ID: 1147920890

View in Genome Browser
Species Human (GRCh38)
Location 17:43916318-43916340
Sequence TTGGGAGGGGCCCCAAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147920882_1147920890 -7 Left 1147920882 17:43916302-43916324 CCCAGGCCTATCTCCTTTGGGAG No data
Right 1147920890 17:43916318-43916340 TTGGGAGGGGCCCCAAACTTGGG No data
1147920883_1147920890 -8 Left 1147920883 17:43916303-43916325 CCAGGCCTATCTCCTTTGGGAGG No data
Right 1147920890 17:43916318-43916340 TTGGGAGGGGCCCCAAACTTGGG No data
1147920877_1147920890 13 Left 1147920877 17:43916282-43916304 CCCAAGGATGTGAGGAGAGACCC No data
Right 1147920890 17:43916318-43916340 TTGGGAGGGGCCCCAAACTTGGG No data
1147920878_1147920890 12 Left 1147920878 17:43916283-43916305 CCAAGGATGTGAGGAGAGACCCA No data
Right 1147920890 17:43916318-43916340 TTGGGAGGGGCCCCAAACTTGGG No data
1147920875_1147920890 15 Left 1147920875 17:43916280-43916302 CCCCCAAGGATGTGAGGAGAGAC No data
Right 1147920890 17:43916318-43916340 TTGGGAGGGGCCCCAAACTTGGG No data
1147920876_1147920890 14 Left 1147920876 17:43916281-43916303 CCCCAAGGATGTGAGGAGAGACC No data
Right 1147920890 17:43916318-43916340 TTGGGAGGGGCCCCAAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147920890 Original CRISPR TTGGGAGGGGCCCCAAACTT GGG Intergenic
No off target data available for this crispr