ID: 1147918272

View in Genome Browser
Species Human (GRCh38)
Location 17:43901205-43901227
Sequence TTGGTCAGCCACTGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147918262_1147918272 -10 Left 1147918262 17:43901192-43901214 CCCCTACCCACCCTTGGTCAGCC 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG 0: 1
1: 0
2: 1
3: 24
4: 227
1147918260_1147918272 -6 Left 1147918260 17:43901188-43901210 CCTCCCCCTACCCACCCTTGGTC 0: 1
1: 0
2: 1
3: 47
4: 493
Right 1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG 0: 1
1: 0
2: 1
3: 24
4: 227
1147918261_1147918272 -9 Left 1147918261 17:43901191-43901213 CCCCCTACCCACCCTTGGTCAGC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG 0: 1
1: 0
2: 1
3: 24
4: 227
1147918257_1147918272 10 Left 1147918257 17:43901172-43901194 CCTCAAGCCTCAGACGCCTCCCC 0: 1
1: 0
2: 2
3: 34
4: 322
Right 1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG 0: 1
1: 0
2: 1
3: 24
4: 227
1147918258_1147918272 3 Left 1147918258 17:43901179-43901201 CCTCAGACGCCTCCCCCTACCCA 0: 1
1: 0
2: 1
3: 37
4: 401
Right 1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG 0: 1
1: 0
2: 1
3: 24
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147918272 Original CRISPR TTGGTCAGCCACTGGGAGGC AGG Intronic
900641550 1:3690168-3690190 TTGGGCAGGCAGTGGAAGGCAGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901648094 1:10727412-10727434 TTTGTGAGCTTCTGGGAGGCTGG - Intronic
901991529 1:13118331-13118353 TTGGTCAGCTACTGTGCAGCAGG + Intergenic
903350375 1:22713104-22713126 TTGGACTGCCACTTGGGGGCAGG + Intronic
903438227 1:23368454-23368476 TTGGCCAGGCTGTGGGAGGCGGG - Intronic
903711424 1:25327771-25327793 TAGTTCACCCACTGGCAGGCTGG + Intronic
903715524 1:25363658-25363680 TAGTTCACCCACTGGCAGGCTGG - Intronic
903913103 1:26743102-26743124 TGGGTAAGGCACTGGGAGCCAGG - Intronic
905307306 1:37028577-37028599 TTGGTCCTCCTCTGGGAGGATGG - Intronic
905825256 1:41021816-41021838 TTGGCCAGCCACAGGCAGGCTGG + Exonic
907761317 1:57363689-57363711 TTGTACAGTCACTGGAAGGCAGG + Intronic
912305375 1:108560994-108561016 TTGGCCACCCACTCTGAGGCTGG + Intronic
915105555 1:153533329-153533351 GTTGTCAGCCACTGGAAGGCAGG + Intergenic
915317846 1:155039579-155039601 TGGGTCATCCAATGGGAGCCAGG + Intronic
920244129 1:204575385-204575407 TGGGTCAGGCACAGGGAGGCAGG + Intergenic
921287316 1:213620920-213620942 TGAGTTAGCCAATGGGAGGCTGG - Intergenic
921587530 1:216965616-216965638 CTAGTCAGCCACTGGGAGGATGG - Intronic
922734528 1:227972092-227972114 CTGTTCAGGCACTGGGAGGCGGG + Intergenic
923388012 1:233484883-233484905 ATGGTCAGCCACTGGTGTGCTGG + Intergenic
924772673 1:247090285-247090307 TATGTCAGCCACTGGGGGACAGG + Intergenic
1065104835 10:22372473-22372495 TGGCTCAGCCACTGGGAGGTGGG + Intronic
1069895968 10:71680241-71680263 CTGGACAGCCAAAGGGAGGCAGG - Intronic
1069973126 10:72190397-72190419 TTGGTGATCCACTGGGTGTCAGG - Intronic
1070314392 10:75296241-75296263 TTGTCCAGCCCCTGGGAGGATGG + Intergenic
1070398850 10:76035379-76035401 TGGGGCAGCCACTGGGACGCTGG + Intronic
1070751025 10:78963997-78964019 ATGGCCAGGCCCTGGGAGGCAGG - Intergenic
1072337741 10:94414560-94414582 TTGAGAAGCCACTGGGAGACAGG - Intronic
1072783917 10:98267963-98267985 TTGGTGAGCGACTGGAGGGCCGG + Intronic
1073030900 10:100524837-100524859 TTGGTCTGCCTCTAGGTGGCAGG - Intronic
1073180286 10:101579254-101579276 CTGGGCAGACACTGGGAGCCGGG + Exonic
1074079547 10:110156818-110156840 TGGGGCAGCCACTGGGTGGAGGG + Intergenic
1074599705 10:114901165-114901187 TTGGTGATCCACTGGGTGTCAGG - Intergenic
1075049224 10:119170276-119170298 TGGGTCAGGCACTGGGAGCCTGG + Intronic
1075806261 10:125191137-125191159 TTGGCCAGACATTGGGAGGGCGG + Intergenic
1075987880 10:126803701-126803723 TTGGTTAGGGACTGGGAGGGAGG - Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1078098359 11:8313896-8313918 TGAGGCAGCCACTGGGAGCCAGG + Intergenic
1078528241 11:12117041-12117063 CAGGACAGCCACTGGGAGGTGGG - Intronic
1079812161 11:25008575-25008597 TTGCTCAGCAAGTGGGAGGGAGG + Intronic
1080808948 11:35683027-35683049 TTGTTCAGCCAATGAGAAGCAGG + Intronic
1082188367 11:49211239-49211261 ATGGTCAACAACTGTGAGGCTGG - Intergenic
1083291877 11:61695093-61695115 TTTGCCAGCAACTGAGAGGCAGG + Intronic
1083619662 11:64042563-64042585 TTGGCTAGCCAATGGGGGGCTGG + Intronic
1083772705 11:64877503-64877525 TGGGGCAGCCCCTTGGAGGCAGG - Intronic
1084157190 11:67320358-67320380 ATGGTGAGCTTCTGGGAGGCAGG + Intronic
1084462277 11:69302627-69302649 TAGGGCAGCCGCTGGGAGCCTGG + Intronic
1086220666 11:84438785-84438807 TTTGTGTGCCACTGGAAGGCAGG - Intronic
1087043952 11:93829131-93829153 TTGGTCAGTCACCCTGAGGCAGG - Intronic
1088497567 11:110446774-110446796 CTGGCCAGCCACTGGGCGCCTGG + Intronic
1090229626 11:125092344-125092366 TTAGAAATCCACTGGGAGGCTGG + Intergenic
1090321101 11:125844505-125844527 TTGGGCAGGCACTGAGATGCAGG + Intergenic
1090915523 11:131159311-131159333 AGGGTCAGCCACTGGGAGAAAGG - Intergenic
1091689524 12:2586066-2586088 TCAGTCAGCATCTGGGAGGCAGG + Intronic
1092077396 12:5685188-5685210 TTGCTCAGCCACTTGGAGAAGGG + Intronic
1092437400 12:8461053-8461075 TTGGTGATCCACTGGGTGTCAGG - Intronic
1092510169 12:9146874-9146896 TTGGTCAGCCACAGAGAAGTTGG + Intergenic
1093849614 12:24019634-24019656 TTAGTCAGACACTTGGAGGTAGG + Intergenic
1099993592 12:89752998-89753020 TTGTTCATCACCTGGGAGGCAGG - Intergenic
1100240614 12:92707158-92707180 TGGTTCAGCAACTGAGAGGCCGG - Intronic
