ID: 1147919273

View in Genome Browser
Species Human (GRCh38)
Location 17:43906434-43906456
Sequence TCTCGGAGGCAGAGCTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 404}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147919273_1147919283 27 Left 1147919273 17:43906434-43906456 CCCTCTCAGCTCTGCCTCCGAGA 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1147919283 17:43906484-43906506 GCGAGCGGACCAGCAGTGAAAGG 0: 1
1: 0
2: 1
3: 2
4: 62
1147919273_1147919278 5 Left 1147919273 17:43906434-43906456 CCCTCTCAGCTCTGCCTCCGAGA 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1147919278 17:43906462-43906484 ACATCACCCATAGTGTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1147919273_1147919284 28 Left 1147919273 17:43906434-43906456 CCCTCTCAGCTCTGCCTCCGAGA 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1147919284 17:43906485-43906507 CGAGCGGACCAGCAGTGAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 44
1147919273_1147919281 12 Left 1147919273 17:43906434-43906456 CCCTCTCAGCTCTGCCTCCGAGA 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1147919281 17:43906469-43906491 CCATAGTGTCCGCAGGCGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147919273 Original CRISPR TCTCGGAGGCAGAGCTGAGA GGG (reversed) Intronic
900213221 1:1467598-1467620 TCTGGGAGGCATAGCTGGGATGG + Intronic
900218448 1:1494708-1494730 TCTGGGAGGTACAGCTGGGACGG + Intronic
900220785 1:1508419-1508441 TCTGGGAGGCATAGCTGGGATGG + Intergenic
900225790 1:1533131-1533153 TCTGGGAGGTACAGCTGGGACGG + Intronic
900771531 1:4548550-4548572 TATAGGAGACAGAGCTGAGCTGG - Intergenic
901430315 1:9210044-9210066 TTTGGAAGGCTGAGCTGAGAGGG + Intergenic
902793579 1:18785469-18785491 CTTCAGAGGCAGAGCTGGGATGG + Intergenic
903847196 1:26285528-26285550 TCTCGGAGGCAGCGCTGCAAGGG + Exonic
904021731 1:27471850-27471872 TTTTGGAGGTAGAGCTGATAAGG - Intronic
904065478 1:27746832-27746854 TCTGGGAGGCCGAGGTGGGAGGG + Intronic
905028396 1:34866133-34866155 TCTCGGTGGCCGAGCTGTGGCGG + Exonic
905390521 1:37633344-37633366 TGGCAGAGGCAGAGCTGAGAAGG + Intronic
905419001 1:37826157-37826179 TCTAGAAGGCAGAACTCAGAAGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906735723 1:48125155-48125177 ACTGGGAGGCCGAGCTGGGAGGG + Intergenic
907627435 1:56043816-56043838 TCTGGGAAGCAGAACTGAGAAGG - Intergenic
907870401 1:58437818-58437840 TCTCAGTGGCAGTGCTGAGCAGG + Intronic
910197525 1:84659344-84659366 TCTCTGAGGCGGAGCAGACAGGG + Intronic
912379727 1:109240803-109240825 TCTGACAGGCAGAGCTGGGATGG + Intergenic
913587328 1:120288379-120288401 GGTGGCAGGCAGAGCTGAGATGG + Intergenic
913620857 1:120609990-120610012 GGTGGCAGGCAGAGCTGAGATGG - Intergenic
914569343 1:148900262-148900284 GGTGGCAGGCAGAGCTGAGATGG + Intronic
914603484 1:149229994-149230016 GGTGGCAGGCAGAGCTGAGATGG - Intergenic
915271774 1:154758711-154758733 CCCCAGAGGCTGAGCTGAGAGGG - Intronic
915335398 1:155138038-155138060 ACCAGGAGGCAGAGGTGAGAAGG - Exonic
915390969 1:155543687-155543709 TCTGGGAGGCTGAGGTGGGAGGG + Intronic
915441025 1:155945564-155945586 TCTCCGACCCAGAGCTGTGAGGG - Intergenic
915601253 1:156924402-156924424 TCTGGAAGGCAGAGGTGAGGAGG - Exonic
916804462 1:168244675-168244697 TCTTGGAGACAGATCTCAGAAGG + Exonic
917333005 1:173901780-173901802 TTTCAGAGGCAGAGCAGAGCGGG - Exonic
917379831 1:174393516-174393538 TCTCTGAGGCCAAGCTGAGCTGG - Intronic
917685630 1:177412831-177412853 ACAAGAAGGCAGAGCTGAGAGGG + Intergenic
918462612 1:184792181-184792203 TTTGGGAGGCTGAGGTGAGAGGG - Exonic
920112551 1:203597593-203597615 TCTAGGAGGCTGAGCTGTGAGGG - Intergenic
920881711 1:209886991-209887013 TCCGGGAGGCAGTGCTGTGAAGG - Intergenic
921346223 1:214188172-214188194 TCTCGGAGGCAGTGGAGATAAGG - Intergenic
921900921 1:220449747-220449769 TTCAGGAGGCAGAGCTGGGATGG - Intergenic
922787930 1:228292514-228292536 CCTGGCAGGCAGAGCTGGGAAGG - Exonic
922789041 1:228299873-228299895 TCTGGCAGGCAGGGCTGAGAAGG - Exonic
923659673 1:235947159-235947181 CCTGGGAGGCTGAGGTGAGAGGG + Intergenic
923710351 1:236383759-236383781 TCTGGGAGGCTGAGGTGGGAGGG + Intronic
