50286729 AGGAGCAGCCCTCAGCCCCCTGG - Intergenic
1174471270 20:50762986-50763008 AGTGTCCTTCCTCCACCCCCAGG + Intergenic
1174758474 20:53183099-53183121 AGGGTCCTTTCTCAGCTGCCAGG - Intronic
1175661619 20:60817853-60817875 TTGGTCTTCCCTCAGCCACCAGG - Intergenic
1175815668 20:61882039-61882061 CAGGTCCTCCCTCAAGCCCCTGG + Intronic
1175945768 20:62558025-62558047 AGAGTCCTCCCTGGGCACCCAGG - Intronic
1176161596 20:63651476-63651498 AGTGACCTCCATCTGCCCCCGGG - Intronic
1176205772 20:63887374-63887396 AGGGTCCTCCCTTGGCCTCATGG - Intronic
1176222351 20:63975646-63975668 GGGCTTCTCCATCAGCCCCCAGG + Intronic
1176377501 21:6093831-6093853 AGGGTCCCCTCGCAGCACCCAGG + Intergenic
1178434816 21:32548909-32548931 AGTCTCCTGCCTCAGCCTCCTGG + Intergenic
1178765911 21:35450756-35450778 AGGCTTCTCCCTGAGCACCCAGG + Intronic
1179175546 21:39005356-39005378 AGGTTCCTCCCTGAGCCTTCAGG - Intergenic
1179745974 21:43444413-43444435 AGGGTCCCCTCGCAGCACCCAGG - Intergenic
1179789587 21:43748761-43748783 TGAGTCCTCCCTCGGCCCCTCGG + Intronic
1179798751 21:43800699-43800721 TGGGCCCTTCCGCAGCCCCCGGG + Intronic
1179983870 21:44910610-44910632 AAGGTCCTTCCCCAGCCTCCCGG + Intronic
1180597745 22:16989862-16989884 CCTGTCCTCCCACAGCCCCCAGG + Intronic
1180914855 22:19479021-19479043 CGGGCCCTACCTCAGGCCCCGGG + Intronic
1181013799 22:20056982-20057004 AGGGGGCTCCCTCACACCCCTGG + Intronic
1181496867 22:23292146-23292168 AGGGGCTTCCCACATCCCCCAGG + Intronic
1182109761 22:27714753-27714775 AGAGTCATCCCTCAGCATCCAGG - Intergenic
1182133102 22:27873158-27873180 ATTGTCCTGCCTCAGCCTCCCGG - Intronic
1182372351 22:29820267-29820289 ATTCTCCTCCCTCAGCCTCCCGG + Intronic
1182385670 22:29938606-29938628 GGGGACTTCCCTCAGCCCACTGG + Intronic
1182418245 22:30235297-30235319 AGGCTCCTCCCTCAGAGCCTTGG - Intergenic
1182508540 22:30802769-30802791 AGGAGGCTCCCTCCGCCCCCTGG - Intronic
1182519508 22:30877448-30877470 AGCGTCCTCCCTGAGCACCAGGG + Intronic
1182592491 22:31392652-31392674 AGTCTCCTGCCTCAGCCTCCTGG + Intergenic
1183343521 22:37294799-37294821 AGGGGCCACTCCCAGCCCCCTGG + Intronic
1183463241 22:37965813-37965835 TGGGTCCTTCCCCAGACCCCCGG - Intronic
1183706650 22:39478561-39478583 AGAGTCCTAGCTCAGTCCCCAGG - Intronic
1183960239 22:41407215-41407237 ATTCTCCTCCCTCAGCCTCCTGG + Intergenic
1184109111 22:42384750-42384772 AGGGTCCTCCCTCAGCTCAGAGG + Exonic
1184492977 22:44820752-44820774 GCCCTCCTCCCTCAGCCCCCGGG + Intronic
1184670674 22:46011013-46011035 GGGCTCCTTCCTCTGCCCCCCGG - Intergenic
1185139419 22:49092110-49092132 AGGGTCCTCCCCCAGACCTGGGG + Intergenic
1185168418 22:49276623-49276645 AGGGTCTTCCTTCAGGTCCCAGG + Intergenic
