ID: 1147919018

View in Genome Browser
Species Human (GRCh38)
Location 17:43905367-43905389
Sequence CAGCCAGAGGGGCCGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147919018_1147919025 15 Left 1147919018 17:43905367-43905389 CCTCTCCACGGCCCCTCTGGCTG 0: 1
1: 1
2: 4
3: 40
4: 333
Right 1147919025 17:43905405-43905427 TCCCTTTCTTAGCTCAGAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 163
1147919018_1147919028 22 Left 1147919018 17:43905367-43905389 CCTCTCCACGGCCCCTCTGGCTG 0: 1
1: 1
2: 4
3: 40
4: 333
Right 1147919028 17:43905412-43905434 CTTAGCTCAGAGCTGGCACAAGG 0: 1
1: 0
2: 2
3: 50
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147919018 Original CRISPR CAGCCAGAGGGGCCGTGGAG AGG (reversed) Intronic
900214723 1:1475364-1475386 CAGGCAGAGGGGCAGGGCAGGGG - Intronic
900221933 1:1513714-1513736 CAGGCAGAGGGGCAGGGCAGGGG - Intronic
900318423 1:2070683-2070705 GAGCCATGGGGGCCGTGGAGGGG + Intronic
900398220 1:2462013-2462035 CAGGCAGAGGGGCTGCCGAGTGG - Intronic
900519208 1:3097639-3097661 CCCCCAGAGGGGCTGTGGGGCGG - Intronic
902544786 1:17183533-17183555 CAGCAGGAGGGGCAGAGGAGGGG - Intergenic
903157830 1:21460179-21460201 CAGCCAGCAGAGCCGTGGTGAGG - Intronic
904354629 1:29930993-29931015 CAGCCAGAGGGTGGCTGGAGTGG + Intergenic
904585301 1:31576684-31576706 CAGAGAGAGGGACAGTGGAGGGG + Intronic
904860975 1:33537456-33537478 CAGTCAGATGGGACATGGAGTGG - Exonic
904886025 1:33739082-33739104 CAGCCAGAGAGGCTGGGGAGGGG - Intronic
905358912 1:37404749-37404771 AAGCCAGAGGGGCCTTGGAGAGG + Intergenic
905422762 1:37859660-37859682 CAACCAGAGGCGCCAGGGAGGGG - Intergenic
906292929 1:44631758-44631780 CAGCGGGAGGGGTCGTGGAGTGG + Intronic
907276483 1:53319664-53319686 CAGCCGGAGTGGCAGGGGAGGGG - Intronic
907319558 1:53594062-53594084 CTGCCAGAGGGGCTGGGGTGAGG + Intronic
907324434 1:53627750-53627772 CAACCAGAGAGGAGGTGGAGGGG + Intronic
909012834 1:70354120-70354142 CGGCCAGAAGGGCCGGGGACTGG + Exonic
912473747 1:109923257-109923279 CAGCCACAGGGGCCATGGAGGGG - Exonic
912775061 1:112501763-112501785 CAGCCAGAGGATCCCTAGAGCGG - Intronic
915080136 1:153346277-153346299 GAGGCAGAGGGGCAGTGGAGAGG - Intronic
917122221 1:171654825-171654847 GAGCCACAGGGGAGGTGGAGGGG - Intergenic
921938551 1:220816766-220816788 CAGCAAGAGGGGCAAGGGAGAGG - Exonic
922100471 1:222474010-222474032 CATCCAGAGAGGCCGCCGAGAGG + Intergenic
922464881 1:225839799-225839821 CAGAGAGAGGGGCCGGGGTGAGG - Intronic
922705078 1:227786442-227786464 CAGCCAGAGGGGCCTATGACAGG - Intergenic
923657928 1:235934500-235934522 CAGCCAGAGGTGGCGTGAAAAGG + Intergenic
1064680732 10:17808925-17808947 CAGCCACACGGGCCCTGGAAAGG - Intergenic
1067334255 10:45347844-45347866 CAGACAGAGCGGCCGGGCAGAGG - Intergenic
1068884637 10:62086253-62086275 CAGATAGACGGGCTGTGGAGCGG - Intronic
1072628227 10:97128107-97128129 GAGGCAGAGGGGCCGAGGAAGGG - Intronic
1073351495 10:102823054-102823076 CAGTCACAGAGGCCGTGCAGTGG - Intergenic
1074858201 10:117489110-117489132 CAGCCAGGGAGGCCAAGGAGAGG + Intergenic
1075411845 10:122234066-122234088 ATGCCAGAGGGGCCACGGAGGGG - Intronic
1075507473 10:123037125-123037147 CAGCTAGTGGGGCCGTGGCCGGG + Intronic
1075952518 10:126493934-126493956 CAGCCAGCGGAGCTGGGGAGGGG - Intronic
1076196582 10:128522806-128522828 AATCCAGAGAGGCCGTGGATGGG + Intergenic
1076429556 10:130391939-130391961 CAGGCACAGGGAACGTGGAGGGG - Intergenic
