ID: 1147919159

View in Genome Browser
Species Human (GRCh38)
Location 17:43905976-43905998
Sequence ATGCCCAGGATCCACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147919151_1147919159 9 Left 1147919151 17:43905944-43905966 CCCCTATTCAGGCTACACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1147919159 17:43905976-43905998 ATGCCCAGGATCCACTGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 140
1147919153_1147919159 8 Left 1147919153 17:43905945-43905967 CCCTATTCAGGCTACACCCAGGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1147919159 17:43905976-43905998 ATGCCCAGGATCCACTGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 140
1147919154_1147919159 7 Left 1147919154 17:43905946-43905968 CCTATTCAGGCTACACCCAGGCT 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1147919159 17:43905976-43905998 ATGCCCAGGATCCACTGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 140
1147919157_1147919159 -9 Left 1147919157 17:43905962-43905984 CCAGGCTGGAAGAAATGCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 242
Right 1147919159 17:43905976-43905998 ATGCCCAGGATCCACTGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 140
1147919156_1147919159 -8 Left 1147919156 17:43905961-43905983 CCCAGGCTGGAAGAAATGCCCAG 0: 1
1: 0
2: 3
3: 21
4: 258
Right 1147919159 17:43905976-43905998 ATGCCCAGGATCCACTGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147919159 Original CRISPR ATGCCCAGGATCCACTGTGC TGG Intronic
901259278 1:7859706-7859728 ATGCCCAGGCTCCTCATTGCTGG - Intergenic
901954964 1:12777403-12777425 ATGCCCAGGGTGCTCTCTGCTGG + Exonic
902158849 1:14512719-14512741 ATGCCCAGATTCCACCCTGCTGG + Intergenic
903237311 1:21958400-21958422 ATTGCCAGGAGCCACTCTGCTGG - Intergenic
904023998 1:27490631-27490653 TTGCCCCGGATGGACTGTGCAGG - Intergenic
906078022 1:43066561-43066583 GTGCACATGCTCCACTGTGCCGG + Intergenic
908897316 1:68914866-68914888 ATGCCCAGCATTCGCTGTGGTGG - Intergenic
910446926 1:87308250-87308272 ATTCCCAGGCTCCACTTTGCTGG + Intergenic
913282415 1:117198982-117199004 ATGCCCAGGAACCAAAGGGCAGG - Intronic
915321796 1:155060563-155060585 CTCCCCAGGAGCCCCTGTGCTGG + Intronic
1063982818 10:11469720-11469742 ATGCCCATCCCCCACTGTGCGGG - Intronic
1064615201 10:17146356-17146378 ATGGCCAGGGTCCTCTGTGAAGG + Intronic
1065887625 10:30092662-30092684 ATGCCAAGCATCCAACGTGCTGG - Intronic
1066235789 10:33483007-33483029 GTGCCCAGGATTCAGTGTCCAGG + Intergenic
1067684280 10:48457644-48457666 GTGCCCAGGGGACACTGTGCTGG + Intronic
1068603668 10:58981615-58981637 ATGTTCAGGATACTCTGTGCTGG - Intergenic
1069937409 10:71927304-71927326 GCTCCCAGGATCCACTGAGCAGG + Intergenic
1070918380 10:80169142-80169164 ATACCCAGGGGCCCCTGTGCCGG - Exonic
1071876917 10:89852374-89852396 GTGCCTAGGACCCACTGGGCTGG - Intergenic
1073431827 10:103492218-103492240 ATGCCCAGGATCACGTGTGCAGG - Intergenic
1074073571 10:110098902-110098924 ATGGGCATGAGCCACTGTGCCGG + Intronic
1074123932 10:110513358-110513380 CTAACCAGGATCCAGTGTGCTGG + Intergenic