1185272076 22:49934432-49934454 CTGCTGCTCCCTCAGCCCCCCGG + Intergenic
949361988 3:3242186-3242208 ATTGTCCTGCCTCAGCCTCCTGG + Intergenic
949894959 3:8761982-8762004 AGGGTCCGGCTTCAGCCCCTGGG + Intronic
949895841 3:8767210-8767232 AAGGGCCTCCCCCAGCCACCAGG + Intronic
950174835 3:10865824-10865846 AGGGTCCACCTTCAGCTCCTGGG + Intronic
950496980 3:13339736-13339758 AGGGTGCTGCTTCTGCCCCCTGG - Intronic
951425761 3:22543367-22543389 AGGTTCCTCCCTCAACACCTGGG - Intergenic
951543967 3:23806981-23807003 AGGCCCCTCCCTCGCCCCCCGGG - Intronic
952009656 3:28885982-28886004 ATTCTCCTCCCTCAGCCTCCTGG - Intergenic
952213220 3:31250358-31250380 AGATTCCTCCCTCAGCCCCAGGG - Intergenic
952383744 3:32823966-32823988 ATGCTCCTGCCTCAGCCTCCTGG - Intronic
952848319 3:37707548-37707570 AATGTCATTCCTCAGCCCCCAGG + Intronic
953341529 3:42138643-42138665 ATCCTCCTGCCTCAGCCCCCGGG - Intronic
953405256 3:42656703-42656725 AGGAGCCTCCCTGAGCCACCAGG - Intronic
953630482 3:44611896-44611918 ATGCTCCTGCCTCAGCCTCCTGG + Intronic
954408615 3:50359273-50359295 AGGGCCTTCCCTCAGGTCCCGGG - Exonic
954574868 3:51670495-51670517 AGGCTCCTCCCTCAGTGCCCAGG - Intronic
954793252 3:53148127-53148149 AGGGCCCTCCATCAGCCTACAGG - Intergenic
956284884 3:67597829-67597851 ATTCTCCTCCCTCAGCCTCCGGG - Intronic
956690497 3:71873857-71873879 ATTTTCCTGCCTCAGCCCCCTGG - Intergenic
957550514 3:81697710-81697732 AGGGTCCTGCCTCATACCCTGGG - Intronic
958794506 3:98692602-98692624 ATTCTCCTGCCTCAGCCCCCCGG - Intergenic
959594438 3:108114174-108114196 GGTTTCCTCCCACAGCCCCCGGG - Intergenic
960144444 3:114185780-114185802 ATCTTCCTCCCTCAGCCTCCTGG + Intronic
960703105 3:120456352-120456374 ATGTTCCTGCCTCAGCCTCCTGG + Intergenic
961201866 3:125051914-125051936 AGGCTCCTTCCCCAGCCTCCAGG + Intronic
961357469 3:126348108-126348130 AGGGACCTCCCTCTGCACCCCGG - Intronic
961383942 3:126513887-126513909 AGAGTCCTCCATCAGCCGGCTGG + Intronic
961384128 3:126515211-126515233 AGGGCCCTCCCTGAGCTCCGGGG + Intronic
961403535 3:126663661-126663683 AGGGTGCTGCTTCTGCCCCCTGG + Intergenic
961654228 3:128432770-128432792 TGGGTCCTCCTCCAGGCCCCCGG - Intergenic
962198328 3:133381377-133381399 AAGGTCCTCCCCCAGCTCCTGGG - Intronic
962749671 3:138424600-138424622 AGACTTCTCCCTCAGCCTCCTGG - Intergenic
962932504 3:140051103-140051125 TGGGGCCTCCCTCAGCTCCAAGG + Intronic
963241699 3:143009489-143009511 ATTCTCCTCCCTCAGCCTCCTGG - Intronic
965588311 3:170339479-170339501 ATTCTCCTCCCTCAGCCTCCCGG + Intergenic
966709463 3:182956033-182956055 ATTCTCCTGCCTCAGCCCCCCGG + Intronic
967314574 3:188139417-188139439 ATTCTCCTGCCTCAGCCCCCTGG + Intergenic