1076541146 10:131215660-131215682 CAGAGAGAGGGGCTGTGGAGAGG + Intronic
1076619570 10:131778617-131778639 CAACCAGAGGGGCCCTGCAGTGG + Intergenic
1076652457 10:131999287-131999309 CAGCTAGAGGGGCCAAGCAGGGG + Intergenic
1076702906 10:132283491-132283513 CAGACAGATGGGCAGTGGGGAGG + Intronic
1076990115 11:268326-268348 GAGCCAGGGGGGCCGAGGAGCGG - Intergenic
1077025915 11:439825-439847 CAGCTGGAGGGGCCGGGGGGTGG - Intronic
1077170714 11:1164725-1164747 CAGCCTTAGGGGCCCAGGAGAGG - Intronic
1077268931 11:1666107-1666129 CTGTCAGAGGGGCAGTGCAGGGG + Intergenic
1077271821 11:1685073-1685095 CTGTCAGAGGGGCAGTGCAGGGG - Intergenic
1077330265 11:1981054-1981076 CAGGCAGAGGGGGTGTGGAGTGG + Intronic
1077518067 11:3014166-3014188 CAGCCCTAGGGGCACTGGAGGGG + Intronic
1079010069 11:16820755-16820777 CAGCTAGTGGGGCAGTGGGGAGG - Intronic
1080823178 11:35826306-35826328 CAGGCAGTGGGCCCCTGGAGGGG - Intergenic
1082814594 11:57499695-57499717 CGGCCAGAGGGAGCGGGGAGAGG + Intronic
1082883984 11:58065108-58065130 CTGACAGAGGGGCTATGGAGTGG + Intronic
1083410566 11:62489663-62489685 CAGGGAGAGGGGGAGTGGAGGGG + Intronic
1083540611 11:63509337-63509359 CAGCCACAGTGGCAGGGGAGAGG + Intronic
1083791548 11:64989321-64989343 CAGCTCGAGGGGCTGTGGAGGGG + Exonic
1084356432 11:68641754-68641776 CAGAGAGAGGGGCCCTGGAAGGG + Intergenic
1084624967 11:70299514-70299536 CTGCTGGAGGGGCCGAGGAGAGG - Intronic
1088847964 11:113683450-113683472 CAGCCAGAGGTTCCTTGGAAGGG + Intergenic
1089150158 11:116358060-116358082 GAGCCAGAGGGGAGGCGGAGTGG - Intergenic
1089687980 11:120169116-120169138 GACCCAGAGGGGACATGGAGAGG + Exonic
1089801530 11:121033807-121033829 GAGCCAGAGGGCACGGGGAGTGG - Intronic
1090190158 11:124761933-124761955 CAGCCAGTGATGCCCTGGAGTGG + Intronic
1090506506 11:127320822-127320844 CAGGAAGAGGGGCCCTGCAGGGG - Intergenic
1202813244 11_KI270721v1_random:36233-36255 CAGGCAGAGGGGGTGTGGAGTGG + Intergenic
1091584723 12:1809680-1809702 CAGCCAGCGGGGGCGGGGGGAGG + Intronic
1092322040 12:7486664-7486686 CAGACAGCTGGGCTGTGGAGAGG - Exonic
1092766993 12:11861778-11861800 AAGGCAGAGAGGCCCTGGAGTGG - Intronic
1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG + Exonic
1096670918 12:53197798-53197820 CAGCCAGGGCGCCCGCGGAGAGG - Exonic
1096789068 12:54034040-54034062 CAGCCGGAGGGGCTGAGGGGGGG - Intronic
1097072328 12:56364137-56364159 CAGGCAGAGGGGCTAGGGAGGGG + Intergenic
1097109309 12:56646356-56646378 CAGCCATAGGGGCGGTGGTTAGG + Intergenic
1100614441 12:96220185-96220207 CAGGCAGAGGAGCAGTGGTGGGG - Intronic
1101735492 12:107459937-107459959 CAGCCAGGGGGGCAGGGGTGGGG + Intronic
1102455003 12:113065680-113065702 CAGGTAGCGGGGCTGTGGAGGGG + Intronic
1104492595 12:129208039-129208061 CAGCCTGAGGGGCCGAGCAGAGG + Intronic
1104759342 12:131287551-131287573 CAGCCACATGGGCTGTGCAGAGG + Intergenic
1104898189 12:132174346-132174368 CAGGCAGAGCAGCAGTGGAGCGG + Intergenic
1104902582 12:132197394-132197416 CACCCAGGGGGGCCGGGAAGGGG + Intronic
1104928061 12:132323929-132323951 CAGCCGGAGTGGCCGTGGCCGGG - Intronic
1104983571 12:132584607-132584629 CAGCCCCTGGGTCCGTGGAGGGG + Exonic
1105484603 13:20814726-20814748 CTGCCAGAGAGGCTTTGGAGAGG + Intronic
1106102890 13:26709789-26709811 CAGCCTGAGGTCCCGGGGAGGGG - Intergenic
1106382808 13:29256430-29256452 GAGCCAGAGGGGCCACAGAGAGG + Intronic
1107481549 13:40789708-40789730 CAGGCAGAGGGAGCGGGGAGCGG + Intronic