1063487211 10:6430925-6430947 TCTCGCACGAAGAGCTGAAAGGG + Exonic
1064130652 10:12706663-12706685 TCTGGGAGGCAGAGATTATAGGG + Intronic
1064238142 10:13596593-13596615 TCCAAGAGGCAGAGCTGCGATGG + Intronic
1065009938 10:21411865-21411887 TCTGATAGGCAGAGCTCAGATGG + Intergenic
1068553798 10:58435450-58435472 TCTGGGAAGCCGAGCTGAGGAGG - Intergenic
1071570706 10:86695291-86695313 CCTTGGAGGCAGAGCAGTGATGG - Intronic
1072139673 10:92578317-92578339 TTTGGGAGGCAGAGGTGAGAGGG + Intergenic
1072392295 10:94999760-94999782 TCTCAGAGACAGAGCCTAGAAGG - Intergenic
1072722694 10:97790644-97790666 TTTGGGAGGCTGAGCTGGGAGGG + Intergenic
1072806012 10:98424440-98424462 TCTCAGAGCCTGATCTGAGAAGG - Intronic
1073474790 10:103745809-103745831 TCTCGGAGGCCCAACTCAGAGGG + Intronic
1074921804 10:118021871-118021893 TCTCCGAGGTAGAGCGGAAAAGG - Intronic
1075391878 10:122097953-122097975 TCACCGGGGAAGAGCTGAGATGG + Intronic
1077031929 11:472261-472283 CCTTGGAGGCACAGCTGAGGTGG + Intronic
1078590034 11:12632605-12632627 TCCTGGATGCTGAGCTGAGATGG - Intergenic
1078738609 11:14045325-14045347 TTTGGGAGGCCGAGCCGAGAGGG + Intronic
1079392116 11:20031628-20031650 AGTGGGAAGCAGAGCTGAGAGGG - Intronic
1079851549 11:25541977-25541999 TCTCGATGGCACAGCAGAGATGG + Intergenic
1080323524 11:31043392-31043414 TCCTGAAGGCAGAACTGAGATGG + Intronic
1080575700 11:33597360-33597382 TTCCGGAGGCAGAGGGGAGAAGG + Intronic
1080718214 11:34824412-34824434 TGTGGGAAGTAGAGCTGAGAGGG - Intergenic
1082926498 11:58552954-58552976 GCTAGGGTGCAGAGCTGAGAAGG + Intronic
1083000965 11:59290156-59290178 TATCTGGGGCAGAGCTGACAGGG + Intergenic
1084326210 11:68401621-68401643 CCTTGGGGGCAGAGCTGAGGCGG + Intronic
1084616285 11:70238242-70238264 TTTCGGAGGCTGAGGTGGGAGGG + Intergenic
1085274394 11:75289032-75289054 TCTCGGACTCTGGGCTGAGAAGG + Intronic
1085288807 11:75382491-75382513 TCTGGGAGGCCGAGGTGGGAGGG - Intergenic
1086043972 11:82510989-82511011 TCTCTGGGGCACAGCTCAGAAGG + Intergenic
1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG + Intronic
1087572879 11:99952637-99952659 TTTGGGAGGCTGAGGTGAGAGGG - Intronic
1088016930 11:105072136-105072158 CTTGGGAGGCAGAGCTGAGAGGG - Intronic
1088396391 11:109374610-109374632 TCTACGAGGCAGAGCTGTGAGGG + Intergenic
1088741953 11:112774528-112774550 TCTCAGAAGCAGTGTTGAGATGG + Intergenic
1090207511 11:124894049-124894071 TATGGGATGCAGAGCTCAGAGGG + Intronic
1091655272 12:2341483-2341505 TCTGGGAGGCAGTGCTGTGCGGG + Intronic
1092037931 12:5356603-5356625 TCTGGGGGGCAGAGCAGAGTGGG + Intergenic
1092277400 12:7072097-7072119 TCTGAGAGGAAGAGCTGAGGGGG + Intergenic
1093417736 12:18939747-18939769 TTTCGGAGGCTGAGGTGGGAGGG - Intergenic
1094249114 12:28339156-28339178 TTTCAAAGGCAGAGCTGACAGGG + Intronic
1095487514 12:42700199-42700221 TGTAGGAGGCAGAACTCAGATGG - Intergenic
1095803783 12:46296360-46296382 TCTCAGAGAAAGAGCTGAGGTGG - Intergenic
1097863113 12:64537557-64537579 TTCAGGAGGGAGAGCTGAGATGG - Intergenic
1097984939 12:65772772-65772794 TCTAGAAGTCAGAGCTGAGTGGG - Intergenic
1098135098 12:67393842-67393864 TATGGGAGGCTGAGCTGAGGCGG + Intergenic
1098262901 12:68688994-68689016 TCCGGGAGGCAGAGGTGACACGG + Exonic
1101418690 12:104531245-104531267 TTTGGGAGGCTGAGGTGAGAGGG + Intronic
1101605690 12:106246906-106246928 TCCCACAGGCAGAGCTGAGGTGG + Intronic
1101856288 12:108446112-108446134 TCTGGGAGGCAGAGGTTACACGG - Intergenic
1102153549 12:110705733-110705755 TCTGGGAGGCTGAGGTGGGAGGG + Intergenic
1102222130 12:111201691-111201713 TCTGGCATGCAGGGCTGAGAAGG - Intronic
1102290244 12:111693294-111693316 TTTTGGAGGCCGAGGTGAGAGGG + Intronic
1102807968 12:115798877-115798899 TTTGGGAGGCAGAGATGGGAAGG + Intergenic
1103064320 12:117884392-117884414 TCTCTGATGCAGAGCTGAAAAGG - Intronic
1104589968 12:130076203-130076225 TCTGGAAGACAGAACTGAGACGG + Intergenic
1104804217 12:131574642-131574664 TCACGGTAGCAGAGCTGAGCGGG - Intergenic
1105338441 13:19496783-19496805 TCTCGGAGGAGGAGCCAAGATGG + Intronic
1105397065 13:20046302-20046324 TTTGGGAGGCTGAGGTGAGAGGG + Intronic
1106019396 13:25900113-25900135 GCTGGGAGGCAGAGCTGAGAGGG + Intronic