1074900628 10:117813440-117813462 ATGCCAAAGATCAGCTGTGCTGG - Intergenic
1075650096 10:124122135-124122157 GTGTGCAGGATCCAGTGTGCAGG + Intergenic
1076698007 10:132256383-132256405 AGGACCAGGATCCACAGTGCTGG - Intronic
1081395837 11:42585292-42585314 ATCCCCAGGAGCAACTGGGCAGG + Intergenic
1084973374 11:72783259-72783281 TTGTCCAGGATTCACTTTGCAGG - Intronic
1086259598 11:84923174-84923196 ATGCCCAGGATCGTGTGTGTGGG - Intronic
1089489035 11:118870202-118870224 CTGCCCAGCAGCCACTGAGCTGG - Intergenic
1090042442 11:123302543-123302565 ATGGCTAGGGACCACTGTGCTGG - Intergenic
1094831879 12:34304069-34304091 CTTCCCAGGAGCCACTGCGCGGG + Intergenic
1094836327 12:34323827-34323849 ATTCCCAGCATCCCCTGCGCAGG - Intergenic
1096611422 12:52804503-52804525 AAGGCCAGGATCCACTCTCCTGG + Intergenic
1096648318 12:53049926-53049948 ATTCCCAGGATCTACCCTGCTGG - Intronic
1097938733 12:65280493-65280515 AAGACCAGAATCCACTGTACTGG + Intronic
1099417027 12:82402868-82402890 TTGCCCAGGCTGCACTGTGGTGG - Intronic
1099930423 12:89067799-89067821 ATGCCCAGTAGCCAGTGAGCAGG - Intergenic
1100994504 12:100288919-100288941 CTGCCCAGGCTCCAAAGTGCTGG + Intronic
1105532711 13:21234679-21234701 ATGCCCTGGCGCCTCTGTGCTGG - Intergenic
1106878953 13:34108153-34108175 AAGTCCAGGACCCACAGTGCTGG + Intergenic
1106900416 13:34349654-34349676 AAGCACAGGATCCACTTTCCTGG + Intergenic
1107671447 13:42750344-42750366 ATGCCCAGGAGCTGCTCTGCTGG - Intergenic
1111515850 13:89329546-89329568 ATGACCAGTATCCACAGAGCAGG + Intergenic
1119666117 14:76486309-76486331 CTGCCCAGGCTCCCATGTGCAGG + Intronic
1121247914 14:92476130-92476152 ATGCCCAGGAACGTCTTTGCGGG - Intronic
1121830365 14:97046241-97046263 ATGTCCAGAATCCACAGGGCAGG - Intergenic
1125857137 15:42961389-42961411 ATGCAAATGAGCCACTGTGCTGG + Intronic
1128799326 15:70487525-70487547 AAGCGCAGGGTCCACTGGGCAGG - Intergenic
1130670358 15:85906908-85906930 ATGCACACGATCCACTGTGCAGG + Intergenic
1133097536 16:3457867-3457889 AGGCCCAGGATCCCGTATGCGGG - Intronic
1135070311 16:19345976-19345998 AGCCCCATGATCCCCTGTGCTGG + Intergenic
1137447090 16:48538569-48538591 GTGCCCAGGATGCCATGTGCTGG + Intergenic
1139513593 16:67440843-67440865 ATTCCTGGGATCCTCTGTGCTGG - Intronic
1140277488 16:73523544-73523566 ATGCCAAGGATCCAGGGTGAGGG - Intergenic
1141597307 16:85105139-85105161 GTGGCCAGGATTAACTGTGCCGG + Intronic
1144371387 17:14594819-14594841 AGGCAGAGGATCCACTGAGCTGG + Intergenic
1147336079 17:39727601-39727623 CAGCCCAGGGTCCACTGTGGGGG + Intronic
1147919159 17:43905976-43905998 ATGCCCAGGATCCACTGTGCTGG + Intronic
1148719540 17:49740979-49741001 ATGCCCAGAACCCACTGGTCAGG - Intronic
1148990393 17:51661032-51661054 ATCCCCATGATCCACTGTCATGG + Intronic
1149697146 17:58625038-58625060 ATTCCCACGATGCAGTGTGCTGG - Intronic
1151674276 17:75589696-75589718 TTCCCCAGGATCCACAGGGCAGG + Intergenic
1153736268 18:8071662-8071684 AAGCCCAGGATGCACAGAGCAGG - Intronic
1157911980 18:51624914-51624936 ATGCCCAGGATGGAATGTACTGG - Intergenic
1164402384 19:27911010-27911032 CTGCCTAGGAGCCACTGGGCAGG + Intergenic
