ID: 1147922517

View in Genome Browser
Species Human (GRCh38)
Location 17:43926819-43926841
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147922514_1147922517 14 Left 1147922514 17:43926782-43926804 CCTGTTCTTGGGCGAAACAATAA No data
Right 1147922517 17:43926819-43926841 GAATCCTTACTGTCTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147922517 Original CRISPR GAATCCTTACTGTCTAGAGG TGG Intergenic
No off target data available for this crispr