ID: 1147924112

View in Genome Browser
Species Human (GRCh38)
Location 17:43936126-43936148
Sequence CCCCCACCTTCTCTCCGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147924109_1147924112 -10 Left 1147924109 17:43936113-43936135 CCATGTGCTTCCACCCCCACCTT No data
Right 1147924112 17:43936126-43936148 CCCCCACCTTCTCTCCGTTCCGG No data
1147924105_1147924112 28 Left 1147924105 17:43936075-43936097 CCGGCAGGGACTGTGACCTGGTC No data
Right 1147924112 17:43936126-43936148 CCCCCACCTTCTCTCCGTTCCGG No data
1147924108_1147924112 -9 Left 1147924108 17:43936112-43936134 CCCATGTGCTTCCACCCCCACCT No data
Right 1147924112 17:43936126-43936148 CCCCCACCTTCTCTCCGTTCCGG No data
1147924102_1147924112 30 Left 1147924102 17:43936073-43936095 CCCCGGCAGGGACTGTGACCTGG No data
Right 1147924112 17:43936126-43936148 CCCCCACCTTCTCTCCGTTCCGG No data
1147924107_1147924112 12 Left 1147924107 17:43936091-43936113 CCTGGTCAGAACAGCTGGTAGCC No data
Right 1147924112 17:43936126-43936148 CCCCCACCTTCTCTCCGTTCCGG No data
1147924104_1147924112 29 Left 1147924104 17:43936074-43936096 CCCGGCAGGGACTGTGACCTGGT No data
Right 1147924112 17:43936126-43936148 CCCCCACCTTCTCTCCGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147924112 Original CRISPR CCCCCACCTTCTCTCCGTTC CGG Intergenic
No off target data available for this crispr