1107815716 13:44242855-44242877 AAGGCAGAGGGGACTTGGAGCGG - Intergenic
1110505844 13:76285159-76285181 GAGGCAGAGGGGACGGGGAGGGG - Intergenic
1112581306 13:100678633-100678655 CACCAAGAGGGGCCGTGTGGGGG - Intergenic
1113958004 13:114109567-114109589 CAGCCATGAGGGCCGCGGAGAGG + Intronic
1114312088 14:21476978-21477000 GAGCCGGAGGGGCGGGGGAGCGG - Intronic
1115265080 14:31492675-31492697 CAGCCAGAGGTGTGGGGGAGTGG + Intronic
1116568746 14:46487623-46487645 CTGCCAGAAGGGCTGAGGAGAGG - Intergenic
1117156964 14:52951096-52951118 CGGACAGAGGGGGCGGGGAGAGG - Intronic
1117848382 14:59938066-59938088 TAGCAAGAGGGGCTGTGTAGGGG + Intronic
1121280296 14:92692767-92692789 CAGCCAGAGAAGCAGTGGGGGGG + Intergenic
1122502760 14:102212337-102212359 CAGCAAGAGGGGCCTTGGGGAGG - Intronic
1122575400 14:102738710-102738732 CAGCCTGGAGGGCCGTGGAGAGG - Intergenic
1122593528 14:102872479-102872501 CAGCCACAGGGGGCGAGAAGGGG - Intronic
1122863681 14:104593940-104593962 CGGCCAGAGGCCCCGAGGAGGGG + Intronic
1122940626 14:104979441-104979463 CAGGCAGAGGGGACTTGGTGAGG + Intergenic
1122959633 14:105088456-105088478 CAGCCAGCGGGGCCGAGGGGAGG + Intergenic
1123082027 14:105699905-105699927 CAGGGGCAGGGGCCGTGGAGTGG - Intergenic
1124079776 15:26481147-26481169 TAGCCAGAGGAGCAGTGGATGGG + Intergenic
1124576822 15:30916874-30916896 TAGACAGAGTGGCCCTGGAGAGG + Intronic
1126066131 15:44827666-44827688 CAGCCAGAGGGCCCCAGCAGGGG + Intergenic
1126093705 15:45072898-45072920 CAGCCAGAGGGCCCCAGCAGGGG - Intronic
1126106166 15:45148299-45148321 CAGCCAGCTGGGCCTTGGACAGG - Exonic
1129780792 15:78269328-78269350 CAGCCAGAGTGGATGTGGTGTGG + Intronic
1130300677 15:82678067-82678089 CAGCCAGAAGGGCCTGGGAGAGG - Intronic
1130912545 15:88281088-88281110 CAGAGAAAGGGGCCATGGAGAGG - Intergenic
1131050704 15:89346096-89346118 CAGTCAGAGGGGCCCTCAAGTGG - Intergenic
1131977566 15:97961202-97961224 CAGGCTGCGGGGCCGGGGAGGGG + Intronic
1132467943 16:86215-86237 CAGACAGAGGTGCTGGGGAGGGG + Exonic
1132523963 16:405157-405179 CTGCCAGAGGGACTGGGGAGCGG + Intronic
1133223542 16:4329242-4329264 CAGCCAGAGAAACAGTGGAGGGG + Intronic
1133317324 16:4892787-4892809 ATGCCAGGGGGGACGTGGAGGGG - Intronic
1136578888 16:31140404-31140426 CAGCCACAGGGACTGGGGAGAGG + Exonic
1138385329 16:56632459-56632481 GAGCCAAAGGGGCGGTCGAGCGG + Exonic
1138418901 16:56886711-56886733 CAGCAAGAGGGGCCAGGAAGGGG - Intronic
1138651356 16:58463365-58463387 CGGCCACAGGGGGCCTGGAGGGG + Intronic
1139371843 16:66473845-66473867 CAGCCAGAGGGGTGGGAGAGAGG - Intronic
1139574717 16:67833697-67833719 CAACTAGAGGGACCGGGGAGTGG - Intronic
1139592315 16:67940140-67940162 CACCCACAGGGTCCGTGTAGGGG + Exonic
1139964829 16:70739493-70739515 CAGCCAGAGGGGAGGAGGAGAGG - Intronic
1140728514 16:77835395-77835417 CAGCCACAGGGGCCATGAAAAGG - Intronic
1141445934 16:84058406-84058428 CTGCCTGAGGGGCTGGGGAGAGG + Intronic
1141708144 16:85680971-85680993 CAGCCAGAGGGGCCTTTGAAAGG - Intronic
1141839787 16:86567225-86567247 GAGCCAGAGGGGGAGAGGAGGGG - Intergenic
1142008856 16:87703661-87703683 CAGCCAGTGGGGGCTTGGAAGGG + Intronic
1142058466 16:88015156-88015178 CAGGCAGAGGGGACGGGCAGAGG - Intronic
1142352667 16:89587182-89587204 CAGACTGAGGGGGCGGGGAGGGG - Intronic
1142586955 17:979800-979822 CAGGCGGAGGGGGCGTGGCGTGG - Intergenic
1143181335 17:4986253-4986275 CGGCCTGAGGGGCCGGGGGGAGG + Exonic
1143211544 17:5191784-5191806 CAGTGATAGCGGCCGTGGAGGGG - Intronic