1106533673 13:30618498-30618520 TCTCGGAGGGCGAGCTCAAATGG + Intronic
1108757119 13:53517029-53517051 TCTTGGAGGCTGAGGTGGGAGGG + Intergenic
1108863280 13:54889682-54889704 TTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1110451096 13:75637365-75637387 TCTGTGAGGCACAGCTGGGAGGG - Intronic
1111117773 13:83803567-83803589 TTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1112353994 13:98659586-98659608 CCTTGAAGGAAGAGCTGAGAAGG + Intergenic
1113449124 13:110393801-110393823 TCTGGGAGGCAGAGGTTACAGGG + Intronic
1113669423 13:112165636-112165658 TCCCGGAGACAGAGCAGAGGTGG + Intergenic
1113787604 13:113010706-113010728 GCTCAGAGGCAGGTCTGAGAGGG - Intronic
1114926996 14:27415336-27415358 TCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1115608296 14:35027513-35027535 TCTGGGAGGCTGAGGTGAGTGGG + Intronic
1115943357 14:38632953-38632975 TCTCTGAGGCACAGCTAAGGTGG + Intergenic
1116367383 14:44084194-44084216 TCGGGTAGGCAGAGCGGAGAGGG + Intergenic
1116438237 14:44919376-44919398 TCCAGGAGGCAGAGCTTGGAGGG + Intergenic
1117105804 14:52395834-52395856 TCCCGGAGGGAGAGGGGAGAGGG - Intergenic
1117598650 14:57350703-57350725 TTTGGGAGGCAGAGGTGAGAGGG + Intergenic
1118391192 14:65297155-65297177 TATAGGAGGCATAGCTGAGGAGG - Intergenic
1118705888 14:68479927-68479949 TTTAGGAGGCTGAGCTGGGAAGG - Intronic
1119762422 14:77161045-77161067 TCTGGGAGGTTGAGCTGAGAGGG - Intronic
1121542731 14:94740812-94740834 TCACGGATGCAGAGCTGGGGAGG - Intergenic
1121621597 14:95353558-95353580 TTTGGGAGGCTGAGATGAGAGGG + Intergenic
1121757404 14:96414580-96414602 CATAGGAGGCAGAGCTCAGAAGG + Intronic
1122062679 14:99147230-99147252 TCTCGGAGGCACACGGGAGAGGG - Intergenic
1122541747 14:102501870-102501892 CCCCGGAAGCAGAGGTGAGATGG + Exonic
1122564459 14:102642590-102642612 TTTGGGAGGCAGAGGTGGGAAGG + Intronic
1123017329 14:105381665-105381687 TCTCACAGGCAGAGCTGTGTGGG + Intronic
1124645474 15:31435024-31435046 TCAAGGAGGCTGAGCTGCGACGG - Intronic
1124665990 15:31593355-31593377 TCTCGGGGTCAGAGCTCTGAGGG + Intronic
1126556848 15:49997884-49997906 TCTAGGACGCAGAGATGAGTAGG + Intronic
1126580529 15:50238578-50238600 GCTGGGAGGCAGAGCTGGGCAGG - Intergenic
1128037032 15:64536262-64536284 TTTGGGAGGCTGAGATGAGAGGG - Intronic
1128908068 15:71486166-71486188 TCTCGGAGTCAGAGTTGAAGTGG + Intronic
1129001909 15:72342373-72342395 TCAGGAAGGCAGGGCTGAGAAGG - Exonic
1129246143 15:74280164-74280186 TGTGGGAGGCAGAGGTGGGATGG - Intronic
1129337239 15:74860019-74860041 TTTGGGAGGCTGAGGTGAGAGGG + Intronic
1130621540 15:85467912-85467934 TGACGGAGGCAGAGTTGAGGAGG + Intronic
1130647483 15:85741631-85741653 TTTAGGAGGCTGAGGTGAGAGGG + Intronic
1132458224 16:35979-36001 GCTCGAGGGCAGAGCTGAGTTGG + Intergenic
1132827748 16:1913538-1913560 GCTCGGAGGGAGAGCTGGGGAGG + Intronic
1132981922 16:2742676-2742698 TCTGGGAGACAGAACTCAGAGGG - Intergenic
1133207723 16:4243505-4243527 CCTCGGAGGTTGAGGTGAGAGGG - Intergenic
1133404175 16:5509795-5509817 TCTTGGAGGCAAAGTTGACAGGG + Intergenic
1134824395 16:17272831-17272853 TCTCCGAGGCAAAGCTCAGGAGG - Intronic
1135336286 16:21604149-21604171 TCTCGAAGGCAGTTCAGAGAAGG - Intronic
1138104493 16:54280441-54280463 TCTGGGAGGAAGAGAAGAGATGG + Intergenic
1138391396 16:56672502-56672524 TTTGGGAGGCAGAGGTGGGAAGG + Intronic
1138442469 16:57043276-57043298 TGTTGGTGACAGAGCTGAGATGG - Intronic
1138476310 16:57272338-57272360 TCTTGAAGCCAGAGCTGAGAGGG + Intronic
1138971052 16:62143403-62143425 TGTCAGTGGCAGAGCTGGGATGG + Intergenic
1139240145 16:65383072-65383094 TTACGGAGGCAGAGCACAGAGGG - Intergenic
1139444897 16:66991562-66991584 TCTGGGTAGCAGAGCTGGGATGG + Intronic
1139508333 16:67410908-67410930 TTTGGGAGGCCGAGCTGAGTGGG - Intronic
1141382202 16:83586497-83586519 TCTGGGAGTCTGAGCCGAGAAGG + Intronic
1142176467 16:88647675-88647697 GCTGGGCGGCAGGGCTGAGATGG + Intronic
1142694546 17:1626593-1626615 TCTCCGGGGCAGATCAGAGAAGG + Intronic
1143184511 17:5002136-5002158 TCTTGGTGGCAGGGCTGAGAGGG + Intronic
1143848846 17:9794330-9794352 TCTCTGATGCAGAGATGAGCAGG - Intronic
1143956003 17:10669659-10669681 TTTCGGAGGCCGAGATGGGAGGG + Intergenic