967536701 3:190612952-190612974 ATGGTGTTCCCTCAACCCCCTGG - Intronic
968093077 3:195909850-195909872 CGGCTCCTCCCCCAGCCTCCGGG + Intronic
968273452 3:197422528-197422550 AGGGTTCGCCCTCCTCCCCCTGG - Intergenic
968493638 4:903638-903660 ACGCTCCTTCCTCAGTCCCCTGG - Intronic
968908266 4:3464264-3464286 AGGGTGCTCTGGCAGCCCCCTGG - Intronic
969413983 4:7046944-7046966 CGGGTTGTCCCTAAGCCCCCAGG - Intronic
969491471 4:7501525-7501547 ATGGGCCTCCCTCAGCCTCCTGG + Intronic
969635972 4:8369729-8369751 AGGACCCTCCCTCAGTCCTCAGG - Intronic
969701669 4:8771062-8771084 GGGCTCCTCACTCAGCTCCCTGG + Intergenic
970567660 4:17348092-17348114 AGTATCCTGCCTCAGCCTCCCGG - Intergenic
971054731 4:22899298-22899320 AGGTTCCACCTTGAGCCCCCAGG + Intergenic
972852103 4:43063170-43063192 AGTCTCCTGCCTCAGCCTCCTGG + Intergenic
974522642 4:63004295-63004317 ATTCTCCTGCCTCAGCCCCCCGG - Intergenic
974924131 4:68276794-68276816 AGGTTCCTCCCTCAACACCTGGG - Intergenic
975658323 4:76663634-76663656 ATCCTCCTCCCTCAGCCTCCTGG + Intronic
976018815 4:80594395-80594417 AGGGTCCTTCCTCAACACCTGGG + Intronic
976500435 4:85781928-85781950 ATGCTCCTACCTCAGCCTCCCGG - Intronic
977357588 4:95966974-95966996 GGGGACCTCCCCCAGCCCACTGG + Intergenic
978308949 4:107364405-107364427 ATAGTCCTGCCTCAGCCTCCTGG + Intergenic
980810386 4:137870565-137870587 ATTGTCCTGCCTCAGCCTCCTGG + Intergenic
984706082 4:182848184-182848206 AGGTTCCTCCCTGAGCTCCTGGG - Intergenic
985717771 5:1472210-1472232 GGAGTCCTCCCTCCGCCCCTGGG - Intronic
985717786 5:1472261-1472283 AAAGTCCTCCCTCTGCCCCTGGG - Intronic
985745186 5:1642766-1642788 GTGGCCCTCCCACAGCCCCCAGG - Intergenic
985745206 5:1642835-1642857 GTGGCCCTCCCACAGCCCCCAGG - Intergenic
985802436 5:2013514-2013536 TGGGCCCTCCCTAAGCCCCTGGG - Intergenic
986219155 5:5751960-5751982 AGGGCCCTCCCTCATCCACTAGG + Intergenic
986552497 5:8974153-8974175 TGGGTCCAACCTCAGCCCCTAGG + Intergenic
986766965 5:10936868-10936890 ATTCTCCTGCCTCAGCCCCCCGG - Intergenic
991060261 5:62367371-62367393 ATTTTCCTGCCTCAGCCCCCTGG + Intronic
992078569 5:73214022-73214044 AGGTTCCTCCCTGGGCCTCCTGG - Intergenic
992507657 5:77404092-77404114 AGTCTCCTGCCTCAGCCTCCTGG + Intronic
993218566 5:85059524-85059546 AGTCTCCTGCCTCAGCCTCCTGG + Intergenic
993679581 5:90859537-90859559 AGTCTCCTGCCTCAGCCTCCTGG + Intronic
994539816 5:101080068-101080090 ATTGTCCTGCCTCAGCCTCCCGG + Intergenic
995651948 5:114379196-114379218 AGGGTCTTCCCTGGGGCCCCAGG - Intronic
996738234 5:126776808-126776830 AGGGCCCTCCCGCCGCCCCGCGG - Intronic
997574508 5:134963924-134963946 ATTCTCCTGCCTCAGCCCCCCGG + Intronic
997630013 5:135360302-135360324 AGGGTCCTCCCTCAGCATTGTGG + Intronic