1143477030 17:7208694-7208716 CAGCCAGAGGGGTAGGGGAGGGG - Intronic
1143688811 17:8542746-8542768 CAGCCTGAGTGACAGTGGAGTGG - Intronic
1144029149 17:11304200-11304222 CAGTGAGAGGGGCCCTGGAGGGG + Intronic
1144707630 17:17380125-17380147 AAGCCAGAGGGGCCTGAGAGAGG + Intergenic
1145013305 17:19381953-19381975 CAGCCAAGGGGTCAGTGGAGGGG - Exonic
1145024033 17:19454106-19454128 CAGGCAAAGTGGCTGTGGAGAGG - Intergenic
1145828140 17:27892943-27892965 CGGGCAGAGGGACGGTGGAGGGG + Intronic
1146975506 17:37107911-37107933 CAGGGAGAGTGGCTGTGGAGCGG - Intronic
1147383860 17:40070705-40070727 CAGGCAGAGGGGAAGGGGAGAGG + Intronic
1147911619 17:43859431-43859453 GAGGCAGAGGGGCAGGGGAGAGG + Intronic
1147919018 17:43905367-43905389 CAGCCAGAGGGGCCGTGGAGAGG - Intronic
1147934069 17:44001534-44001556 CAACCAGAGGAGAGGTGGAGGGG + Intronic
1147946437 17:44082856-44082878 CAGGCAGGAAGGCCGTGGAGGGG + Intronic
1148159581 17:45442276-45442298 CAGCCAGAGGGAAGGTTGAGAGG - Intronic
1148793645 17:50187109-50187131 GAGCCAGGGGGACCCTGGAGTGG + Exonic
1148798117 17:50207137-50207159 CAGCCATAGGGGGCGTGGCCGGG + Intergenic
1149419144 17:56491614-56491636 CATCCAGAGGGGCCAAGAAGCGG + Intronic
1150508569 17:65724864-65724886 CAGCAGGAGGGGCTGTGCAGTGG - Intronic
1151414420 17:73952378-73952400 CAGCCAGAGACGCGCTGGAGGGG + Intergenic
1151957854 17:77389383-77389405 CTGCCAGAGAGGCCCTGGCGGGG + Intronic
1151978355 17:77494960-77494982 CAGGCAGAGGGGCCAAGGGGAGG - Intronic
1152206406 17:78976841-78976863 CAGTCACAGGGGCCGTTGTGAGG - Intronic
1152252076 17:79217551-79217573 CAGGCAGAGGGGAGATGGAGGGG + Intronic
1152310625 17:79547777-79547799 CAGGGAGAGGGGCTGTGGTGTGG - Intergenic
1152418238 17:80176945-80176967 CAGCCAGAGGGAGCGTGCACAGG - Intronic
1152557159 17:81059127-81059149 CAGCCTGTGGGGGCGTGGGGGGG - Intronic
1152572447 17:81126770-81126792 CTGGCTGAGGGGCAGTGGAGAGG - Intronic
1152630503 17:81408758-81408780 CAGCCAGGGGGGCTGGGCAGGGG - Intronic
1152740312 17:82015805-82015827 CTGCCCGAGTGGCCCTGGAGAGG - Intronic
1152750902 17:82062047-82062069 GGGGCAGAGGGGGCGTGGAGGGG - Intronic
1153005075 18:490841-490863 CAGCCTGAAGGACCGTGGACAGG + Intronic
1154305034 18:13224298-13224320 CACCCAGAGGTGCCATGGGGAGG - Intronic
1154380903 18:13848972-13848994 TAGCCACAGAGGGCGTGGAGAGG - Intergenic
1156498454 18:37541462-37541484 CAGCCAGAGGAGCAATGGTGGGG - Intronic
1157608980 18:48944265-48944287 CAGCCAAAGGTGGCGGGGAGTGG - Intronic
1158931877 18:62330729-62330751 GAGCCAGTGGGGCTGTGCAGGGG + Intronic
1160242042 18:77131795-77131817 CAGGCAGTGGGGCCCAGGAGGGG + Intronic
1160588037 18:79923325-79923347 CAGGCAGGGGGGCTGTGGACAGG + Intronic
1161562444 19:4981125-4981147 CAGCCAGTGGGGCCCTGGCAGGG + Intronic
1161837028 19:6654762-6654784 GAGCCAGAGGAGGAGTGGAGAGG - Intergenic
1162261896 19:9540682-9540704 CAGCCTGAGGGGGAGGGGAGAGG - Intergenic
1162524112 19:11197582-11197604 CAGCCGGAGGGGGCGTGGTGCGG - Intronic
1162917355 19:13881555-13881577 CAGACAGCTGGGTCGTGGAGGGG + Intergenic
1162938128 19:13992024-13992046 CATCCTGAGGGGCTGTGGAAGGG - Intronic
1163096565 19:15062201-15062223 CAGGCAGAAGGGAGGTGGAGAGG + Intergenic
1163468482 19:17483519-17483541 TAGCCAGAGGGGCCTTCTAGGGG + Intronic
1163505343 19:17702511-17702533 CAGGCAGCGGGGCGGGGGAGGGG + Intergenic
1163737752 19:18991820-18991842 CAGCCTGTGGGGGCCTGGAGTGG - Intronic
1166116976 19:40662312-40662334 CAGGCAGAGGGGTCGGGGCGGGG + Intergenic