1165102580 19:33447573-33447595 ATGCCCAGGAGCCAGGCTGCTGG - Intronic
1168139352 19:54374912-54374934 GTACCCAGCATCCACTGTCCTGG + Intergenic
928095483 2:28402282-28402304 AATCCCAGAATCCATTGTGCTGG + Intronic
929046374 2:37794461-37794483 ATGCCCAGGATGCAATCTGAAGG + Intergenic
929215979 2:39413771-39413793 ATGCCCAGGCTCCACCTTGTAGG + Intronic
932740951 2:74290868-74290890 GAGCCCAGGATCCTCTCTGCAGG + Intronic
934857821 2:97739788-97739810 ATGCCCAGGCTCCAATGTCAGGG - Exonic
940308013 2:152247141-152247163 TTGCCTAGAATACACTGTGCAGG - Intergenic
941597055 2:167490605-167490627 ATTCCTAGGATACACTGTGAGGG + Intergenic
943669114 2:190641771-190641793 TCTCCCAGCATCCACTGTGCAGG - Intergenic
945931198 2:215856183-215856205 ATGCCAAAGCTCAACTGTGCAGG + Intergenic
948189197 2:236045190-236045212 ATAGGCAGGAGCCACTGTGCTGG + Intronic
948965976 2:241380888-241380910 ATGCCCTGCCTCCACTGAGCAGG + Intronic
1172436065 20:34929697-34929719 ATGCCCTGGCTTCACTGAGCGGG - Intronic
1172994576 20:39060584-39060606 ATGCCCACGATGTATTGTGCAGG + Intergenic
1175851864 20:62098012-62098034 AAGCCCAGGGTTCAATGTGCTGG + Intergenic
1176198851 20:63850765-63850787 ATCACCAGGACCCACTGTCCTGG - Intergenic
1178263820 21:31124338-31124360 ATCCCCAGGAGCCACTGGGAAGG + Intronic
1181417714 22:22772341-22772363 ATGGCCAGGATCACCTGTGGGGG + Intronic
1181623848 22:24108751-24108773 ATCCTCAGTATCCTCTGTGCAGG + Intronic
1182549313 22:31092461-31092483 AAGCCCAGGATCCACTAGCCGGG + Intronic
1183251998 22:36736968-36736990 AGCCCCAGGATCCAGTGTGTAGG + Intergenic
953629669 3:44602641-44602663 ATCCCCAGAATTCTCTGTGCAGG - Intronic
962091675 3:132250812-132250834 ATGCCCAAGATTCATTGAGCTGG - Intronic
962372595 3:134833313-134833335 CTGCCCAGGATAGAGTGTGCTGG + Intronic
963852697 3:150224148-150224170 ATTCCCAGGAACCACTGGACTGG + Intergenic
965591348 3:170362773-170362795 ACGCCCAGGATGGACTGTGGTGG - Intronic
974541293 4:63240190-63240212 ATGCCAAGGATTTACTGTACGGG + Intergenic
981532453 4:145765423-145765445 AGGCCCAGGATGCAGTATGCTGG - Intronic
986772984 5:10990185-10990207 ATGCCCAGGCTCTGCTGTGAGGG + Intronic
987007892 5:13729500-13729522 ATGTCCAGGATCCATTTTGATGG + Exonic
987847498 5:23305181-23305203 TTGCTCAGGCTCCACTGGGCTGG + Intergenic
988698261 5:33646032-33646054 GTTCCAAGGAACCACTGTGCAGG + Intronic
989264561 5:39458119-39458141 ACGCACATGAGCCACTGTGCCGG - Intronic
992122783 5:73611568-73611590 GTGCCCAGCATCCACAGTACAGG - Intergenic
994127896 5:96190264-96190286 AAGCCCAGCATTCACTTTGCAGG - Intergenic
995057565 5:107777123-107777145 ACGAGCAGGATGCACTGTGCTGG - Intergenic
998162186 5:139819889-139819911 ATGCTGAGGCTCAACTGTGCAGG + Intronic
998592049 5:143488487-143488509 ATGCCCATGATACACTGCCCTGG - Intergenic
1001104369 5:168840563-168840585 GTGGTCAGGATGCACTGTGCTGG - Intronic
1001136685 5:169108381-169108403 ATGCCTGTGATCCATTGTGCTGG - Intronic
1001690031 5:173626007-173626029 ATGCCCAGGGTCCACTGAATGGG - Intergenic
1005132673 6:22528246-22528268 ATGGCCTGGATCCTCAGTGCTGG - Intergenic
1007371323 6:41428339-41428361 AGGCCCAGGGTCCGGTGTGCTGG - Intergenic
1013476143 6:110508961-110508983 AGGCAGAGGATCCACTGAGCTGG + Intergenic
1019064199 6:169282204-169282226 AAGCCCAGCATCCCCGGTGCAGG + Intergenic
1022334141 7:29406710-29406732 GTTCCCAGGAGCCACTGTGTGGG + Intronic
1026491754 7:70869626-70869648 ATTCCCTGCAGCCACTGTGCAGG - Intergenic
1027932188 7:84551796-84551818 TTGCCCAGGATGCAGTATGCAGG - Intergenic
1028056529 7:86252332-86252354 AAGCCCAGGAAGCACAGTGCAGG + Intergenic
1028695453 7:93705621-93705643 ATGCCCAGGTTACATTGTTCTGG - Intronic
1029116377 7:98239660-98239682 GTGACCAGGATCCAATGTGGGGG + Intronic
1030987545 7:116260275-116260297 ATGCAAAGGACCCACTGTGCTGG + Intergenic
1032667043 7:134046964-134046986 CTGGCCAGCATCCAGTGTGCAGG - Intronic
1034038801 7:147854623-147854645 GTGGCTAGGAACCACTGTGCTGG - Intronic
1039159600 8:34602773-34602795 AAGCGCAGGATCCCCTTTGCCGG + Intergenic
1040057666 8:43074483-43074505 TTGCCCAGGATGGACTGTGGTGG - Intronic
1040104662 8:43534878-43534900 ATGCCCAGGTCCCACTGACCAGG - Intergenic
1042655065 8:71086898-71086920 ATTCCCATGATCCTCTGTGCAGG + Intergenic
1042774241 8:72412175-72412197 AAGCCCAGGACCCACTGCACAGG - Intergenic
1048503677 8:135001621-135001643 AGGCCCAGGAGTCACTGGGCTGG - Intergenic
1050077949 9:1884320-1884342 ATGCCCAGGAGCCAGGGTGAGGG + Intergenic
1053421617 9:37983468-37983490 ATGCCCAGGAACCTCTGGGCAGG + Intronic
1056547560 9:87625497-87625519 AGCCCCAGGTTCCACTGTGATGG + Intronic
1057275506 9:93674172-93674194 ATGCCCAGGACCCAAGGTTCAGG - Intronic
1057928162 9:99170960-99170982 ATGCCCAGGGTCAAGTGGGCAGG - Intergenic
1061238801 9:129357551-129357573 ATGCCCATGTGCCACTGTGCAGG + Intergenic
1062093517 9:134690795-134690817 GTGCCCAGGATTCACAGTGGTGG + Intronic
1062182560 9:135198415-135198437 AGGCCCAGGATCCACTTTTAGGG - Intergenic
1186282992 X:8014396-8014418 ATGGGCAGGTCCCACTGTGCTGG - Intergenic
1186575667 X:10762876-10762898 AAACCCATGATCCACTGTGTAGG + Intronic
1187346253 X:18467257-18467279 AAGCCCAGGATCCACAGGACTGG - Intronic
1187746940 X:22419573-22419595 ACCCCCAGGAGCCACTGCGCAGG - Intergenic
1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG + Intergenic
1188245804 X:27834674-27834696 AAGCTCAGAAGCCACTGTGCTGG + Intergenic
1188442715 X:30229185-30229207 ATGCCCAGAAGCCACCGTGCTGG + Intergenic
1188444045 X:30238224-30238246 AGGCCCAGAAGCCACTGTGCTGG + Intergenic
1189203899 X:39221367-39221389 GTGGCCAGGATCCACTGTGGTGG + Intergenic
1190253766 X:48747439-48747461 ATCCCCAGGTTCCAGGGTGCAGG + Intergenic
1191250758 X:58259117-58259139 CTTCCCAGGAGCCCCTGTGCTGG + Intergenic
1191252446 X:58266020-58266042 CTTCCCAGCAGCCACTGTGCAGG - Intergenic
1192207921 X:69108328-69108350 TTCCCCAGGATCCTGTGTGCAGG - Intergenic
1194807247 X:98344757-98344779 ATGCACAGCAGCCCCTGTGCTGG + Intergenic
1196324542 X:114388179-114388201 TTGCCCAGGCTGGACTGTGCTGG + Intergenic
1197616589 X:128698774-128698796 ATTTCAAGGATTCACTGTGCTGG + Intergenic
1198487360 X:137101444-137101466 ATTCCCAGTAGCCACTGTTCAGG + Intergenic
1201142747 Y:11042045-11042067 ATGCCCAGGGCCCACGGTCCTGG + Intergenic