ID: 1147925724

View in Genome Browser
Species Human (GRCh38)
Location 17:43944385-43944407
Sequence GAAAAATGAAAGCTACGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147925724_1147925727 7 Left 1147925724 17:43944385-43944407 CCAAACCGTAGCTTTCATTTTTC No data
Right 1147925727 17:43944415-43944437 CAAACAACAGATTCCTCTTCTGG No data
1147925724_1147925729 18 Left 1147925724 17:43944385-43944407 CCAAACCGTAGCTTTCATTTTTC No data
Right 1147925729 17:43944426-43944448 TTCCTCTTCTGGGTCCTCTCAGG No data
1147925724_1147925732 25 Left 1147925724 17:43944385-43944407 CCAAACCGTAGCTTTCATTTTTC No data
Right 1147925732 17:43944433-43944455 TCTGGGTCCTCTCAGGGATGTGG No data
1147925724_1147925728 8 Left 1147925724 17:43944385-43944407 CCAAACCGTAGCTTTCATTTTTC No data
Right 1147925728 17:43944416-43944438 AAACAACAGATTCCTCTTCTGGG No data
1147925724_1147925730 19 Left 1147925724 17:43944385-43944407 CCAAACCGTAGCTTTCATTTTTC No data
Right 1147925730 17:43944427-43944449 TCCTCTTCTGGGTCCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147925724 Original CRISPR GAAAAATGAAAGCTACGGTT TGG (reversed) Intergenic
No off target data available for this crispr