ID: 1147923124

View in Genome Browser
Species Human (GRCh38)
Location 17:43930921-43930943
Sequence CTGTCAATCAGCTGCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147923119_1147923124 3 Left 1147923119 17:43930895-43930917 CCATCACTCCCTGCTTGCTCTCT No data
Right 1147923124 17:43930921-43930943 CTGTCAATCAGCTGCTACCAGGG No data
1147923120_1147923124 -5 Left 1147923120 17:43930903-43930925 CCCTGCTTGCTCTCTCCTCTGTC No data
Right 1147923124 17:43930921-43930943 CTGTCAATCAGCTGCTACCAGGG No data
1147923118_1147923124 12 Left 1147923118 17:43930886-43930908 CCAAAATTTCCATCACTCCCTGC No data
Right 1147923124 17:43930921-43930943 CTGTCAATCAGCTGCTACCAGGG No data
1147923121_1147923124 -6 Left 1147923121 17:43930904-43930926 CCTGCTTGCTCTCTCCTCTGTCA No data
Right 1147923124 17:43930921-43930943 CTGTCAATCAGCTGCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147923124 Original CRISPR CTGTCAATCAGCTGCTACCA GGG Intergenic
No off target data available for this crispr