1146417558 17:32650494-32650516 TCTCTGAGGGAGAGGAGAGAAGG - Intronic
1147126353 17:38371687-38371709 TTTGGGAGGCAGAGGTGAGCAGG - Intronic
1147425379 17:40343674-40343696 ACTCGGTGGCGGAGCTGGGAAGG - Intronic
1147619638 17:41856942-41856964 TCTGGGAGGCAGAGGTTATAGGG + Intronic
1147666463 17:42151796-42151818 CCTCAGAGGCAGAGGTGAAAGGG + Intronic
1147919273 17:43906434-43906456 TCTCGGAGGCAGAGCTGAGAGGG - Intronic
1148166392 17:45486824-45486846 TCAGGGAGGCAGGGCTCAGATGG + Intronic
1148217173 17:45839645-45839667 GCTCTGAGGTAGAGCTGGGATGG - Intergenic
1148462512 17:47846780-47846802 TTCCGGAGGGAGAGCCGAGATGG - Exonic
1148781229 17:50123274-50123296 TCTCTGAAGCAGAGATGGGAAGG + Intronic
1149632753 17:58140492-58140514 TTTGGGAGGCAGAGGTGGGAAGG - Intergenic
1149755901 17:59185470-59185492 TCTCGGTGGCAGATACGAGATGG - Exonic
1150397563 17:64833224-64833246 TCAGGGAGGCAGGGCTCAGATGG + Intergenic
1150689359 17:67351147-67351169 TCTGGGAGGCAGAGATGGGCGGG + Intronic
1150732578 17:67708772-67708794 TCTCGGTGGCAGTGCTGAGCAGG - Intergenic
1151274186 17:73021567-73021589 TTTGGGAGGCAGAGCTGGGCAGG - Intronic
1152024640 17:77801011-77801033 TCTCGGAGACAGCGCTGGGCTGG - Intergenic
1153923141 18:9808831-9808853 TCTGGGAGGCAGAGCCCAGCTGG + Intronic
1154985672 18:21548555-21548577 TTTGGGAGGCCGAGGTGAGAGGG + Intronic
1155021638 18:21902125-21902147 TCTGGGGGGCAGTGCAGAGAAGG + Intergenic
1156790408 18:40965851-40965873 GCTTGGAGGCTGAGATGAGAGGG - Intergenic
1157208070 18:45717415-45717437 TTTTGGAGGCTGAGGTGAGAGGG + Intergenic
1157264454 18:46205970-46205992 TTTGGGAGGCAGAGGTGGGAGGG - Intronic
1157296603 18:46449483-46449505 TCTTGGAGGCAGTGCAGAGTAGG + Intronic
1157459301 18:47872622-47872644 TCCAGGAGGCAGAGCTCAGGTGG - Intronic
1157818429 18:50748200-50748222 TCTCTGAGCCTGAGCTGAAAGGG - Intergenic
1158069334 18:53452218-53452240 TCTCTGAAGCAGAGTTAAGAGGG + Intronic
1158220881 18:55149612-55149634 CCAAAGAGGCAGAGCTGAGAAGG - Intergenic
1158958875 18:62570943-62570965 TTTCCAAGGCAGACCTGAGAAGG - Intronic
1159099083 18:63938413-63938435 TTTGGGAGGCAAAGGTGAGAGGG + Intergenic
1159266256 18:66083859-66083881 TCTGGGAGGCAGAGGTCAGAAGG - Intergenic
1159974435 18:74692773-74692795 TCTCTGGGGGAGAGCTAAGAAGG - Intronic
1160045009 18:75378748-75378770 GCTCGCAGGCCGAGCTCAGAGGG + Intergenic
1160281350 18:77493740-77493762 TGTAGGAGGCAGAGCTCAGGCGG - Intergenic
1160935016 19:1590508-1590530 CTTGGGAGGCTGAGCTGAGAGGG + Intronic
1160963179 19:1733731-1733753 TCTGGGAGCCTGAGTTGAGAAGG - Intergenic
1161414871 19:4140358-4140380 CCTGGGAGGCGGAGTTGAGATGG + Intergenic
1162124478 19:8491891-8491913 TCTAGGAGGCAGAAGTGAAATGG - Intronic
1162732938 19:12729800-12729822 TTTAGGAGGCCGAGGTGAGAGGG + Intergenic
1163233035 19:16016559-16016581 TCTGGGAGGAGGAGGTGAGAGGG + Intergenic
1163741258 19:19014455-19014477 TCTAGGAGGCAGATATAAGAAGG - Intronic
1163796724 19:19342214-19342236 TCACGCAGCCAGACCTGAGACGG - Intronic
1164981861 19:32620098-32620120 TCTGGCAGGCAGAGCTGACTGGG - Intronic
1165051300 19:33143085-33143107 TTTGGGAGGCCGAGGTGAGAGGG + Intronic
1165936068 19:39389807-39389829 TCTGGGAAGCAGGGCTGTGAGGG - Intronic
1166085928 19:40474975-40474997 TTTCGGAGGCCGAGGTGGGAGGG - Intronic
1166102518 19:40579223-40579245 ACTCAGTGGCAGAGCTGAGGTGG - Intronic
1167699550 19:51034483-51034505 GCTGGGGGCCAGAGCTGAGATGG + Intronic
927183914 2:20468472-20468494 CCTCAAAGGCAGAACTGAGAAGG + Intergenic
927515373 2:23668968-23668990 TCACCGAGGCTGAGCTGAGCAGG + Intronic
927517795 2:23682198-23682220 TTTCCGAGGGAGAGGTGAGAAGG - Intronic
927899523 2:26809275-26809297 TTTGGGAGGCAGAGGTAAGAGGG - Intergenic
928767079 2:34660154-34660176 TCTGGGAGGCAGAGTTCAGATGG + Intergenic
929078260 2:38096186-38096208 TCTGGGAGGCTGAGCTCAGAAGG - Intronic
929460434 2:42099135-42099157 GCTCGGAAGCAGAACAGAGATGG - Intergenic
929575797 2:43050917-43050939 TCTCTGTGGTTGAGCTGAGATGG - Intergenic
929783255 2:44971416-44971438 TCTAGGAACAAGAGCTGAGATGG - Intergenic
931395529 2:61885182-61885204 TCTGGGAGGCTGAGGTGGGAGGG - Intronic
931940438 2:67246092-67246114 TCTGGGATGCAGAACTGTGAGGG + Intergenic
933750344 2:85599093-85599115 TCTCGGGGGCACAGTTGAGGTGG + Exonic
935289296 2:101596119-101596141 TTTGGGAGGCTGAGGTGAGAGGG + Intergenic
936438348 2:112528355-112528377 TTTGGGAGGCCGAGGTGAGAGGG + Intronic
937416564 2:121719548-121719570 TTTGGGAGGCTGAGATGAGATGG - Intergenic
938632418 2:133181522-133181544 TCTGGGAGGCTGAGCTGGGCAGG + Intronic
939291626 2:140203504-140203526 TTCAGGAGGCAGAGCTCAGAAGG + Intergenic
940817853 2:158315986-158316008 TCTCAGAGGGAGGGCTGTGAAGG - Intronic
942453268 2:176121780-176121802 TCGCTGAGGCAGGGCTGAGGCGG + Intergenic
944280522 2:197891377-197891399 TCTGGGAGACAGAACTGGGATGG - Intronic
944510209 2:200456965-200456987 TCTTTGTGGGAGAGCTGAGAAGG - Intronic
945081083 2:206086276-206086298 TCTTGGAGGCAGAGCAAAGGGGG + Intronic
946393220 2:219429122-219429144 TCTCAGAGTCAGACCTCAGAAGG + Intergenic
946442212 2:219706389-219706411 TGTAGGAGGCAGAGGTGGGAGGG - Intergenic
946917960 2:224545707-224545729 TCTCTGAGGGAGAGGGGAGAAGG + Intronic
947426265 2:229985630-229985652 TCTGGGCTGCAGAGCAGAGAAGG + Intronic
947814194 2:233024849-233024871 TCTCGGAGGGAGTGCTGTGTGGG + Intergenic
947976497 2:234370886-234370908 TTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1169393708 20:5211779-5211801 TATGGGAGGCTGAGGTGAGAGGG - Intergenic
1169401986 20:5289904-5289926 TTTGGGAGGCCGAGGTGAGAGGG + Intergenic
1169824641 20:9753996-9754018 CCTTGGATGCAGACCTGAGATGG - Intronic
1170710270 20:18784490-18784512 TCTGGGAGTCAGAGATGAGGGGG - Intergenic
1171184485 20:23115248-23115270 TTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1171229861 20:23475602-23475624 TGTGGGACCCAGAGCTGAGAAGG + Intergenic
1172281592 20:33711624-33711646 TTTGGGAGGCTGAGCTGAGATGG + Intronic
1172389594 20:34558189-34558211 TCTCAGAGGATGAGGTGAGAAGG - Intronic
1172593285 20:36132347-36132369 TGACGGAGGCAGAGGTGGGAGGG - Intronic
1172730406 20:37082272-37082294 TCACTGAGGCAGAGCTGGGCTGG + Intronic
1174045422 20:47729529-47729551 TTTTGAAGGCAGAGCTGACAGGG + Intronic
1175400574 20:58697884-58697906 ACTCGAAGGCAGGGCAGAGAGGG - Intronic
1175781779 20:61687364-61687386 ACTCGGAGGCAGCGCTGTGCCGG + Intronic
1175887390 20:62300144-62300166 TTTGGGAGGCCGAGCTGAGAGGG - Intergenic
1177393490 21:20505659-20505681 TTTGGGAGGCTGAGGTGAGAGGG + Intergenic
1178522286 21:33296401-33296423 TCACTGAGGCAGATGTGAGATGG - Exonic
1178690314 21:34744878-34744900 TCTGGGAGGCTGAGGTGGGAGGG - Intergenic
1178898464 21:36580157-36580179 TCTCAGAGGAAGTGCAGAGATGG + Intergenic
1178971216 21:37178850-37178872 CTTGGGAGGCTGAGCTGAGAGGG + Intronic
1179058245 21:37955635-37955657 GATAGGAGGCAGAGCTCAGATGG + Intronic
1179070247 21:38064434-38064456 ACTGGGATGCAGGGCTGAGAGGG - Intronic
1180207567 21:46271267-46271289 TTTGGGAGGCCGAGATGAGAGGG - Intronic
1180219707 21:46350769-46350791 TCTCGGAGGGAGAGCCTGGAAGG - Intronic
1180850442 22:19016646-19016668 TTTGGGAGGCTGAGCTGGGAGGG + Intergenic
1181534335 22:23533958-23533980 TCTCGAGAGCAGAGCTGTGAAGG + Intergenic
1181582334 22:23835180-23835202 CCTTGGAGGCAGGGCTGGGAAGG - Intronic
1182515116 22:30853831-30853853 CCGAGGAGGCAGAGCTGAGATGG - Intronic
1182825970 22:33265145-33265167 TTTCGGAGGCTGAGATGGGAGGG - Intronic
1182973309 22:34598105-34598127 TATAGGTGGCAGAACTGAGATGG + Intergenic
1183053526 22:35285616-35285638 CTTGGGAGGCAGAGGTGAGAGGG + Intronic
1183517248 22:38273754-38273776 TGATGGAGGCAAAGCTGAGAGGG - Intergenic
1184416626 22:44355610-44355632 CCTCAGGGGAAGAGCTGAGAAGG - Intergenic
1185100745 22:48839648-48839670 GCTCAGAGCCAGAGCTGTGAGGG + Intronic
949527198 3:4916531-4916553 TCTCGGAGGAGGAGCCAAGATGG + Intergenic
950218133 3:11174373-11174395 TCTGGGAGTCAGCGCTGAGATGG - Intronic
951419364 3:22466040-22466062 TCTGGAAGGCATAGCTGAGATGG + Intergenic
952457763 3:33490052-33490074 TCTGGGAGGCAGAGTTTACAGGG - Intergenic
952533458 3:34286240-34286262 TCTCAGAGGAAGACCTGACAAGG + Intergenic
952765995 3:36954959-36954981 TCTCTGAGTCAGCCCTGAGAGGG + Intergenic
952953014 3:38539303-38539325 AGTCAGAGGCAGAGCTGGGAAGG - Intronic
953162949 3:40438634-40438656 TTTGGGAGGCTGAGGTGAGATGG + Intergenic
953792332 3:45957837-45957859 ACAGGGAGGCAGAGCTGAGACGG - Intronic
955375926 3:58397347-58397369 TCTGGGAGGCTGAGTTGAAATGG + Intronic
957311530 3:78525827-78525849 TTTCGGAGGCTGAGGTGGGAGGG - Intergenic
959728760 3:109575581-109575603 TATTGGAGGCAGAGGTGAAATGG + Intergenic
960583134 3:119297327-119297349 TCTGGGAGGAAAAGCTGAGCTGG + Intronic
962065073 3:131971137-131971159 TCTAGAAGGCAGAGCTCAGCTGG + Intronic
962501707 3:136000839-136000861 TCTCAGAGGCAGATGTGACAAGG + Intronic
963741279 3:149084506-149084528 TCTGGGAGGCTGAGGTGGGAGGG + Intronic
965371159 3:167863892-167863914 TCTCAGAAGCACAGCTCAGATGG + Intergenic
966490844 3:180527024-180527046 TCTCTGAGCCAGGGCAGAGATGG - Intergenic
966591185 3:181684581-181684603 TCTGGGAAGCTGAGTTGAGAGGG - Intergenic
966843322 3:184106506-184106528 CTGCGGAGGCAGAGCTGACAGGG + Exonic
968923727 4:3536120-3536142 TCCTGGAAGCAGAGCTGAGATGG + Intergenic
969134737 4:5020667-5020689 TCTTGCAGGCAGAGATGAGTTGG + Intergenic
969219032 4:5747323-5747345 TCTCAGAGGCTGAGCCAAGATGG + Intronic
969223898 4:5781730-5781752 TTTGGGAGGCTGAGGTGAGAGGG + Intronic
969864942 4:10069211-10069233 TCTGGGAAGGAAAGCTGAGAAGG - Intergenic
970019797 4:11555231-11555253 TCTGGGATGCAGAGCTCAGAGGG - Intergenic
973148752 4:46861799-46861821 TCTAGGAGGAACAGCTAAGAGGG - Intronic
973821241 4:54663461-54663483 TCTAAGAGGCAAAGCTGAAAGGG - Intronic
974392894 4:61295714-61295736 TTTGGGAGGCAGAGGTGTGAGGG + Intronic
976877270 4:89868649-89868671 ATTTGGAGACAGAGCTGAGAAGG - Intergenic
977095291 4:92734885-92734907 ACTTGGAGGCTGAGTTGAGAGGG - Intronic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
978593718 4:110354482-110354504 CCTGGGAAGCAGAGCTGAGAGGG - Intergenic
980761800 4:137244337-137244359 TTTCGGAGGCTGAGGTGAGATGG + Intergenic
980870387 4:138604618-138604640 TCTCAGAAGCAGAGAGGAGAAGG - Intergenic
981974228 4:150704104-150704126 CCTTGGAGGCTGAGGTGAGAGGG + Intronic
983302476 4:165945010-165945032 TCTGGGAGGCAGTATTGAGAAGG + Intronic
984794342 4:183644532-183644554 TTTGGGAGGCAGAGGTGAGGGGG + Intronic
987169149 5:15235270-15235292 TCTTGGAGGCAGAGAGAAGATGG + Intergenic
988705116 5:33718395-33718417 GATAGGAGGCAGAGCTCAGATGG - Intronic
989434127 5:41391412-41391434 TCTGGGAGCTAGAGCTGAAATGG - Intronic
991011466 5:61887296-61887318 TCTTGGTGGCTAAGCTGAGAGGG + Intergenic
991460891 5:66857075-66857097 TCTGGGAGGGAGGGCAGAGAAGG - Intronic
991907915 5:71530625-71530647 ACTCGGAGGCTGAGGTGTGAGGG - Intronic
991948530 5:71925584-71925606 TATTGGAGGCAAAGCTTAGAAGG + Intergenic
993858758 5:93108335-93108357 TCTCCCAGGCTGTGCTGAGAAGG - Intergenic
995522751 5:113026580-113026602 TTTTGGAGGCAGGGCTGGGAAGG - Intronic
996816504 5:127579577-127579599 CCTGGGAGGCTGAGGTGAGAAGG + Intergenic
997429922 5:133830495-133830517 TCTGGGAGGCTGGGCAGAGATGG - Intergenic
997569609 5:134916044-134916066 TCTGGGAGGCCGAGTTGAGTGGG + Intronic
998007668 5:138667702-138667724 TTTGGGAGGCTGAGGTGAGAGGG - Intronic
1001496056 5:172188320-172188342 TCTCGCAGGCAGGGCTGGGCCGG - Exonic
1002652387 5:180708988-180709010 TTTCTGAGGCAGAGTTGGGATGG - Intergenic
1002827305 6:785181-785203 TTTCGGAAGCAGAACAGAGAAGG - Intergenic
1003232968 6:4271474-4271496 TTTGGGAGGCTGAGGTGAGAGGG + Intergenic
1004539577 6:16537356-16537378 TCTCGGAGGGTGAGCAGAGTTGG - Intronic
1004677643 6:17859358-17859380 TCTGGGAGGCCGAGGTGGGAGGG + Intronic
1004794389 6:19064859-19064881 TTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1006798681 6:36746044-36746066 TCCCTGAGTCAGTGCTGAGATGG - Intronic
1007018651 6:38496398-38496420 TTTGGGAGGCTGAGGTGAGAGGG + Intronic
1007573075 6:42907286-42907308 TCTGGGAGCCTGAGATGAGATGG + Intergenic
1008131081 6:47720611-47720633 TCTGGGAGGCAGGGGAGAGAGGG + Intronic
1008606989 6:53150148-53150170 CTTAGGAGGCAGAGATGAGAAGG + Intergenic
1010255676 6:73754482-73754504 TGTAGGAGGCAGAGGGGAGATGG + Intronic
1010953415 6:82063355-82063377 TCTGGGAGGCTGAGGTGAGTGGG - Intergenic
1011498468 6:87962074-87962096 TTTGGGAGGCTGAGGTGAGAGGG + Intergenic
1013169899 6:107627364-107627386 TCTGTAAGGCAGAGCAGAGATGG - Intronic
1014647653 6:123994372-123994394 TCTCCAAGGCAGAATTGAGAGGG - Intronic
1015204182 6:130616374-130616396 TGTGGGAGGCAGAGCAGAGGAGG - Intergenic
1015535730 6:134265883-134265905 TTTGGGAGGCTGAGCTGGGAGGG - Intronic
1015587003 6:134786621-134786643 TCTGGGAGGCTGAGGTGGGAGGG - Intergenic
1016685592 6:146879120-146879142 TCTCAGAGGAAGCGCTGACAAGG - Intergenic
1016772933 6:147872338-147872360 TTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1017754722 6:157519705-157519727 TTGCAGAGGAAGAGCTGAGAGGG - Intronic
1019226590 6:170516016-170516038 TTTCGGAGGCTGAGGTGAGAGGG + Intergenic
1019412634 7:913084-913106 TCTGGGAGGCCGAGGTGGGAGGG - Intronic
1019509493 7:1410496-1410518 TTTGGGAGGCTGAGGTGAGAAGG + Intergenic
1019594831 7:1853680-1853702 TCTCCCAGGCTGAGCTCAGAAGG + Intronic
1019743323 7:2686288-2686310 TTTGGGAGGCCGAGCTGGGAGGG + Intronic
1019808186 7:3144358-3144380 TCTCGGAGGCAGAGGAGGGTGGG - Intronic
1020087754 7:5320672-5320694 TCTAGGAGGCAGTGCTGTGCTGG - Intronic
1021566770 7:22024024-22024046 TCTCTGGGGCTGAGCTGAGAAGG - Intergenic
1022127607 7:27373265-27373287 TTTAGGATGGAGAGCTGAGAGGG + Intergenic
1022958076 7:35399543-35399565 CATTGGAGGCAGAGCTGGGATGG + Intergenic
1023260452 7:38353465-38353487 TCTCTGAGGTTTAGCTGAGATGG + Intergenic
1023261427 7:38362614-38362636 TCTCTGAGGCTTAGCTGAGATGG + Intergenic
1023817580 7:43962222-43962244 CCTGGGAGGCAGAGCTGTGCAGG - Intergenic
1023832828 7:44050017-44050039 TCCCAGCTGCAGAGCTGAGAAGG + Intronic
1024310802 7:47967101-47967123 GCTCCCAGGCTGAGCTGAGAGGG - Intronic
1025212235 7:57026426-57026448 ACTCGGAGGCTGAGGTGGGAGGG - Intergenic
1025659720 7:63550401-63550423 ACTCGGAGGCTGAGGTGGGAGGG + Intergenic
1026157653 7:67841254-67841276 TTTGGGAGGCTGAGGTGAGAGGG + Intergenic
1026960992 7:74407172-74407194 TTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1027546102 7:79529400-79529422 GGTCGGGTGCAGAGCTGAGAGGG + Intergenic
1028283180 7:88959568-88959590 TATCAGAGGAAGAGCTTAGAAGG - Intronic
1028507106 7:91582762-91582784 ACACGGAGGCAGGGATGAGAAGG + Intergenic
1029253025 7:99250496-99250518 TCTGGGAGGCTGAGGTGGGAGGG + Intergenic
1033532890 7:142283425-142283447 TCTCAGAGGCAGAGCTGGCAAGG + Intergenic
1034475701 7:151280309-151280331 TCACAGAGGCACAGCTCAGAGGG - Intergenic
1034980107 7:155470312-155470334 TCTTGGAGGAAGAGCTGGGTTGG - Intergenic
1035901556 8:3462420-3462442 GCTGGGAGGCAGAGCTCAGGTGG - Intronic
1035935626 8:3834735-3834757 TCTCGGAGGTGGAGCCAAGATGG + Intronic
1037834847 8:22209756-22209778 TCTTGGAGACTGGGCTGAGAAGG - Intronic
1038176825 8:25187832-25187854 TGTCTGAGGCAGAGTTGGGAGGG - Intronic
1038571150 8:28663865-28663887 TCTCTGGGGCAGGGCTGAGGAGG + Intronic
1038606234 8:29007723-29007745 TTTGGGAGGCCGAGGTGAGAGGG + Intronic
1039302425 8:36223681-36223703 TTTGGGAGGCTGAGCTGGGAGGG + Intergenic
1039364689 8:36917456-36917478 CCTAGGAGGCTGAGGTGAGAGGG - Intronic
1039734991 8:40322238-40322260 TGTGGAAGGCAGAGCAGAGATGG + Intergenic
1040834046 8:51712958-51712980 TCTGGAAGGCTGAGCTGAAAGGG + Intronic
1040975745 8:53192800-53192822 TCTCAGAAGAAGAGGTGAGAGGG - Intergenic
1041153738 8:54962567-54962589 CCTGGGTGGCAGAGGTGAGATGG - Intergenic
1041207383 8:55512399-55512421 TGTCTGAGGCAGGGCTGAGGAGG - Intronic
1044435767 8:92161203-92161225 TTTGGGAGGCTGAGGTGAGAAGG + Intergenic
1045344451 8:101281960-101281982 TTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1045471288 8:102514437-102514459 GCTGGGAGGCAGGGCTGGGAGGG + Intergenic
1045891668 8:107165166-107165188 TCTGGGAGGCAGAGGTGGGCGGG - Intergenic
1047175706 8:122538365-122538387 ACTCACAGGCAGAGGTGAGAGGG + Intergenic
1049629705 8:143646906-143646928 TTTGGGAGGCAGAGGTGGGAGGG - Intronic
1049648506 8:143750591-143750613 TTTGGGAGGCTGAGATGAGAGGG + Intergenic
1050068489 9:1786119-1786141 TCTCAGAAGCAGACCTGAGGTGG + Intergenic
1051182351 9:14424692-14424714 ACTCAGAGGCAGAGCTCCGAGGG + Intergenic
1051467052 9:17391280-17391302 TCTTCAAGGCAGAACTGAGAAGG + Intronic
1053799440 9:41755142-41755164 TCCTGGAAGCAGAGCTGAGATGG + Intergenic
1054145775 9:61559855-61559877 TCCTGGAAGCAGAGCTGAGATGG - Intergenic
1054187849 9:61967203-61967225 TCCTGGAAGCAGAGCTGAGATGG + Intergenic