1166292003 19:41869371-41869393 CAGCCAGAGAGGTCGGGGTGAGG - Intronic
1167134284 19:47608199-47608221 CGGCCAGAGCGGCCGGGGACAGG + Exonic
1167171971 19:47839500-47839522 GAGCCTGAGGGGCCGGGCAGAGG - Exonic
1168167957 19:54566463-54566485 CAGCCAGAAGAGCCGTGGGGTGG - Intergenic
1168272596 19:55258355-55258377 AAGCCTGAGGGGACGCGGAGAGG + Intronic
925092508 2:1166941-1166963 GAGCCAGAAGGGGCATGGAGTGG - Intronic
925394758 2:3525218-3525240 CAGGGAGAGGGGCGGTGGAAGGG + Intergenic
925607495 2:5673557-5673579 CCGCCCGCGCGGCCGTGGAGGGG - Intergenic
926116724 2:10218122-10218144 CGGCCAGAGGTGGCCTGGAGTGG - Intergenic
926250538 2:11153335-11153357 CAGCATGAGGGGCCTTTGAGAGG - Intergenic
928770132 2:34695758-34695780 CTGCCAAAGGGGCCGTGAACTGG - Intergenic
929592116 2:43154154-43154176 CAGCCACAGGGGCTATTGAGGGG + Intergenic
931665167 2:64605328-64605350 GAGCCAGAGGGCCCGGGCAGAGG + Intergenic
932574440 2:72955016-72955038 CAGCCAGAGGGGCAGAGGGCAGG + Intronic
934619070 2:95793161-95793183 GAGCCAGAGGGGCAGTACAGGGG + Intergenic
934641821 2:96031396-96031418 GAGCCAGAGGGGCAGTACAGGGG - Intronic
937216948 2:120318853-120318875 CAGACAGAGGGGCCGAGAAGGGG - Intergenic
937305389 2:120867546-120867568 CACCCAGAGGGGCGGCGGTGCGG - Intronic
938599351 2:132821448-132821470 CAGCCAGAGGAATTGTGGAGGGG + Intronic
941554595 2:166961048-166961070 CAGAGAGGGGGGCTGTGGAGTGG - Intronic
941635649 2:167932405-167932427 CAGCCATGGGGGCAGTGGACTGG - Intergenic
944206812 2:197165153-197165175 CAGCCAGAAGGGGCGTGTTGAGG - Intronic
944306872 2:198188875-198188897 AAGCCAGAAGGGGGGTGGAGTGG - Intronic
946376046 2:219309391-219309413 CTGCCAGAGGGGCTGAGGCGGGG + Exonic
947728705 2:232416602-232416624 CAGCTACTGGGGCCGTGGTGAGG - Intergenic
947823498 2:233088853-233088875 CATCCAAAGGGGCCTTGGAGAGG + Intronic
948125238 2:235560238-235560260 CAGCCAAACATGCCGTGGAGGGG - Intronic
948159699 2:235813876-235813898 TAGCCAGAAGGGCGATGGAGTGG + Intronic
948572639 2:238927230-238927252 CACCAAGAGGGGACGTGAAGAGG + Intergenic
948720482 2:239896525-239896547 CAGCCAGTGGGGCCACGGAAGGG + Intronic
949031575 2:241799691-241799713 CAACCAGAGGGGCTGGGGAGTGG - Intronic
1168770068 20:408851-408873 TGGCCAGAAGGGCCTTGGAGAGG + Intronic
1169130211 20:3162915-3162937 CACCCAGAAGGGCTGTGCAGAGG + Exonic
1171767082 20:29296422-29296444 CTGTCAGACGGGCCGTGCAGTGG + Intergenic
1172695499 20:36819981-36820003 CAGCCAGTGGGGCCCTGGACGGG + Intronic
1172847811 20:37940309-37940331 CAGCCAGAGGGGCAGCTGGGAGG + Intronic
1173851640 20:46222327-46222349 CTGTGAGAGGGGCAGTGGAGGGG - Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174147717 20:48463697-48463719 CAGCCTGAGGGGGCCTGAAGGGG + Intergenic
1174430428 20:50464473-50464495 CAGCTGGAGGGGTCGGGGAGAGG - Intergenic
1174553147 20:51375785-51375807 AAGCCAGAGGTGCCCCGGAGAGG + Intergenic
1175963441 20:62648398-62648420 CAGCCACAGGGGGCCTGAAGTGG + Intronic
1176064303 20:63186861-63186883 CAGCCTGAGGACCTGTGGAGGGG + Intergenic
1176113095 20:63419362-63419384 CAGCCAGAGGGGCCAGCCAGGGG - Intronic
1176143525 20:63555296-63555318 CACCCCTCGGGGCCGTGGAGAGG - Exonic
1178807161 21:35848853-35848875 CAGCCACAGCGGCCGTGTATGGG + Intronic
1179076992 21:38131782-38131804 CTGCCAGATGTGCCCTGGAGGGG - Intronic
1179879738 21:44288408-44288430 GAGCCCGAGGGGCCGTGGAGGGG + Exonic
1180107948 21:45632151-45632173 CACCCAGAGGGGTCGTAGGGTGG + Intergenic
1182439819 22:30356704-30356726 CAGGCTGAGGGGCGGGGGAGAGG + Exonic
1182508770 22:30803754-30803776 CAGGCAGAGGAGCTCTGGAGTGG + Intronic
1183005066 22:34894577-34894599 CAGCCAGTGAGGACTTGGAGGGG - Intergenic
1183186679 22:36295445-36295467 CAGCCAGGGGGGCCTTGGCTTGG - Intronic
1183303060 22:37067903-37067925 CTGCCAGAGGGGCTGAGGTGGGG - Intronic
1183489125 22:38107458-38107480 CGGGCAGTGGGGCCGTGGAACGG + Intronic
1184309327 22:43631095-43631117 CAGCCTGGGGGGCTGTGGGGAGG - Intronic
1184387628 22:44185405-44185427 CTACGAGAGGGGCCATGGAGGGG + Intronic
1184502251 22:44881084-44881106 CAGCCAGGTGGGCGTTGGAGGGG - Intergenic
1184767452 22:46579001-46579023 CAGCCATAGGGGCAGCTGAGAGG - Intronic
1184774796 22:46617763-46617785 CACCCAGGGGGGCCAGGGAGCGG - Intronic
1185215742 22:49599090-49599112 GCGCCAGATCGGCCGTGGAGGGG - Intronic
949504978 3:4719309-4719331 CAGCCTGAGGGGCTGGGGACAGG - Intronic
953018818 3:39100974-39100996 CATCCAGAGGGTCTGGGGAGGGG + Intronic
953044220 3:39280980-39281002 GGGCCAGAGGGGCCTTGAAGGGG - Intronic
953799508 3:46011530-46011552 CTGGCAGAGGGACAGTGGAGAGG + Intergenic
954388631 3:50257717-50257739 GAGCCAGAGGGGCTGTGGCAGGG + Intronic
955326955 3:58015960-58015982 AGGTCAGAGGGGCAGTGGAGGGG + Intronic
955412327 3:58663818-58663840 CACCCAGCAGGGCCGGGGAGAGG - Intronic
955950712 3:64239587-64239609 CAGCCACAGGGACAGGGGAGGGG + Intronic
956726918 3:72163833-72163855 CAGCCAGAGGGGTGGGGCAGGGG + Intergenic
958497597 3:94864508-94864530 CAGCCTGAGGGGAAGTGGAGAGG + Intergenic
958513005 3:95073326-95073348 CAGGCAGAGGGGGAGTGAAGAGG + Intergenic
959758751 3:109930811-109930833 CAGACAGAGAGGGAGTGGAGTGG - Intergenic
961370046 3:126423431-126423453 GAGCCAGAGGGGCAGGGGTGGGG - Intronic
961626122 3:128264905-128264927 CAGCCAGAGGGGAGGTGGGGCGG - Intronic
962368015 3:134798362-134798384 TGGCCAGAGGGGCAGAGGAGGGG + Intronic
962876942 3:139542347-139542369 GAGCCAGAGGGGCCCTAGAAGGG + Intergenic
964621461 3:158723719-158723741 AGGCCAGAGGGGACCTGGAGGGG - Intronic
966806290 3:183810363-183810385 CAGGCAGAGGCCCCGTGGAGAGG - Intronic
967956762 3:194883390-194883412 CAGCCAGAGGAGCCATTGACAGG + Intergenic
968553092 4:1234025-1234047 CAGCCAGCAGGGACGAGGAGGGG + Intronic
968642203 4:1720479-1720501 CATCCAGAGGGACCGCGGCGTGG - Intronic
968751580 4:2392259-2392281 CAGCCAGGCTGGCTGTGGAGGGG - Intronic
969249267 4:5956371-5956393 AAGGCCCAGGGGCCGTGGAGTGG - Intronic
969638221 4:8381789-8381811 CAGCCAGGGGGGCCCTGGGCAGG - Intronic
969889762 4:10249125-10249147 GAGCCAGAGGTGTCCTGGAGGGG + Intergenic
970859064 4:20681436-20681458 TAGCCAGAGGGCCAGGGGAGGGG - Intergenic
971207349 4:24583881-24583903 CAGCCAGAGGGGCCGTGGGGAGG - Intronic
975660320 4:76682018-76682040 GAGCCAGAGGGAAAGTGGAGGGG - Intronic
976226241 4:82797718-82797740 CAGGGACAGGGGCCTTGGAGAGG + Intronic
976373419 4:84316572-84316594 CAGCCAGAAGGGGCGAGGAAGGG + Intergenic
978105907 4:104901595-104901617 CAGGCAGAGGAGCAGAGGAGTGG + Intergenic
978250063 4:106619878-106619900 CAGCCAAAGAGTCCATGGAGTGG - Intergenic
983717646 4:170805114-170805136 CATCCAGAGGAGCAGAGGAGCGG + Intergenic
984947915 4:184984102-184984124 CTGCCCGGTGGGCCGTGGAGGGG - Intergenic
985400167 4:189586252-189586274 CAGAGAGAGGGGCCTTTGAGGGG - Intergenic
985909426 5:2867273-2867295 CAGGCAGAGGGTCCGTGGAGAGG - Intergenic
988267229 5:28967704-28967726 GAGCCAGAGGGGAGATGGAGTGG - Intergenic