1101147422 12:101854355-101854377 ATGCTCAGCCACTGGGACACTGG + Intergenic
1101465157 12:104940901-104940923 TTGCTCTGTCACTCGGAGGCAGG - Intronic
1106304036 13:28494821-28494843 ATGGTCAGCTACTGGGACACCGG - Exonic
1107760913 13:43677283-43677305 ATGGACTGCCAATGGGAGGCAGG + Intronic
1110436481 13:75482157-75482179 TGGGGCAGACACTGGGTGGCTGG + Intergenic
1111473926 13:88722879-88722901 GTGGTCTGTCACTGGTAGGCAGG - Intergenic
1112370319 13:98788031-98788053 TTGGTCAACCACTGGAAGAATGG - Intergenic
1112505451 13:99971970-99971992 TTGGGCATCCCCGGGGAGGCGGG - Intergenic
1113535314 13:111061941-111061963 TAGGGCAGCCACTTGCAGGCTGG - Intergenic
1115463232 14:33685168-33685190 ATGGTCAGCTCCTGGGAGGTGGG - Intronic
1117636464 14:57749650-57749672 TTGGGCAGCTTCTGAGAGGCTGG - Intronic
1121320941 14:92991286-92991308 ATGGACAGCCACTGGGGGTCAGG + Intronic
1121551060 14:94801005-94801027 TTGGTGATCCACTGGGTGTCAGG + Intergenic
1121800923 14:96773593-96773615 TTTGTCAGCCTCTGGAAGGGAGG + Intergenic
1122437645 14:101710806-101710828 TGGGTGAGCCATTGAGAGGCAGG - Intergenic
1124048606 15:26174697-26174719 TTGGTCAGGGAATGGGAGGAGGG + Intergenic
1124400629 15:29344780-29344802 TCTGTCAGCCCCTGGGAGTCAGG - Intronic
1125390307 15:39185277-39185299 TTTGACAGCCACTGGGTGCCTGG + Intergenic
1126485666 15:49177757-49177779 TTGGTGATCCACTGGGTGGCAGG + Intronic
1126568843 15:50128430-50128452 TTCATCAGCCACAAGGAGGCAGG - Intronic
1130387317 15:83423194-83423216 TGGATCTGCCACTGTGAGGCTGG + Intergenic
1130940012 15:88499382-88499404 TTGCTAAACCCCTGGGAGGCTGG + Intergenic
1131112931 15:89776697-89776719 TTGGTCAGGCTCTGGCCGGCCGG - Exonic
1133287535 16:4697586-4697608 TTGCTCAGCCTGTGGGAGGAAGG - Intronic
1134653875 16:15931854-15931876 TTGGTGATCCACTGGGTGTCAGG + Intergenic
1136293615 16:29289999-29290021 TGGGCCTGCCACAGGGAGGCTGG - Intergenic
1136578667 16:31139248-31139270 GTGGGGAGCCACTGGGGGGCAGG + Exonic
1137793350 16:51194041-51194063 ATGCCCAGCCTCTGGGAGGCAGG + Intergenic
1138589607 16:57992551-57992573 TGGCTCAACCACTGGGAGGATGG - Intergenic
1140574330 16:76147940-76147962 GTGGGCAGCCTCTGGGAAGCGGG + Intergenic
1141661372 16:85443359-85443381 GAGGTCAGCCAGTGGGAGCCAGG - Intergenic
1141920740 16:87133824-87133846 TTGGGCAGCCACCAGGAGCCAGG - Intronic
1142099497 16:88264005-88264027 TGGGCCTGCCACAGGGAGGCTGG - Intergenic
1144425030 17:15133591-15133613 TTGCTCATCCACTGTGAGGCGGG - Intergenic
1144764793 17:17726389-17726411 TGGGTGAGGCTCTGGGAGGCAGG + Intronic
1145809169 17:27754555-27754577 TGGGTCAGCCAGTGGCAGCCAGG - Intergenic
1146442907 17:32912739-32912761 TGTGGCAGCCACTGGGAAGCAGG - Intergenic
1147401284 17:40181420-40181442 CTGGGCAGCCACTGCGAGGGTGG - Intronic
1147790771 17:43013255-43013277 CTGCTCAGCCACTGGGTGGTGGG - Exonic
1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG + Intronic
1148125205 17:45233164-45233186 TTGGTGGGCCTGTGGGAGGCCGG + Intronic
1151481776 17:74373810-74373832 TTCCTCCACCACTGGGAGGCGGG + Intergenic
1152389524 17:79994331-79994353 TTGGGCAGCCTCTAGGAGGAGGG - Intronic
1153105854 18:1525285-1525307 TGGGTCAGGCACTGGAAGCCAGG + Intergenic
1153457942 18:5298908-5298930 TTTATAAGCCACTGGGAGGTTGG + Intergenic
1153909555 18:9695124-9695146 TTGGTCAGCCACAAGGTGCCAGG + Intergenic
1154394341 18:13973231-13973253 GTTGGCAGCCACTGGGAGGCAGG + Intergenic
1154946269 18:21164854-21164876 TTGGTCACCAACTCGGAGGTAGG + Intergenic
1156084530 18:33382752-33382774 TTGGGCAGGCACTGGGCTGCAGG + Intronic
1157134749 18:45042817-45042839 TTTGTGAGCTACTGGGAGGGAGG + Intronic
1157444431 18:47734183-47734205 TTGGTTAGCCACAGGTAGACAGG + Intergenic
1157711789 18:49854917-49854939 TTGAGGAGCCACTGGGAGTCAGG - Intronic
1160092588 18:75841002-75841024 TTGGCCAGCTACTTGGTGGCAGG + Intergenic
1160183861 18:76659761-76659783 TTGCTCAGTCGCAGGGAGGCTGG + Intergenic
1160830715 19:1103879-1103901 GACGTCAGCCAATGGGAGGCCGG - Intergenic
1161212350 19:3074015-3074037 TTGGGCAGCCAAGGGGGGGCGGG - Intergenic
1163406890 19:17128463-17128485 TGGGGCAGCCACTGGGAGCTGGG - Intronic
1164048803 19:21566493-21566515 CTGGTCAGCCAATCAGAGGCTGG - Intergenic
1164886214 19:31780662-31780684 TTGCCCAGCCACTGAAAGGCAGG + Intergenic
1165117127 19:33535253-33535275 GTGGGCAGCCTTTGGGAGGCAGG - Intergenic
1165615014 19:37192091-37192113 TTGATCAGCCACTGTGTGGCAGG - Intronic
1165735278 19:38171922-38171944 TAGGGCAGCCAATGGGAGGTTGG + Intronic
926303652 2:11621605-11621627 TTTATGAGCCACTGGGAGGAGGG - Intronic
927163409 2:20292214-20292236 GGGGCCAGCCACAGGGAGGCGGG - Intronic
927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG + Intronic
930283920 2:49404309-49404331 TTGCTCAGTAAGTGGGAGGCAGG + Intergenic
930313725 2:49772401-49772423 TTGGCCAGACTTTGGGAGGCGGG - Intergenic
930369559 2:50485918-50485940 TTGGTCAGTCACTGGCAGTAGGG - Intronic
932338136 2:70942729-70942751 TGGGTCAGCCACAGGCTGGCAGG - Intronic
932376629 2:71241786-71241808 GTAGTCAGCCACAGTGAGGCAGG + Intergenic
933121313 2:78541791-78541813 TTGTTTAGCAGCTGGGAGGCGGG + Intergenic
933645500 2:84809798-84809820 TTTGCCAGCCAGTGGGAAGCAGG + Intronic
934535498 2:95129877-95129899 TTGGTCAGCAAGTAGGAGTCTGG + Intronic
935489449 2:103698611-103698633 TTGGGCAGGCACTGGGCTGCAGG - Intergenic
936277921 2:111116933-111116955 TCTGGCAGCCACTGGAAGGCAGG - Intronic
937307014 2:120878220-120878242 TTGCTCTGCCCCTGGGAGGGAGG - Intronic
937531320 2:122830609-122830631 TAGGTCAGCTACTTGGTGGCAGG + Intergenic
937854167 2:126660634-126660656 TTGCTGAGCCACTTTGAGGCAGG + Intronic
938776422 2:134545250-134545272 TCTGTCACCCACTGTGAGGCTGG + Intronic
939134672 2:138279037-138279059 TTGGTGATCCACTGGGTGTCAGG - Intergenic
944311509 2:198238847-198238869 TTGGTGAGCAACTGGAGGGCTGG + Intronic
948775761 2:240288071-240288093 ATGGTCAGCCACTCAGAGCCTGG + Intergenic
1169511675 20:6271024-6271046 TTGTTGAGCCAGTGGGAAGCTGG + Intergenic
1170634132 20:18090272-18090294 TTGGTGATCCACTGGGTGTCAGG + Intergenic
1171347619 20:24477996-24478018 ATGCTCAGCCACTGGCAGGGTGG - Intronic
1171517313 20:25747716-25747738 CTGGGCAGGCACTGGGAGGGAGG + Intergenic
1171994681 20:31722721-31722743 TTTGCCAGCCACCGCGAGGCCGG - Exonic
1172004831 20:31811929-31811951 CTTCTCAGACACTGGGAGGCAGG + Intergenic
1172882204 20:38209304-38209326 TTTGTCAGCCACTTTGAGGTAGG - Intergenic
1173210273 20:41026967-41026989 TTGGTCAGCCAGTGGAAGCAGGG + Intergenic
1174640086 20:52036254-52036276 AAGGTGAGCCACTGGCAGGCAGG + Intergenic
1174869945 20:54173259-54173281 TTGGAGCGCCACTGGGAGGGCGG + Intronic
1175081090 20:56420817-56420839 ATTGCCAGCCACTGGGAGTCAGG + Intronic
1175538848 20:59735684-59735706 TTGGGCAGCCCCTGGGTGCCAGG + Intronic
1175862813 20:62159286-62159308 TTGGACAGCCGCTTGGAGGGTGG - Intronic
1175914166 20:62418099-62418121 CTGGTCAGACACTGGCGGGCGGG - Intronic
1176307792 21:5133253-5133275 CTGGTCAACCACGGGGTGGCCGG + Intronic
1178114567 21:29404351-29404373 CTGTTCAGCCACTGTGAGGGAGG + Intronic
1179053496 21:37910175-37910197 TTTGTAAGCCACTGAGATGCTGG + Intronic
1179271366 21:39853536-39853558 TAGGTCAGCACCTGCGAGGCAGG - Intergenic
1179388995 21:40970227-40970249 TTGGTCAGCAACTGGCATCCAGG + Intergenic
1179476732 21:41651336-41651358 CTGGCCATCCACTGGGAGGGGGG - Intergenic
1179623200 21:42632384-42632406 TGGGGCAGCCACCGGGACGCAGG - Intergenic
1180174334 21:46080385-46080407 CTGGTCATCTGCTGGGAGGCTGG - Intergenic
1180611016 22:17097981-17098003 TGGGAGAGCCACTTGGAGGCAGG - Intronic
1181016247 22:20070525-20070547 TGGCCCAGCCACAGGGAGGCTGG + Intergenic
1181509729 22:23383789-23383811 TTGGCCAGCAAGTGGGGGGCAGG - Intergenic
1182622349 22:31625105-31625127 TTGCTCAGCAACTGGGAGAGAGG - Intronic
1183089179 22:35509687-35509709 TGGGACAGCCACTGCGAGGGAGG - Intergenic
1184022551 22:41830609-41830631 TTGTTCACACACAGGGAGGCTGG - Intergenic
1185190646 22:49433814-49433836 TTGGTCAGCCACCGTGGGGGAGG + Intronic
951555795 3:23919322-23919344 TTGGTGATCCACTGGGTGTCAGG - Exonic
953630413 3:44611047-44611069 TTGGTCAGCATCTGGGAACCTGG + Intronic
954371582 3:50171868-50171890 TTGGCCAACCGCTGGGACGCAGG - Intronic
954386330 3:50246045-50246067 CGGGTCCGGCACTGGGAGGCAGG - Intronic
954662212 3:52232186-52232208 CTGGGCAGCCACGGCGAGGCTGG - Intronic
955067758 3:55547298-55547320 TAGTTCAGCCTCTGGGAGGCAGG + Intronic
960885562 3:122390593-122390615 GTGGTCAGCCAGGGTGAGGCTGG - Intronic
962270592 3:133975287-133975309 TGTGTGAGCCACTGGGAGGATGG - Intronic
964319401 3:155479369-155479391 CTGGACAGGCACTGGGAGTCTGG - Intronic
964339095 3:155689090-155689112 TTGCTGAGCCACTGGGGAGCTGG - Intronic
966508731 3:180736548-180736570 ATGGTGACCTACTGGGAGGCGGG - Intronic
967852983 3:194095951-194095973 TTGCTCTGCCACAGGCAGGCTGG - Intergenic
968532177 4:1098217-1098239 TTGGGGAGCCACTGGTAGGTAGG - Intronic
968568095 4:1325651-1325673 TCAGGCAGCCCCTGGGAGGCAGG + Intronic
970223038 4:13830145-13830167 TTGGTCTGCCTCTGGGAGTGAGG + Intergenic
975439272 4:74392302-74392324 TTTGTCAGCAACTGTGAGTCAGG - Intergenic
977524396 4:98126274-98126296 TTGGGCAGGCACTGAGATGCAGG - Intronic
985045037 4:185932123-185932145 TTGGTAAACCACTTGGAGGAAGG + Intronic
985551919 5:538092-538114 TTGGTGGGCCAGTGGGAGGCTGG + Intergenic
989952851 5:50321069-50321091 TTGGTAAGCCATTGTGAGCCTGG - Intergenic
993500505 5:88661022-88661044 TTGGCGCGCGACTGGGAGGCCGG - Intergenic
997516536 5:134493818-134493840 TTACCCAGCCACTGGGAGGCTGG + Intergenic
998031743 5:138876280-138876302 TAAGTCAGCCACTTGGTGGCTGG - Intronic
998623402 5:143819229-143819251 TTGGTTTGCCACTGGTAGGGAGG + Intronic
998752698 5:145340384-145340406 TTCTTCAGCCACTGGGCAGCTGG - Intergenic
1000197736 5:158976001-158976023 TTGGACAGGCTCTGGGAGGCAGG - Intronic
1000660486 5:163932868-163932890 TTGGTCAGGCACTGAGCTGCAGG + Intergenic
1001001848 5:168014935-168014957 TGGATCAGCCGCTGGGAGCCTGG + Intronic
1002419954 5:179140249-179140271 TGGGTCAGCAAGCGGGAGGCAGG - Intronic
1004092144 6:12514545-12514567 TTGGTGATCCACTGGGTGTCAGG - Intergenic
1006990754 6:38212817-38212839 TTGGACAGCCACACGGAGCCAGG - Intronic
1007010835 6:38416123-38416145 CTGATTAGCCACTGGGAGGTGGG + Intronic
1007078260 6:39081502-39081524 ATGGTCAGCTCCTGGGAGGAGGG + Intronic
1010897566 6:81383159-81383181 TTTGTGAGCCCTTGGGAGGCTGG - Intergenic
1012019767 6:93904269-93904291 TTTATGAGCCACTGGGAGGTTGG + Intergenic
1013368011 6:109449368-109449390 TTGGTCACCCCTTGGGAGGAAGG + Intronic
1013430433 6:110050460-110050482 TAGGGCAGCCAGTGTGAGGCAGG - Intergenic
1016175550 6:141074519-141074541 GTGCTCAGTCCCTGGGAGGCAGG + Intergenic
1017731909 6:157324195-157324217 TTGGTCTTCCGCTGGGAGGCTGG + Intergenic
1018606008 6:165598836-165598858 CTTGCCAGCCGCTGGGAGGCTGG + Intronic
1024948470 7:54834561-54834583 TGGACCAGGCACTGGGAGGCGGG - Intergenic
1025258505 7:57400830-57400852 ATGGGCAGGCACTGGGAGGGAGG + Intergenic
1025610142 7:63070879-63070901 CTGGGCAGGCACTGGGAGGTAGG - Intergenic
1025709267 7:63891930-63891952 CTGGGCAGGCACTGGGAGGGAGG + Intergenic
1026046069 7:66905970-66905992 TTGGGAGGCCACTGTGAGGCAGG - Intergenic
1026470126 7:70687993-70688015 GTTGCCCGCCACTGGGAGGCAGG - Intronic
1027197005 7:76037553-76037575 TTGAGCAGACACAGGGAGGCAGG - Intronic
1029972252 7:104801031-104801053 TTGGTCAGCCCTTGGGAAACTGG - Intronic
1031074496 7:117199680-117199702 TGTGCCAGCCACTGGGACGCTGG + Intronic
1032474554 7:132203205-132203227 AGGGACAGCCACTAGGAGGCGGG + Intronic
1037500944 8:19485013-19485035 TTTCTCACCCACTGGCAGGCTGG - Intronic
1037986154 8:23291856-23291878 CTGAGCAGCCGCTGGGAGGCAGG - Intronic
1038220792 8:25605041-25605063 TTGATCAGCCAAGGGGAGGAAGG - Intergenic
1040747639 8:50664627-50664649 TTGGGTATCCTCTGGGAGGCAGG - Intronic
1041656136 8:60352333-60352355 TTTGTCAGCCACTGGCCGGCTGG - Intergenic
1042267530 8:66924677-66924699 CCGGTCAGCAACTGGGAGGCTGG - Intergenic
1043582617 8:81731998-81732020 TTTGTCTGCCACTAGGATGCAGG - Intronic
1049102196 8:140587908-140587930 TTGGACAGGCAGTGGGAGCCAGG - Intronic
1049275121 8:141716493-141716515 TTGGCAAGCCACTGTGAGCCAGG - Intergenic
1049398194 8:142411717-142411739 TTTCTCAGCCACGGGGAAGCTGG - Intergenic
1050108528 9:2190970-2190992 TTGGTCAGCCATTGGGAGACAGG + Intronic
1051191621 9:14518879-14518901 ATGCTCAGCCACTGGGAGATGGG + Intergenic
1056586114 9:87928274-87928296 TTGGTAAGCCACTGGGTGGACGG - Intergenic
1056610768 9:88124669-88124691 TTGGTAAGCCACTGGGTGGACGG + Intergenic
1057258075 9:93567100-93567122 CTGGCCCGCCACCGGGAGGCTGG - Intergenic
1059354825 9:113690499-113690521 TTGCTGAGCCACTGCGGGGCAGG + Intergenic
1059487217 9:114636028-114636050 TGGGTCAGTCAGTGGGAGGAAGG + Intronic
1060672944 9:125486364-125486386 GTGGTCAGCCCCTGCGAGACAGG - Intronic
1061379063 9:130243487-130243509 TTGGTCAGACACAGGGAGCTGGG + Intergenic
1062133630 9:134913336-134913358 TGGGGCAGACACTGGGAGGTGGG - Intronic
1062243106 9:135550209-135550231 TTGGGAAGCCACTGGGAGGGCGG + Intergenic
1186216282 X:7304725-7304747 ATGGAGAGCCACTTGGAGGCAGG - Intronic
1186929188 X:14369801-14369823 TTGGAGATCCACTGGCAGGCAGG - Intergenic
1187927131 X:24260720-24260742 TGGGGCAGCCACTTGGAGGTGGG + Intergenic
1189912238 X:45822115-45822137 TTGTTCACCCACAGGGTGGCTGG + Intergenic
1190588548 X:51973377-51973399 TTTGTCATCCACTGGGATGTAGG + Intergenic
1193249735 X:79276351-79276373 TTGGTAGACCACTGGGAGACAGG + Intergenic
1195105836 X:101600710-101600732 TTGATCAGGCCCTGGGAGGCAGG - Intergenic
1195107047 X:101613057-101613079 TTGATCAGGCCCTGGGAGGCAGG + Intergenic
1197439102 X:126468867-126468889 TTGGTCAGTTCCTGGGAGGTGGG - Intergenic
1200177567 X:154127599-154127621 TGCCTCAGCCTCTGGGAGGCAGG - Intergenic
1200247989 X:154535964-154535986 GATGTCAGCCACTGTGAGGCGGG + Exonic