ID: 1147924676

View in Genome Browser
Species Human (GRCh38)
Location 17:43939021-43939043
Sequence CTCTCACAGCAGAAACTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147924676_1147924683 20 Left 1147924676 17:43939021-43939043 CCCTGTAGTTTCTGCTGTGAGAG 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1147924683 17:43939064-43939086 GGGTCCTCCCCTGCCTCCCCTGG 0: 1
1: 0
2: 11
3: 62
4: 597
1147924676_1147924678 -3 Left 1147924676 17:43939021-43939043 CCCTGTAGTTTCTGCTGTGAGAG 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1147924678 17:43939041-43939063 GAGAAAAAGACCTCAGCTGTTGG 0: 1
1: 0
2: 2
3: 22
4: 244
1147924676_1147924681 0 Left 1147924676 17:43939021-43939043 CCCTGTAGTTTCTGCTGTGAGAG 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1147924681 17:43939044-43939066 AAAAAGACCTCAGCTGTTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 212
1147924676_1147924679 -2 Left 1147924676 17:43939021-43939043 CCCTGTAGTTTCTGCTGTGAGAG 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1147924679 17:43939042-43939064 AGAAAAAGACCTCAGCTGTTGGG 0: 1
1: 0
2: 4
3: 30
4: 264
1147924676_1147924680 -1 Left 1147924676 17:43939021-43939043 CCCTGTAGTTTCTGCTGTGAGAG 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1147924680 17:43939043-43939065 GAAAAAGACCTCAGCTGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147924676 Original CRISPR CTCTCACAGCAGAAACTACA GGG (reversed) Intergenic
901039128 1:6353838-6353860 CTCTGACCCCAGAAACTTCAAGG + Intronic
903908268 1:26702157-26702179 CTCTCTCAGCAAAACTTACAGGG - Intronic
904483513 1:30808607-30808629 ATCACACAGCAGAAACTGGAAGG + Intergenic
906683914 1:47750393-47750415 CTGTCAGAGCAGAAGCTGCAAGG - Intergenic
908033120 1:60022410-60022432 CTTTCAAAGCAGAAAGTACCAGG + Intronic
909750998 1:79160576-79160598 CTAGCACAGCTGAAACTTCAAGG - Intergenic
910752509 1:90648844-90648866 TTCTTGCAACAGAAACTACATGG + Intergenic
911694888 1:100878920-100878942 CTCTCACAGTACAAATCACAAGG + Intronic
913990524 1:143607680-143607702 GTCACACAGCAGAAGCCACATGG - Intergenic
914892418 1:151637970-151637992 CTCTCTCAGCAAAAACCACTGGG - Intronic
915509456 1:156378518-156378540 CTCTCACAGCAGAATCCAAATGG - Intronic
916048572 1:161019101-161019123 CTCACACAGAAGAAACTTCTGGG + Intronic
917337873 1:173943847-173943869 CTTTCAAATCAGAAAATACAAGG - Intronic
919666843 1:200300642-200300664 AGCTCACAGCAGACACTAAATGG + Intergenic
919667230 1:200303804-200303826 AGCTCACAGCAGACACTAAATGG + Intergenic
920532756 1:206716176-206716198 CTCACACAGCTGAAGATACAAGG - Intronic
921036978 1:211389414-211389436 CTATCACAGCAGAAACTCAGAGG - Intergenic
923366781 1:233269323-233269345 AGCCCACAGCAGAAACTAGAAGG + Intronic
1062792846 10:320803-320825 CTCACAGAGCAGAAGCGACATGG + Intronic
1063869528 10:10402800-10402822 ATCTCACAACAGAACATACAAGG - Intergenic
1064855573 10:19764044-19764066 ATCTCACAGAAGAAACAATAAGG - Intronic
1066144493 10:32542054-32542076 CTCACAGAGCAGAAACAAAAGGG - Intronic
1066498070 10:35961792-35961814 CTTTAACAGTAGAAACTACGTGG + Intergenic
1069476759 10:68740836-68740858 GTATCACAGCTGAACCTACAAGG - Intronic
1070580368 10:77714411-77714433 CTCTCAGAGCTCAAACTAGAAGG + Intergenic
1071515932 10:86297445-86297467 CTCACACATCAGAAAATAAACGG + Intronic
1073118446 10:101106838-101106860 CTTCCCCAGGAGAAACTACAAGG - Intronic
1075547872 10:123369016-123369038 CTGTCCCAGCAGACATTACAAGG + Intergenic
1075766267 10:124895399-124895421 CTCTGAAAGCAGAAAAGACAGGG - Intergenic
1077960621 11:7073082-7073104 CCCACACTGCAGAAACCACATGG - Intergenic
1078043628 11:7892909-7892931 CTCTCACGGCTGAAAGTCCAGGG - Intergenic
1078324056 11:10364944-10364966 CTTTCACTTCAGAAATTACAAGG - Intronic
1080637770 11:34138784-34138806 GCCTCACAGCAGGAACTCCAGGG - Intronic
1080870275 11:36230569-36230591 GTCTCAGAGGAGAAACTACTGGG - Exonic
1081180280 11:39976652-39976674 CTATCACAGCCGGAACAACATGG + Intergenic
1083695634 11:64440482-64440504 CTTTCAGAGCAGAACATACAAGG + Intergenic
1086599881 11:88620025-88620047 CTGTCACAGCAGAAAAAATATGG - Intronic
1086734013 11:90283473-90283495 CTTTCTCAGCAGAAATGACAGGG - Intergenic
1086861874 11:91933975-91933997 CTCTCACAACATAAATTCCAGGG - Intergenic
1086952742 11:92907806-92907828 AACTCACAGCAGCAATTACAAGG - Intergenic
1087416667 11:97864942-97864964 CTCTCAATGCAGAATCTACAGGG + Intergenic
1087574424 11:99972471-99972493 CTCTCCCAGCTGAAAGTACTAGG + Intronic
1089406094 11:118198749-118198771 CTTTAAAAGCAGAAAATACAAGG - Intronic
1089710486 11:120311049-120311071 CTCTCCCAGGGGAAAGTACAAGG + Intronic
1091857870 12:3753449-3753471 CTCTGGGAGCAGAAACTAAAGGG + Intronic
1092487206 12:8913308-8913330 CTCTCAAAGCAAAATCTAAATGG + Intergenic
1095592089 12:43914999-43915021 CTCTCACAGTATAAGCTTCAGGG - Intronic
1099275778 12:80574699-80574721 CAATAACAGCAGAAACTACAGGG - Intronic
1100204484 12:92333287-92333309 CCCTCATAGCAGAAGCTACTTGG - Intergenic
1101242766 12:102854787-102854809 ATAACACAGCAGGAACTACAGGG + Intronic
1101817734 12:108158642-108158664 CTCTCACAGCAGAATAAACAGGG + Intronic
1102972968 12:117185552-117185574 CCTTCACAGCAGAAAATAAAAGG + Intronic
1104815715 12:131644414-131644436 CTCTCACACAAGAAACTCCAAGG - Intergenic
1105063321 12:133173491-133173513 CATTCACAGCAGAAAGTAAAAGG - Intronic
1106300549 13:28460414-28460436 CTCTCACAGATCAAACAACAGGG + Intronic
1106950985 13:34883614-34883636 CTCTCACAGCAACAGCTGCAGGG - Intergenic
1109683782 13:65786306-65786328 CTCTCACAGAACAAATCACATGG - Intergenic
1111507598 13:89214611-89214633 CTCTCACAGCAGAGACCATGTGG - Intergenic
1111695112 13:91613630-91613652 ATTTCACAGAAAAAACTACAAGG + Intronic
1112754631 13:102617556-102617578 CTGTCACATCAGAAACTAGTAGG - Intronic
1114168136 14:20242994-20243016 ATTTCCCAGCAGAAAGTACATGG - Exonic
1116324376 14:43513268-43513290 CTCTCACAGCCAAAAGAACAAGG + Intergenic
1116764199 14:49050785-49050807 CTCTCAAAGCAGAAACTGTAAGG + Intergenic
1118265427 14:64289969-64289991 CTCACAAAGCAGCAACTAGAAGG + Intronic
1118296486 14:64574739-64574761 CTCTCAAAGGAGACATTACAAGG - Intronic
1122082930 14:99279149-99279171 CTCTCACTGCAGCAGCCACAGGG + Intergenic
1124052607 15:26211879-26211901 CTCTTCCAGTAGAAACTATAGGG + Intergenic
1124461984 15:29900427-29900449 GTGTCACAGCAGAAGCTACTAGG + Intronic
1124852675 15:33355953-33355975 CTCTCACAGTATCTACTACAGGG - Intronic
1125557022 15:40594453-40594475 CTCCCACCGCAGGAACTTCAGGG - Intronic
1129182107 15:73884142-73884164 TTCTCACAGGAAGAACTACAAGG + Exonic
1131155112 15:90070070-90070092 CTCTCACGGTAGACACTATAGGG + Intronic
1131384162 15:91989079-91989101 CTTTTCCTGCAGAAACTACAGGG + Intronic
1132853530 16:2035054-2035076 CCGTCACACCAGAAACTCCAGGG - Intronic
1133898346 16:9950173-9950195 CTCTGACAGCAGCAAGGACATGG - Intronic
1134512362 16:14858837-14858859 CTCTGAAAGCAGAGACGACAAGG + Intronic
1135113619 16:19708795-19708817 CTCTCACTCTAGAAACTGCAGGG - Intronic
1136193305 16:28632084-28632106 CTATCACAGCATAAAGTAGAGGG - Intergenic
1138933998 16:61696660-61696682 CTATCACAGTAGCAAATACATGG + Intronic
1141395239 16:83698734-83698756 CTCTAACAGAAGACAATACAGGG - Intronic
1142102989 16:88285452-88285474 CTGTCACAGCAGAATCTTCCAGG + Intergenic
1143357251 17:6339497-6339519 ACCTCAGAGCAGAAACCACATGG + Intergenic
1145836107 17:27955415-27955437 CTCTCAGAGCAGGAACTGTAAGG - Intergenic
1145867454 17:28250257-28250279 CTCCCACAGCAGGAACTCCAGGG + Intergenic
1147924676 17:43939021-43939043 CTCTCACAGCAGAAACTACAGGG - Intergenic
1149575492 17:57708710-57708732 CTGTCACAGAAGGAAGTACAGGG - Intergenic
1203166172 17_GL000205v2_random:97812-97834 CCATCACAACAAAAACTACATGG - Intergenic
1155330137 18:24707376-24707398 CTGTCACAGAGGAAAATACAGGG - Intergenic
1155799243 18:30080627-30080649 ATTTCTCAGCAGAAACTACAAGG - Intergenic
1156234831 18:35192385-35192407 CTCTCACAGCAGTTACAAAATGG - Intergenic
1156977571 18:43242301-43242323 AGCTGACAGGAGAAACTACAGGG - Intergenic
1157393078 18:47319144-47319166 CACTCACAGCAGGAACTGCTAGG - Intergenic
1157727052 18:49972756-49972778 CTCTCCCAAGAGCAACTACAAGG + Intronic
1158108664 18:53915028-53915050 CTATCACAACAAAAACAACATGG - Intergenic
1158954512 18:62524951-62524973 CCCTCAGAGCAGAAGCCACAAGG - Intronic
1163406351 19:17125547-17125569 GTCTCACAGCAAACCCTACAGGG - Intronic
1163646409 19:18491970-18491992 CTCTCAAAACAGAATCTAAAGGG - Intronic
1164797978 19:31051204-31051226 CTCTCACAGAAGAAACTGTAAGG - Intergenic
1165025021 19:32954294-32954316 CTCTAAAAACAGAAACTAGAAGG - Intronic
925038477 2:710690-710712 CTCACACAGCAGAAGGGACAGGG - Intergenic
925613704 2:5725319-5725341 CCCTCATAGCTGGAACTACAGGG + Intergenic
926623622 2:15070878-15070900 ATCTCACAGCAGCACCTACATGG + Intergenic
929665348 2:43829656-43829678 CTCTAACTGCAGAAACCCCAGGG + Intronic
929873659 2:45778370-45778392 CTCCCAGAGCATAAACTCCACGG - Intronic
933514333 2:83281380-83281402 CTCTCACATCAGAAGCTTCACGG + Intergenic
936661312 2:114547137-114547159 ATCTCAAAGCAGCAACTGCAGGG - Intronic
937038515 2:118802597-118802619 CTAGGACAGCAGAAACTAGAGGG - Intergenic
937161864 2:119771126-119771148 CTCTCACAGGAGAGACCAGAAGG + Intronic
937483508 2:122289380-122289402 CTCCCAAAGCAGAAAATAAAAGG - Intergenic
937748542 2:125445590-125445612 TTTAAACAGCAGAAACTACAAGG + Intergenic
938027312 2:127961261-127961283 CTCTAGCAGCTGAGACTACAGGG + Intronic
940503441 2:154523594-154523616 CTCACACAGCAGAAATTCAAAGG - Intergenic
941058835 2:160821740-160821762 CTTTCAAAGCAGAAACCACCAGG - Intergenic
942121125 2:172778545-172778567 TTTTCACACCAGCAACTACAAGG - Intronic
942217498 2:173736592-173736614 CTCTTAAAGCAGAATTTACAAGG - Intergenic
942391903 2:175503416-175503438 ATCTCCCAGCAGCAGCTACATGG - Intergenic
943459988 2:188160704-188160726 TTCTCACAGTTGAATCTACAAGG - Intergenic
945200397 2:207275332-207275354 TTCTCCCAGCAGAAACTGAAGGG + Intergenic
945516298 2:210766885-210766907 CCATCACAAAAGAAACTACAGGG - Intergenic
946009654 2:216554570-216554592 CGCTCACAGTAGAAGCTCCATGG + Intronic
948778046 2:240299997-240300019 CTCCCACTTCAGAAATTACAGGG - Intergenic
1169376048 20:5067316-5067338 TTCCCACTGCAGAAACCACACGG - Intergenic
1169774850 20:9241282-9241304 CTCTGACAGCAGGAAGTACAAGG - Intronic
1171332930 20:24357322-24357344 CTCCCACAGCAGAACCTGCCTGG + Intergenic
1171448690 20:25221768-25221790 TTCTCTCAGAAGAAACTGCAAGG - Intronic
1171509985 20:25674367-25674389 CTCACAGAGCAGAAAATAGAAGG + Exonic
1172831135 20:37835925-37835947 CTCTCCCAAGAAAAACTACAAGG - Intronic
1174899193 20:54480629-54480651 CTCTCACAGCAAAGAATTCAGGG - Intronic
1178270561 21:31185888-31185910 CTTTCACACCAGAAACCAGAAGG + Intronic
1179029394 21:37707240-37707262 CTATCACAGCACTAACTGCAAGG + Intronic
1179830395 21:43992846-43992868 CTCACACAGCTGTAATTACATGG + Intergenic
1180021135 21:45127898-45127920 CACACAGAGCAGAAACTAGATGG + Intronic
1180048362 21:45320072-45320094 CTCCCACAGCAGAGCCTCCAAGG - Intergenic
1180990742 22:19934232-19934254 CTCTAAAAGGAGAAACTGCAGGG + Intronic
1181002380 22:19993952-19993974 CTCTCACAGGACAAACTGCTGGG + Intronic
1182348478 22:29684000-29684022 CTCTATGAGCAGAAACTGCAGGG - Intronic
1183269103 22:36849685-36849707 CTCTCCCAGCTAAAACTACTGGG - Intergenic
950713669 3:14832222-14832244 AGCTCCCAGCAGAAAGTACAAGG - Intronic
952339111 3:32430535-32430557 TGCACACAGCAGAGACTACATGG - Intronic
953403981 3:42651398-42651420 CCCTCACAGCATAAACATCATGG - Intergenic
953841673 3:46394678-46394700 CTCACACAGGAGAAATTACAAGG + Intergenic
953906850 3:46872647-46872669 GTCTCACAGCAGCAGCTGCAGGG + Intronic
954786617 3:53098133-53098155 CTTTCACAGTAAAAACGACACGG - Intronic
956019619 3:64920315-64920337 GTCTCCCAGCAAAAACTAAAAGG - Intergenic
956665190 3:71635704-71635726 ATCTCACAACAAAAACTACAGGG - Intergenic
957935627 3:86937782-86937804 CTGTCACTGCAGAAACTTCATGG + Intergenic
958882014 3:99682776-99682798 CTCTCACATCAGAAATTCAATGG + Intronic
961358885 3:126355569-126355591 TTCCCACAGTAGAAACTGCAGGG - Intronic
962819495 3:139034320-139034342 CCCTCACAGCATAAAATAAAGGG - Intronic
963269912 3:143276198-143276220 CTCTAACAGTAGTAACTAGATGG - Intronic
964222492 3:154363485-154363507 CTCTCATAGCAAAAATGACAGGG + Intronic
964700695 3:159562728-159562750 CTCTCCCAGAAGCAACCACATGG + Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
969953030 4:10858800-10858822 CTCTCATAGCAGAAAGTGGAAGG - Intergenic
970424696 4:15935254-15935276 CTCTGACAGCTGAGTCTACAGGG - Intergenic
973227348 4:47801673-47801695 CTGTCACAGCAGAAAGCAGAGGG + Intronic
975046676 4:69813599-69813621 CTCTCACAGCAACCACCACAGGG + Intronic
980373904 4:131917323-131917345 TTATCACAGCAAAAACTACAGGG + Intergenic
988051886 5:26041752-26041774 GTCTCACAGCAGACCCTACCAGG - Intergenic
989028020 5:37088698-37088720 CTCTCAGAGCAGCCACCACAGGG + Intergenic
989604407 5:43230182-43230204 CTCTCACATCATAATATACAAGG + Intronic
990221623 5:53597071-53597093 CTATCCCAGCAGACACCACATGG - Intronic
999046889 5:148479098-148479120 CTCTCAGAGCACAAACCACGAGG - Intronic
1000252826 5:159511409-159511431 CTTTCACAGCAGAAAGTAGAAGG - Intergenic
1000352708 5:160364746-160364768 CCCTCAGAGCAGAAACAGCAAGG - Intronic
1000702967 5:164475938-164475960 CTCTCACACCTGAAACCACAAGG - Intergenic
1003254615 6:4464012-4464034 CCTTCACTGCAGAAACCACAAGG + Intergenic
1004358268 6:14948823-14948845 CACCCACAGCAGAATCTTCAAGG + Intergenic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1011536894 6:88385520-88385542 CTTTTAAAGCAGAAGCTACAAGG + Intergenic
1013108051 6:107042788-107042810 CTCCCAGTGCAGAGACTACATGG - Intronic
1013194990 6:107837198-107837220 CTCTCAATGCAGATCCTACAAGG - Intergenic
1015867417 6:137741146-137741168 ATATCCCAGCAGGAACTACACGG + Intergenic
1019096838 6:169588652-169588674 CCCTTACAGCAGCAACTGCACGG - Intronic
1020749689 7:12124540-12124562 TTCTCACTGCAGGAACTCCAGGG - Intergenic
1022151822 7:27616100-27616122 CTCTCACGGCAGAAAGTGAAGGG + Intronic
1023988988 7:45116940-45116962 CTCTTCCAGCAGAAACAAGAGGG - Intergenic
1024540858 7:50474053-50474075 GTCTCACAGCAGGACCAACAGGG + Intronic
1025026231 7:55518509-55518531 CTCTCACAGCCAAAACAGCAGGG + Intronic
1027427894 7:78080539-78080561 CTCCCACAACAGAAACCTCATGG + Intronic
1028155576 7:87425470-87425492 CTATTACTGCAGAAATTACAAGG - Intronic
1029741769 7:102495142-102495164 CTCTCACAGCAGCCAGGACACGG + Intronic
1029759760 7:102594311-102594333 CTCTCACAGCAGCCAGGACACGG + Intronic
1029777122 7:102690221-102690243 CTCTCACAGCAGCCAGGACACGG + Intergenic
1032539888 7:132694231-132694253 GTGTCACAGCGGAAGCTACAGGG - Intronic
1038864260 8:31422392-31422414 CTCTGACTGCAGAACATACAAGG - Intergenic
1040620527 8:49086817-49086839 TTCTAACAGCAATAACTACATGG - Intergenic
1040676221 8:49753860-49753882 TTGTCACAGCAAAAACTTCATGG + Intergenic
1042839690 8:73111271-73111293 GTCTCCCAGGAGCAACTACATGG + Intronic
1043658638 8:82706074-82706096 CTTTGACGGCAGAAACTCCAAGG - Intergenic
1045356808 8:101396653-101396675 CTGTAACAGCAGAAAGGACAGGG + Intergenic
1045854387 8:106747058-106747080 TTCAGAAAGCAGAAACTACAGGG + Intronic
1047882823 8:129215393-129215415 CTCTTGCAGCATAAACTAGAGGG + Intergenic
1052811553 9:33065306-33065328 CACTCAAACCAGAAACTAAAGGG + Intronic
1053345980 9:37378538-37378560 TTCTCACGGCATAAACAACACGG + Intergenic
1054926907 9:70598656-70598678 CTCTGACATCAGAATCTATAAGG + Exonic
1055166957 9:73208526-73208548 CTCTCACTGCAGAGATGACAAGG + Intergenic
1055969166 9:81894551-81894573 CTCTCAGAGCAGAAAGTGGAGGG - Intergenic
1056021462 9:82442166-82442188 CTCTAACAGCAGAAATTATGGGG - Intergenic
1056896128 9:90552410-90552432 CTTTCACAACAGAAATCACATGG - Intergenic
1058284030 9:103153494-103153516 CTCCCACAGCAGATACCAAAGGG - Intergenic
1059214873 9:112552151-112552173 CTCTCACAAATAAAACTACAGGG - Intronic
1185545663 X:941831-941853 CTCTCACTGCAGAGAGCACAGGG + Intergenic
1186471577 X:9826079-9826101 CTCTCACGGTAGCAACTCCATGG + Intronic
1186520167 X:10199231-10199253 ATCACACAACAGAAACCACAGGG + Intronic
1187322734 X:18255385-18255407 CTCTTTCAGCAGAGATTACAAGG + Intronic
1187445240 X:19355394-19355416 TTCTCACAGATGAAAATACAAGG - Exonic
1187558915 X:20381190-20381212 CTATCACAGAATAAACTTCAGGG - Intergenic
1187805179 X:23111704-23111726 AACTCAAAGCAGAAGCTACATGG - Intergenic
1189239505 X:39514798-39514820 CACTCACAGCACAAACAGCAGGG - Intergenic
1189865349 X:45321809-45321831 TTCTCACAGAAGAAACATCATGG + Intergenic
1190067004 X:47248276-47248298 CACACACAGCAGAAGGTACAGGG - Exonic
1192397172 X:70794245-70794267 CTTTCACAGCAGAAAACACTAGG + Intronic
1193622420 X:83772216-83772238 GTCTCACAGCAGATACTAAGGGG - Intergenic
1197938915 X:131768152-131768174 CTCACTCAGCAGATACTTCACGG + Intergenic
1198006024 X:132493449-132493471 TTCTTACAGAAGAAACTATAAGG + Intergenic
1198021962 X:132667706-132667728 CTGTCACACCAAAAACCACAGGG - Intronic
1198266410 X:135013244-135013266 CTCTCAGAGGGGAAATTACATGG - Intergenic
1198688165 X:139250055-139250077 CTCTCATAGCAGAAGGTAAAGGG + Intergenic
1199001666 X:142645874-142645896 CTCTAACATAAGAGACTACATGG + Intergenic
1199083512 X:143604237-143604259 CTCTGTCAACAGAAACTCCATGG + Intergenic
1200985905 Y:9303498-9303520 CACGCACAGCAGAAACTTGAAGG + Intergenic
1201054513 Y:9975437-9975459 CTCTCAGAGCAGTCACTACTGGG + Intergenic
1202124674 Y:21557397-21557419 CACTCACAGCAGAAACTTGAAGG - Intergenic
1202154334 Y:21871983-21872005 CACTCACAGCAGAAACTTGAAGG + Intergenic
1202191882 Y:22254022-22254044 CTCTCAGAGCAGCCACTACTGGG - Intergenic
1202232726 Y:22672179-22672201 CACTCACAGCAGAAAGTTGAAGG - Intergenic
1202310430 Y:23523979-23524001 CACTCACAGCAGAAAGTTGAAGG + Intergenic
1202560372 Y:26146615-26146637 CACTCACAGCAGAAAGTTGAAGG - Intergenic