990382799 5:55232995-55233017 AAGCACAAGGGGCCGTGGAGGGG - Intronic
991609292 5:68434288-68434310 CAGGCAGAGGGGACGTGGGCGGG + Intergenic
992894634 5:81235470-81235492 CAGCCAGAGGGCAGGTGGAAGGG - Intronic
994420585 5:99524215-99524237 CAGACACAGGAGCTGTGGAGGGG + Intergenic
998214732 5:140228666-140228688 CAGTCAGAGGGGACTTGGAGTGG - Intronic
998849241 5:146338413-146338435 CGCCCAGACGGGCCCTGGAGAGG - Intronic
999654016 5:153795149-153795171 CAGCCAGAGAGCCTGTGGACAGG + Intronic
1000164478 5:158634699-158634721 CACCCAGATGGCCCATGGAGAGG - Intergenic
1000383702 5:160652266-160652288 GAGGAAGAGGGGCTGTGGAGAGG + Intronic
1001425204 5:171618159-171618181 CAGCCAGCTGGGCCATGGAGAGG + Intergenic
1001714788 5:173806487-173806509 CAGGAAGAGGGGCCCTGGAGAGG - Intergenic
1002332138 5:178450455-178450477 CAGCCAGCGGGGGCCAGGAGAGG + Intronic
1002400243 5:178987613-178987635 CATAGAGAGGGGCCGTGGAATGG + Intronic
1002457714 5:179355106-179355128 CAATCAGAGGGTCTGTGGAGTGG - Intergenic
1002683527 5:180988921-180988943 CAGGCGCAGGAGCCGTGGAGAGG - Exonic
1003711996 6:8602781-8602803 CAGCCAGAGGAGCAGGGCAGAGG - Intergenic
1005913987 6:30335988-30336010 CAGCCTGAGGGGCTATGCAGGGG - Intronic
1006171732 6:32097072-32097094 CAGCCAGAGGGGACGCTGTGAGG - Intronic
1006271331 6:32969188-32969210 CAGCCAATGGGAGCGTGGAGGGG + Intronic
1006298423 6:33180319-33180341 CGGCCAGGGGGGCCCTGGAGTGG + Exonic
1007393729 6:41565456-41565478 CACCCAGAGGGGCAGTGCAAGGG + Intronic
1007578184 6:42939331-42939353 CAGCCCGTGGGGCTGAGGAGGGG + Intergenic
1007742957 6:44023914-44023936 CTGTCACAGGGGCCGTGTAGGGG + Intergenic
1008624443 6:53303965-53303987 CAACAAGAGGGGCAGTGGAGTGG - Intronic
1010187034 6:73156807-73156829 CAGGCAGAGTGACTGTGGAGAGG + Intronic
1013108506 6:107046589-107046611 GAGGGACAGGGGCCGTGGAGGGG + Intronic
1015383013 6:132591368-132591390 CTGCCAGAGGGGCCTGGAAGAGG + Intergenic
1016882095 6:148921525-148921547 CAGACAGAGAGTCCCTGGAGAGG - Intronic
1017798402 6:157869152-157869174 CAGCCAGTGAGGCCGGGGAGAGG - Intronic
1018378266 6:163233602-163233624 CAGTCCAAGAGGCCGTGGAGGGG + Intronic
1018856391 6:167678377-167678399 CAGCCATGGGAGCCGTGGTGGGG + Intergenic
1018986746 6:168643526-168643548 CAGGCAGAGGTGCAGTGGTGTGG - Intronic
1019505635 7:1389088-1389110 GACACAGAGGGGCCATGGAGGGG + Intergenic
1021009407 7:15443029-15443051 AAGCCAGAGGGGAGATGGAGTGG - Intronic
1022015478 7:26345405-26345427 CAGTCAGAGGACCCATGGAGAGG - Intronic
1022050466 7:26663708-26663730 CAGCCAGGGGAGCCTTGAAGAGG - Intergenic
1022757602 7:33310464-33310486 CATCCAGATGGGCCATGGATAGG + Intronic
1023360911 7:39414434-39414456 CAGGCAGAGGGAGAGTGGAGGGG + Intronic
1024811691 7:53219394-53219416 CCACCAGAGGGGACGTGGACAGG + Intergenic
1026213599 7:68328626-68328648 CAGCCAGGTTGCCCGTGGAGAGG + Intergenic
1026921962 7:74162350-74162372 GAGACAGAGGGGCACTGGAGTGG + Intergenic
1029193631 7:98789107-98789129 AAGCCAGAGAGTCCCTGGAGAGG - Intergenic
1032012650 7:128356950-128356972 CAGCCAGAGTGGTCAGGGAGTGG + Intronic
1032837759 7:135689757-135689779 AAGCCAGAAGTGCCATGGAGGGG + Intronic
1033355708 7:140597777-140597799 GAGCCAGAAGGGGCGTGGAAGGG + Intronic
1035395114 7:158529706-158529728 CAGCCCCAGGGGCTGTGGGGAGG + Intronic
1035620192 8:1030815-1030837 CAGCCAGCGGGGCCGCGGGCGGG + Intergenic
1039434049 8:37547471-37547493 CAGGCAGAGGGGCAGGGGAGTGG - Intergenic
1040515482 8:48130871-48130893 GAGGGAGAGAGGCCGTGGAGTGG + Intergenic
1040752445 8:50727489-50727511 AAGCCAGTGGGGCTGTGGAATGG - Intronic
1040917110 8:52574064-52574086 CAGACAGAGCGGCCGGGCAGAGG + Intergenic
1045543319 8:103106270-103106292 GAGCCAGAGGTGGCGGGGAGGGG + Intergenic
1045815087 8:106269980-106270002 CAGCCAGAGGGGCCGCGCGCGGG + Intergenic
1047180699 8:122585017-122585039 CAGCCAGCAGGGCCCTAGAGAGG - Intergenic
1048981058 8:139703591-139703613 CACCGAGAGGGGGCGAGGAGGGG - Intergenic
1049531183 8:143156471-143156493 CAGCTAGGGAGGCCGTGGACAGG - Intergenic
1049620204 8:143594707-143594729 CAGCCAGGTGGGCCGGAGAGGGG - Intronic
1049789997 8:144468139-144468161 CACTCAGAGGGGCCACGGAGAGG - Intronic
1053055577 9:34991492-34991514 CAGGCAGAGGGCCAGTGGAACGG - Intronic
1053131574 9:35618516-35618538 GGGCCAGAGGGGCCACGGAGGGG + Intronic
1054914652 9:70484750-70484772 CAGCCTGAGGATCAGTGGAGAGG + Intergenic
1055466765 9:76574118-76574140 CAGCCCAAGGGGCCAAGGAGGGG - Intergenic
1055807095 9:80108025-80108047 CCTCTAGAGGGGCAGTGGAGGGG - Intergenic
1055923971 9:81491046-81491068 CAGCCAAAAGGGCTGTGAAGAGG + Intergenic
1056576093 9:87857219-87857241 CAGACAGAGGGGCGGTGGCAGGG + Intergenic
1056720744 9:89069688-89069710 CAGCACGAGCTGCCGTGGAGAGG - Intronic
1057206424 9:93175796-93175818 CTGCCACAGGGGCTGTGGTGGGG + Intergenic
1059331156 9:113536609-113536631 CAGCCAGAGGCGCAGGGAAGTGG - Intronic
1059557219 9:115293313-115293335 ATGCCAGAGGGGAAGTGGAGGGG + Intronic
1060113804 9:120925768-120925790 CAGCCAGAGGGGCAGTGTCAGGG + Intronic
1060991911 9:127854328-127854350 CAGCCAGAGGGAGCGTGCCGCGG + Exonic
1061399733 9:130361847-130361869 CAGCCTTGGGGGCAGTGGAGTGG + Intronic
1061805149 9:133133593-133133615 CAGCCAGAGTTGCGGTGGGGAGG - Intronic
1061870345 9:133517014-133517036 CAGCCACAGGAGCCGAGGATGGG - Intronic
1061926890 9:133810323-133810345 CAGCACGAGGGGCCGTGATGTGG - Intronic
1062037459 9:134389147-134389169 CATCCAGAGGGGCAGGGGACGGG - Intronic
1062275273 9:135727530-135727552 CAGCCCGAGGGGCCTGGGAACGG + Intronic
1062323944 9:136003726-136003748 CTGGGAGAGGGGCCCTGGAGAGG + Intergenic
1062380252 9:136283669-136283691 CAGCCAGAGGGGCAGAGGTGCGG - Intronic
1062433996 9:136538364-136538386 CAGCCAGCGGGACCCTGGGGCGG - Intronic
1062696212 9:137877644-137877666 CAGCCGGAGGGGCCGGGGCGGGG + Intergenic
1186403714 X:9283276-9283298 CAGTCTTAGGGGCCTTGGAGGGG - Intergenic
1186896924 X:14012842-14012864 CAGGCAGAGGGGCTATGGGGGGG + Intronic
1187138964 X:16575314-16575336 CAGGCAGAGGAGGCGCGGAGAGG - Intergenic
1189159948 X:38801402-38801424 AAGCCAGAGGGGCGGTGGTGGGG + Intergenic
1191146046 X:57166180-57166202 AAGCCAGAGGGGGGATGGAGTGG - Intergenic
1192664178 X:73069920-73069942 CAGACAGGGCGGCCGGGGAGAGG - Intergenic
1192947438 X:75981665-75981687 AAGCCAGTGGGGCAGGGGAGTGG - Intergenic
1195240804 X:102949915-102949937 TACCCAGAGGGGTTGTGGAGTGG - Intergenic
1195298371 X:103502598-103502620 CACCCAGAGGGGTTGTGGAGTGG + Exonic
1195301636 X:103535832-103535854 CACCCAGAGGGGTTGTGGAGTGG + Intergenic
1199616233 X:149658412-149658434 CAGCAGGAGGGACTGTGGAGTGG + Intergenic
1199626407 X:149744836-149744858 CAGCAGGAGGGACTGTGGAGTGG - Intergenic
1199979662 X:152914010-152914032 CAGGCAGATGGCCTGTGGAGAGG - Intergenic
1200078604 X:153564534-153564556 CAGCCAAAGGGCCCAGGGAGTGG - Intronic
1201294814 Y:12453859-12453881 CAGCCAGGGTGGCCGGGCAGAGG + Intergenic
1201340345 Y:12926357-12926379 GAGCCAGAAGGGCGATGGAGTGG + Intergenic