1054465518 9:65490959-65490981 TCCTGGAAGCAGAGCTGAGATGG - Intergenic
1054650666 9:67621378-67621400 TCCTGGAAGCAGAGCTGAGATGG - Intergenic
1057557615 9:96100296-96100318 TGGTGGAGGCAGAGCAGAGAAGG + Intergenic
1059835178 9:118143801-118143823 TCTCAGAGGCAGAACAGAGATGG + Intergenic
1059835697 9:118149710-118149732 TCTGGGAGGCAGGGAGGAGATGG - Intergenic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1060577956 9:124715278-124715300 TTTGGGAGGCTGAGGTGAGAGGG + Intronic
1061168274 9:128937169-128937191 TCAGGGAGGCAGAGGTGGGAGGG + Intronic
1061909201 9:133713902-133713924 CCTGGGAGGCAGCGCTGAGCAGG + Intronic
1061926590 9:133808886-133808908 ACCTGGAGGCAGAGCTGGGAGGG + Intronic
1062267847 9:135695549-135695571 TCCGGGAGGCGGTGCTGAGAGGG - Intronic
1062273605 9:135720693-135720715 TCTGGGACCCTGAGCTGAGAAGG + Intronic
1062396278 9:136354078-136354100 TCCCTGAGGCAGACCTGAGGAGG - Intronic
1185879589 X:3729332-3729354 TCTGGGAGGCCGAGGTGGGAGGG - Intergenic
1186654564 X:11598812-11598834 TCTGGGAGGCTGAGGTGGGAGGG + Intronic
1186791267 X:13001545-13001567 TTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1186916314 X:14225942-14225964 TATGGCAGGCAGAGCTGATAAGG + Intergenic
1187448327 X:19376366-19376388 TCGGGGAGGCAGAGGAGAGAGGG - Intronic
1188330449 X:28864794-28864816 TCTCTGAGGCAGACATGAGATGG + Intronic
1189254993 X:39630982-39631004 TCTTGGAGGCAGAGCTGCAGGGG + Intergenic
1189617339 X:42797135-42797157 TGAAGGAGGCAGAGATGAGAAGG - Intergenic
1192156043 X:68747337-68747359 TCCCAGAGGCAGGGCAGAGAAGG - Intergenic
1193143021 X:78048800-78048822 TCTAGAAGACAGAGCTGATAGGG + Exonic
1195375287 X:104220808-104220830 CCTCAGAGGCTGAGCAGAGAAGG + Intergenic
1195892621 X:109712340-109712362 TTTGGGAGGCAGAGGTGGGAGGG - Intronic
1197795435 X:130292995-130293017 TGTCTGTGGCAGAGCTGGGATGG + Intergenic
1198100074 X:133415463-133415485 AATCAGCGGCAGAGCTGAGAAGG - Exonic
1198722623 X:139639532-139639554 TCTGGGAGGGAAAGATGAGAGGG - Intronic
1200686468 Y:6264039-6264061 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200688008 Y:6274209-6274231 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200691269 Y:6307579-6307601 TCTCAGTGGCAGAGCTGGAAAGG + Intergenic
1200831658 Y:7692043-7692065 TCTCAGTGGCAGAGCTACGAAGG + Intergenic
1200884310 Y:8253084-8253106 TCTCAGAGGGAGAGCTGGGAAGG + Intergenic
1200954411 Y:8929859-8929881 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200992011 Y:9355286-9355308 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200994666 Y:9375566-9375588 TCTCAGTGGGAGAGCTGGGAAGG - Intronic
1200997329 Y:9395912-9395934 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200999843 Y:9464449-9464471 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201002502 Y:9484758-9484780 TCTCAGTGGGAGAGCTGGGAAGG - Intronic
1201005161 Y:9505045-9505067 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201007820 Y:9525372-9525394 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201010436 Y:9545562-9545584 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201044003 Y:9867137-9867159 TCTCAGTGGCAGAGCTGGAAAGG - Intergenic
1201047259 Y:9900493-9900515 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1201060206 Y:10037746-10037768 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1202111485 Y:21426628-21426650 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1202115256 Y:21465642-21465664 TCTCAGTGGCAGAGCTGGGAAGG - Intergenic
1202116959 Y:21477509-21477531 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1202232537 Y:22671248-22671270 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1202272941 Y:23088013-23088035 TCTCGGAGGCACAACAGAGTGGG - Intergenic
1202293085 Y:23332669-23332691 TCTCGGAGGCACAACAGAGTGGG + Intergenic
1202310619 Y:23524910-23524932 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1202425938 Y:24721757-24721779 TCTCGGAGGCACAACAGAGTGGG - Intergenic
1202444851 Y:24948329-24948351 TCTCGGAGGCACAACAGAGTGGG + Intergenic
1202560183 Y:26145684-26145706 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic