ID: 1147922003

View in Genome Browser
Species Human (GRCh38)
Location 17:43923426-43923448
Sequence GCTTGATCCTGACCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147921997_1147922003 23 Left 1147921997 17:43923380-43923402 CCAGTCCAAAGGTTGAACTGTAA No data
Right 1147922003 17:43923426-43923448 GCTTGATCCTGACCTGGTGTTGG No data
1147921996_1147922003 24 Left 1147921996 17:43923379-43923401 CCCAGTCCAAAGGTTGAACTGTA No data
Right 1147922003 17:43923426-43923448 GCTTGATCCTGACCTGGTGTTGG No data
1147921998_1147922003 18 Left 1147921998 17:43923385-43923407 CCAAAGGTTGAACTGTAATGCTG No data
Right 1147922003 17:43923426-43923448 GCTTGATCCTGACCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147922003 Original CRISPR GCTTGATCCTGACCTGGTGT TGG Intergenic
No off target data available for this crispr