998813099 5:145986174-145986196 AGGGGCCACCTCCAGCCCCCAGG + Intronic
1000032382 5:157414550-157414572 ATTCTCCTGCCTCAGCCCCCTGG - Intronic
1000259198 5:159569772-159569794 AAGGGCTTCCCCCAGCCCCCAGG + Intergenic
1000328269 5:160188387-160188409 AGAGTCCGCCCTCAGCCAGCCGG - Intronic
1000514923 5:162227687-162227709 AGGTTCCTCCCTCAACACCTGGG + Intergenic
1001121027 5:168979990-168980012 AGGGGCTTCCCTCAGCTCCTGGG + Intronic
1001392814 5:171394146-171394168 ATTGTCCTGCCTCAGCCTCCCGG + Intronic
1001467658 5:171982857-171982879 AGGGTCCTGCCTTATACCCCAGG + Intronic
1001660892 5:173392230-173392252 AGGGTCCCTCCTCAGCCCTAGGG - Intergenic
1002204520 5:177553828-177553850 AGCCTCTTCCCTCTGCCCCCGGG - Intronic
1003883584 6:10500283-10500305 ATTCTCCTCCCTCAGCCCCCTGG - Intronic
1004898547 6:20172320-20172342 AGTCTCATCCCTCAGCCTCCTGG - Intronic
1006085203 6:31590126-31590148 TGGGTCTTCCTTCTGCCCCCAGG - Exonic
1006183820 6:32169271-32169293 AGGGTTCACCCACCGCCCCCAGG + Exonic
1006623404 6:35383157-35383179 TGGGTCCTCCCTCACCACTCAGG - Intronic
1006886185 6:37384245-37384267 ATTCTCCTCCCTCAGCCTCCTGG + Intronic
1006962210 6:37944737-37944759 AGGGACCTCCCCCAGCCCACTGG - Intronic
1007818465 6:44541886-44541908 AGGGTCCTCCCTCTCTCCCTGGG - Intergenic
1007865697 6:44967894-44967916 AGCCTCCTGCCTCAGCCTCCTGG + Intronic
1008054409 6:46931418-46931440 AGGGAGCTCCCTCAGTCTCCAGG + Intronic
1009862380 6:69351198-69351220 ATTCTCCTCCCTCAGCCCCCAGG + Intronic
1011472525 6:87722112-87722134 ATTGTCCTGCCTCAGCCTCCTGG + Intergenic
1013188468 6:107782409-107782431 AGGGGGCACACTCAGCCCCCCGG - Intronic
1013488246 6:110618598-110618620 GGGGACCTCCCTCAGCCCACTGG + Intronic
1013889305 6:115007088-115007110 GTGTTCCTCCCTCAGCCTCCTGG + Intergenic
1013997882 6:116329928-116329950 ATTGTCCTGCCTCAGCCTCCCGG + Intronic
1014835536 6:126156389-126156411 AGGCTTCTGCCTCAGCTCCCAGG + Intergenic
1015604840 6:134943903-134943925 CTGGTCATCCCGCAGCCCCCAGG - Exonic
1016965801 6:149717881-149717903 AGCGTCCGCCCTCAGGCCCGTGG - Exonic
1017030995 6:150221903-150221925 ATCCTCCTGCCTCAGCCCCCCGG + Intronic
1017126472 6:151069300-151069322 AGGGACCTCCCTAATCCTCCAGG + Intronic
1017653119 6:156601261-156601283 AGGGTCCACACCCAGCCCTCTGG + Intergenic
1017777235 6:157689705-157689727 AGGGACCCCCCACGGCCCCCAGG - Intergenic
1017811284 6:157985693-157985715 AAGGTTCTCCAACAGCCCCCAGG + Intronic
1018392785 6:163353106-163353128 AGGGCCCTTCCTCCGCCACCTGG - Intergenic
1018610558 6:165644160-165644182 ATTGTCCTGCCTCAGCCTCCTGG + Intronic
1019145983 6:169975878-169975900 AGGGTGCACACTCCGCCCCCAGG + Intergenic
1019146009 6:169976001-169976023 AGGGTACACACTCTGCCCCCGGG + Intergenic
1019288048 7:233537-233559 CGGCTCCTCCCTGAGCCTCCCGG - Intronic
1019368146 7:645806-645828 GGGGTGCTCCCTGAGCCCCAGGG + Intronic
1019700101 7:2470680-2470702 CAGGTCCTACCCCAGCCCCCAGG - Intergenic
1020411455 7:7896220-7896242 ATTTTCCTGCCTCAGCCCCCAGG - Intronic
1021062545 7:16131687-16131709 ATCCTCCTGCCTCAGCCCCCAGG + Intronic
1021132172 7:16924512-16924534 ACTATCCTGCCTCAGCCCCCTGG + Intergenic
1022271557 7:28812693-28812715 AGTGTCCTGCATCAGGCCCCGGG + Intronic
1023830478 7:44036416-44036438 AGGCCCCTCCCACAGCACCCAGG + Intergenic
1023830508 7:44036516-44036538 AGGGCACTCCCACAGCACCCAGG + Intergenic
1024011745 7:45272717-45272739 AGGTTCCTCCCTCAACACCTGGG - Intergenic
1025055859 7:55764341-55764363 ATTTTCCTCCCTCAGCCTCCTGG - Intergenic
1026306983 7:69150861-69150883 AGGGTCTTACTCCAGCCCCCAGG - Intergenic
1026621529 7:71953849-71953871 AGCTGCCTCCCTCACCCCCCAGG - Intronic
1026939503 7:74279146-74279168 AGTCTCCTGCCTCAGCCTCCGGG + Intergenic
1027142630 7:75669906-75669928 AGTCTCCTGCCTCAGCCTCCTGG + Intronic
1027787254 7:82595884-82595906 AGGTTCCTCCCTCAACTCCTGGG - Intergenic
1028344618 7:89764040-89764062 ATTCTCCTGCCTCAGCCCCCGGG + Intergenic
1028510782 7:91624098-91624120 GCGATCCTCCCTCAGCCTCCTGG + Intergenic
1029519148 7:101049145-101049167 AGGGGCCTCCTGCAGCCCCCAGG - Intronic
1029740830 7:102490810-102490832 AGGGCACTCCCACAGCACCCAGG + Intronic
1029758794 7:102589883-102589905 AGGCCCCTCCCACAGCACCCAGG + Intronic
1029758824 7:102589983-102590005 AGGGCACTCCCACAGCACCCAGG + Intronic
1031836359 7:126685475-126685497 AGGGGCCTTCCTGGGCCCCCAGG - Intronic
1032621544 7:133538722-133538744 ATTCTCCTCCCTCAGCCTCCCGG - Intronic
1033243860 7:139702525-139702547 AAGGTCTCCCCCCAGCCCCCAGG - Intronic
1033265013 7:139877527-139877549 ATGCTCCTGCCTCAGCCTCCTGG + Intronic
1033360250 7:140634103-140634125 ATTGTCCTGCCTCAGCCTCCCGG + Intronic
1034419160 7:150979937-150979959 AGTTTCCTCACTCACCCCCCCGG + Intergenic
1034936186 7:155202525-155202547 AGGGTCATCCCTCTCCCTCCAGG - Intergenic
1034982526 7:155488131-155488153 AGGGTCCTCCTGCAGCCCCCAGG - Intronic
1035275305 7:157744863-157744885 CGGGGCTTCCCTCAGCCCCTGGG + Intronic
1035708406 8:1695101-1695123 ATGTTCCTCCTTCATCCCCCAGG + Intronic
1037290369 8:17343321-17343343 ATTCTCCTGCCTCAGCCCCCTGG - Intronic
1037654160 8:20868574-20868596 AGGGGCCCTCCTCAGCCCCATGG + Intergenic
1037752650 8:21692780-21692802 AGGGTCCACCTTCAGCCCTTTGG - Exonic
1037910993 8:22743487-22743509 AGGCTCCTGGCTCAGCCCCCAGG - Intronic
1038331533 8:26613322-26613344 AGGGTCCTCTCCCAGCAGCCTGG + Intronic
1038766632 8:30434595-30434617 ACTGTCCTGCCTCAGCCTCCTGG - Intronic
1038848967 8:31255576-31255598 AGGGTCCTTCCTCATACCCCAGG - Intergenic
1039156531 8:34564670-34564692 AGGGCCCTCCCTAACCCCTCTGG + Intergenic
1039336074 8:36590787-36590809 ATCCTCCTGCCTCAGCCCCCAGG - Intergenic
1039489387 8:37936251-37936273 ATCCTCCTGCCTCAGCCCCCCGG + Intronic
1041348191 8:56923183-56923205 AGGGTCCACCCTGATCACCCAGG - Intergenic
1041884909 8:62797525-62797547 AGTGACCTCCCTCAGCTCGCAGG + Intronic
1042216374 8:66432611-66432633 AGGGTGCCCACGCAGCCCCCTGG + Intronic
1042340687 8:67675624-67675646 AGGGTACTGCCTCAACCCACTGG + Intronic
1042547142 8:69960975-69960997 ATTCTCCTGCCTCAGCCCCCTGG + Intergenic
1042737548 8:72005494-72005516 AGGGACCTCCCTCAACCCTGTGG + Intronic
1044300802 8:90580819-90580841 GGGGGCCTCCCGCAGCCCACCGG + Intergenic
1045231726 8:100312479-100312501 ATCCTCCTGCCTCAGCCCCCTGG - Intronic
1045588501 8:103565751-103565773 AGAGGCCTCCCTAAGCCCACTGG - Intronic
1045808219 8:106190710-106190732 ATTGTCCTGCCTCAGCCTCCAGG - Intergenic
1046431534 8:114134821-114134843 AGGGTCCTGGGTCAGCCTCCAGG + Intergenic
1046587269 8:116162756-116162778 AGGGATCTCCCTCACCCCTCCGG + Intergenic
1046955853 8:120062438-120062460 ATTGTCCTGCCTCAGCCTCCTGG + Intronic
1047414351 8:124651874-124651896 TGGGTCCTCTCCCAGACCCCAGG + Intronic
1047460568 8:125060377-125060399 ATTGTCCTGCCTCAGCCTCCTGG - Intronic
1048771227 8:137897788-137897810 AGTCTCCTGCCTCAGCCTCCCGG + Intergenic
1048835535 8:138515388-138515410 AGGTTCCTCCCTCAACACCTGGG + Intergenic
1049228106 8:141467336-141467358 TGGGCCCGCCCTCCGCCCCCTGG + Intergenic
1049540798 8:143207951-143207973 TGGGGCCTCCCTCTGCCCGCAGG - Intergenic
1049826426 8:144671718-144671740 AGGGTTCTCCCTACGACCCCAGG + Intergenic
1053288422 9:36864640-36864662 AGCCTCCCCCCTCAGCCCACCGG + Intronic
1053647263 9:40130805-40130827 GGAGACCTCCCTCAGGCCCCAGG - Intergenic
1054460731 9:65461021-65461043 AGCTTCCTCCCTCACCCCCACGG + Intergenic
1054812934 9:69449094-69449116 TTTGTCCTCCCTCAGACCCCGGG - Intronic
1054868007 9:70022945-70022967 AGTCTCCTGCCTCAGCCTCCTGG + Intergenic
1055052463 9:71994187-71994209 ATTCTCCTGCCTCAGCCCCCCGG - Intergenic
1055087638 9:72330230-72330252 ATTCTCCTGCCTCAGCCCCCTGG - Intergenic
1056114609 9:83429814-83429836 AGGGATCTCATTCAGCCCCCTGG + Intronic
1056458237 9:86784191-86784213 AGGTTCCTCCCTCAACACCCAGG - Intergenic
1056626045 9:88254166-88254188 GGGGACCTCCCCCAGCCCACTGG + Intergenic
1057013471 9:91629832-91629854 AGTGCCCTCCCCCAACCCCCAGG + Intronic
1057229124 9:93308326-93308348 AGGGTCCTCCACCAGCAGCCTGG + Exonic
1058708648 9:107659288-107659310 AGTCTCCTGCCTCAGCCTCCTGG + Intergenic
1059338571 9:113584178-113584200 AGAGGCCACCCTCAGCCCCCTGG - Exonic
1060410633 9:123397873-123397895 AGGGTCCAAACTCAGCCACCAGG - Intronic
1060473295 9:123966589-123966611 ATGCTCCTGCCTCAGCCCTCCGG + Intergenic
1060826025 9:126688582-126688604 AGGCTCCTTCCTCAGCCCCTCGG + Intronic
1061221076 9:129252518-129252540 ATTCTCCTGCCTCAGCCCCCCGG - Intergenic
1061261778 9:129484117-129484139 TGGGTGCTCCCTCAGATCCCAGG - Intergenic
1061328966 9:129880401-129880423 AGGGCCCTCCCACATCCTCCAGG - Exonic
1061546848 9:131309462-131309484 CTGGTACTCCCTCAGCCCCCAGG + Intergenic
1062466950 9:136685764-136685786 AGGGGCCCCCCTCAGCCCCTGGG - Intronic
1062480638 9:136749266-136749288 AGGGTCCTCCCCCAGTGCCGTGG + Intergenic
1062644187 9:137538352-137538374 AGGGTGCTCACTCTGCTCCCCGG - Intronic
1185595541 X:1304473-1304495 AGAATCTTCCCTCAGCCCCTCGG + Intronic
1185879115 X:3724807-3724829 ATTCTCCTGCCTCAGCCCCCCGG - Intergenic
1186397254 X:9222557-9222579 AGTGTCCTTTCACAGCCCCCTGG - Intergenic
1189803803 X:44716035-44716057 ATTGTCCTGCCTCAGCCTCCCGG + Intergenic
1190279297 X:48918793-48918815 AGGGGCCTCCCGCGCCCCCCGGG - Exonic
1190872441 X:54435579-54435601 AGAGGCCTGCCACAGCCCCCAGG + Intergenic
1191903093 X:66058510-66058532 AGTCTCCTGCCTCAGCCTCCTGG - Intergenic
1193141733 X:78034848-78034870 ATTCTCCTGCCTCAGCCCCCAGG + Intronic
1194068101 X:89286718-89286740 AGGGTCCTCCCTCAACATCTGGG - Intergenic
1194290422 X:92064972-92064994 TGGGTCCACCCTCAGCCTCCTGG - Intronic
1194524256 X:94958197-94958219 ATTCTCCTGCCTCAGCCCCCAGG - Intergenic
1195275387 X:103276087-103276109 AGGGTCCGCCCTCAGCAGCCTGG + Intronic
1196082866 X:111651419-111651441 AGTCTCCTGCCTCAGCCTCCCGG + Intergenic
1196566275 X:117208590-117208612 AGTCTCCTGCCTCAGCCTCCCGG - Intergenic
1197267933 X:124396221-124396243 AGGTTCCTCCCTGAGTCTCCTGG + Intronic
1197753847 X:129981971-129981993 GGGAGCCTCCCTCAGGCCCCTGG + Intronic
1198326326 X:135577359-135577381 AGGGACCACCCTCAGCCTCGTGG + Exonic
1199255969 X:145719259-145719281 AGGTTCCTTCCTCAGGCCACTGG - Intergenic
1200124783 X:153808123-153808145 AGGGTCCTCCCTCGGCCCTGGGG + Intronic
1200208756 X:154336094-154336116 ATTCTCCTGCCTCAGCCCCCTGG - Intergenic
1200831081 Y:7689378-7689400 AGCCTCCTCGCTCAGCGCCCCGG + Intergenic
1201010764 Y:9547071-9547093 TGGGTGCTCCCACAGCCCCCGGG + Intergenic
1201329494 Y:12802853-12802875 ATTCTCCTCCCTCAGCCTCCCGG + Intronic
1201557225 Y:15275532-15275554 ATTGTCCTTCCTCAGCCTCCTGG + Intergenic
1202352352 Y:24007670-24007692 ATTCTCCTGCCTCAGCCCCCTGG - Intergenic
1202518428 Y:25662445-25662467 ATTCTCCTGCCTCAGCCCCCTGG + Intergenic