ID: 1147926146

View in Genome Browser
Species Human (GRCh38)
Location 17:43947204-43947226
Sequence CTGCAAACAGGGATGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147926146_1147926157 14 Left 1147926146 17:43947204-43947226 CCTGGCTTCATCCCTGTTTGCAG No data
Right 1147926157 17:43947241-43947263 ACCCGCCACTGGCCAGAGCCTGG No data
1147926146_1147926152 3 Left 1147926146 17:43947204-43947226 CCTGGCTTCATCCCTGTTTGCAG No data
Right 1147926152 17:43947230-43947252 CCCCAATCCCAACCCGCCACTGG No data
1147926146_1147926162 27 Left 1147926146 17:43947204-43947226 CCTGGCTTCATCCCTGTTTGCAG No data
Right 1147926162 17:43947254-43947276 CAGAGCCTGGCCCAGCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147926146 Original CRISPR CTGCAAACAGGGATGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr