ID: 1147927192

View in Genome Browser
Species Human (GRCh38)
Location 17:43953275-43953297
Sequence CGGTGAGCGCAGGCGCGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147927192_1147927197 -7 Left 1147927192 17:43953275-43953297 CCGCTCCGCGCCTGCGCTCACCG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1147927197 17:43953291-43953313 CTCACCGCTGCCGGGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1147927192_1147927204 12 Left 1147927192 17:43953275-43953297 CCGCTCCGCGCCTGCGCTCACCG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1147927204 17:43953310-43953332 CAGGTTGAGGTAGTGGCGCAGGG 0: 1
1: 0
2: 3
3: 8
4: 134
1147927192_1147927201 5 Left 1147927192 17:43953275-43953297 CCGCTCCGCGCCTGCGCTCACCG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1147927201 17:43953303-43953325 GGGTGACCAGGTTGAGGTAGTGG 0: 1
1: 0
2: 4
3: 12
4: 211
1147927192_1147927206 26 Left 1147927192 17:43953275-43953297 CCGCTCCGCGCCTGCGCTCACCG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1147927206 17:43953324-43953346 GGCGCAGGGAGGCGTAGTAGCGG 0: 1
1: 0
2: 0
3: 5
4: 136
1147927192_1147927205 15 Left 1147927192 17:43953275-43953297 CCGCTCCGCGCCTGCGCTCACCG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1147927205 17:43953313-43953335 GTTGAGGTAGTGGCGCAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 289
1147927192_1147927199 -1 Left 1147927192 17:43953275-43953297 CCGCTCCGCGCCTGCGCTCACCG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1147927199 17:43953297-43953319 GCTGCCGGGTGACCAGGTTGAGG 0: 1
1: 0
2: 0
3: 16
4: 163
1147927192_1147927203 11 Left 1147927192 17:43953275-43953297 CCGCTCCGCGCCTGCGCTCACCG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1147927203 17:43953309-43953331 CCAGGTTGAGGTAGTGGCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147927192 Original CRISPR CGGTGAGCGCAGGCGCGGAG CGG (reversed) Exonic
900142674 1:1145162-1145184 CGGGGAGCACAGGCCAGGAGGGG - Intergenic
900206972 1:1435788-1435810 CGGCTGGCGCTGGCGCGGAGCGG + Exonic
901719458 1:11184865-11184887 CGGGGAGCCCAGGTGAGGAGCGG - Intronic
903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG + Intronic
905104812 1:35557929-35557951 CGATCAGCGCCGGCTCGGAGAGG - Exonic
905375139 1:37514815-37514837 CCGCGCGCGCAGGCGCAGAGCGG - Intergenic
906808282 1:48801281-48801303 CGGTGTGGGCAGGCAGGGAGGGG - Intronic
909594204 1:77386833-77386855 GGGTGAGCGCAGGCAGGGAGAGG - Intronic
912546015 1:110452472-110452494 CGGTGAGGGCAGGAGCAGCGTGG + Intronic
914199080 1:145468561-145468583 CGGTGAGGGCAGGGGAGGAAAGG + Intergenic
914511642 1:148337534-148337556 CGGTGAGGGCAGGGGAGGAAAGG + Intergenic
921389247 1:214603119-214603141 CTGAGTGCGCAGGCGCGGATTGG + Intergenic
922440896 1:225653775-225653797 CGCTGGGCGCAGCCGCGGCGAGG - Intergenic
1063151462 10:3340313-3340335 CGGTGTGGGGAGGCGGGGAGGGG + Intergenic
1067337033 10:45374428-45374450 CGGTGAGCGCGGGCGGGGCACGG + Exonic
1070385947 10:75924765-75924787 CGGAGAGCACAGGCAGGGAGTGG + Intronic
1073135399 10:101217505-101217527 CGGGCAGCGCAGGAGGGGAGGGG - Intergenic
1076775157 10:132691414-132691436 CTGTGCGCTCAGGCACGGAGCGG + Intronic
1077054500 11:584389-584411 AGGTGAGCGCAGACACGGTGGGG - Intronic
1077224719 11:1434994-1435016 GGGTGGGCCGAGGCGCGGAGGGG + Intronic
1077488213 11:2848708-2848730 CAGTGGGCTCAGGGGCGGAGAGG - Exonic
1077540972 11:3146339-3146361 AGGTGAGGGCAGACGAGGAGGGG + Intronic
1079128504 11:17734867-17734889 CGGTGAGGCGAGGCGCGGAGCGG - Exonic
1083617954 11:64035749-64035771 CCGTGCGTGCAGGCGCGGAGCGG - Intronic
1085143419 11:74170865-74170887 CGGGGAACGCAGGCGCCGTGGGG - Exonic
1087761734 11:102110336-102110358 CGGTGCGGGCGGGCGCGCAGAGG + Intergenic
1090086301 11:123654042-123654064 CGGCGAGAGCGGGCGCGGAGCGG - Exonic
1090253026 11:125264276-125264298 CGGTGAGCTCAGCCCAGGAGAGG - Intronic
1092529503 12:9332716-9332738 GGGTGAGAGCAGGCACAGAGGGG + Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097079719 12:56421218-56421240 CCGAGAGAGCAGGCGCGGGGGGG - Intronic
1102101487 12:110281681-110281703 CCGGGAGCCCAGGCGCGGACGGG - Exonic
1102543312 12:113637931-113637953 CGGTGGGAGCAGGGGAGGAGGGG - Intergenic
1104635284 12:130434679-130434701 TGGTGGGCGCGGGCTCGGAGCGG - Intronic
1104724686 12:131068423-131068445 CGGGGAGGGAAGGCGTGGAGTGG + Intronic
1104974421 12:132546097-132546119 CGGGGAGCGCAGGGGAGGGGAGG - Intronic
1105004116 12:132710638-132710660 CGGTGCGCGCAGGTGCGGGCGGG - Intergenic
1105926916 13:25017333-25017355 GCGCGGGCGCAGGCGCGGAGAGG + Intergenic
1110714638 13:78687101-78687123 CGGTGAGTGCAGGCTGGGTGTGG - Intergenic
1112507114 13:99981845-99981867 CGCGTAGCGAAGGCGCGGAGAGG - Exonic
1113660663 13:112104714-112104736 CAGTGACCGCACGCGTGGAGTGG + Intergenic
1113775590 13:112943344-112943366 CGCAGAGCCCAGGCGCGGGGAGG + Intronic
1123002054 14:105300978-105301000 CGGTGAGCGCAGCCGAGGACTGG + Exonic
1123002068 14:105301022-105301044 CGGTGAGCGCAGCCCGGGACTGG + Exonic
1123002096 14:105301107-105301129 CGGTGAGTGCAGCCGGGGACGGG + Exonic
1124340602 15:28887002-28887024 CGGTGTGCCCAGGCGGGGAGGGG + Intronic
1128454236 15:67823610-67823632 CGGTGAGCGGAGGTGCGCGGCGG - Intronic
1128509806 15:68306477-68306499 GGGTGAGCACAGGCCCGGAGGGG - Intronic
1128654831 15:69453019-69453041 CGGTGAGTGCGGGCGCGGGCCGG + Exonic
1129150369 15:73684459-73684481 CGGTGAGTGCTGGCGTGGCGCGG + Exonic
1132483872 16:180434-180456 CGGTCCGCGCAGGCGCAGCGGGG + Exonic
1132544798 16:528105-528127 CGGGGAGCGCGGGCTCGGCGGGG + Intronic
1132591449 16:728028-728050 TGGTGAGCGCCGGCGGGGCGCGG + Exonic
1132831327 16:1929811-1929833 CTGCGTGCGCAGGCGCGGCGGGG - Intergenic
1133052272 16:3124034-3124056 CGGTGAGGGCGGAGGCGGAGAGG + Intergenic
1136620836 16:31427656-31427678 AGCTGGGCGCATGCGCGGAGCGG + Intergenic
1138417026 16:56877552-56877574 CTGTGAGGGCTGGCGGGGAGGGG + Intronic
1139451175 16:67029148-67029170 CGGTGAGCGCTGGGGCTGCGCGG + Intronic
1139664509 16:68447085-68447107 CGGGGGGCGCGGCCGCGGAGGGG - Intronic
1139805982 16:69565926-69565948 GGCACAGCGCAGGCGCGGAGGGG - Intronic
1140504782 16:75464438-75464460 CGCAGTGCGCAGGCGCGGGGCGG + Intronic
1141422216 16:83924755-83924777 CGGTGAGAGCTGGCAAGGAGAGG - Exonic
1142708399 17:1710282-1710304 CCGAGAGCGCGGGCGCCGAGGGG - Exonic
1142757691 17:2025426-2025448 CCGTGAGCGGGGGCGGGGAGCGG - Intergenic
1143390401 17:6556364-6556386 AGGTGAGGGCGGGCGCGGGGAGG - Exonic
1143482221 17:7234315-7234337 GGGTGTGCGCAGGCGCGGCAGGG - Exonic
1144704820 17:17361559-17361581 GGGGGAGGACAGGCGCGGAGGGG + Intergenic
1144816599 17:18039599-18039621 CGGGGCGCGCACGCGCGGGGTGG - Exonic
1145863763 17:28227492-28227514 TCGTGAGCGCAGGCGCGGGGCGG + Intergenic
1146922389 17:36722424-36722446 CGGCGAGCGCATGCGCGCTGGGG - Intergenic
1147726065 17:42566890-42566912 CGGGGAGGGCAGGCACGGCGGGG + Intergenic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1148206723 17:45784232-45784254 CGGGGAGCCGAGGCGAGGAGCGG + Intergenic
1148442174 17:47717082-47717104 AGGTGAGAGGAGGTGCGGAGAGG - Intergenic
1149651538 17:58279276-58279298 TGGTGAGCGCCGGCGGGCAGAGG - Exonic
1149963282 17:61136058-61136080 CGGGGAAGGCAGGCGCGAAGGGG - Intronic
1150802239 17:68291453-68291475 CGCTGAGCGCAGCCAAGGAGGGG + Intronic
1152022406 17:77787379-77787401 CGGTCAGCACAGGGGCGGTGTGG - Intergenic
1152627880 17:81396569-81396591 CCGGGAGCGCGGGCGCGGTGGGG - Intronic
1152719818 17:81917983-81918005 CGGTGAGCGGCGGCGCGGGCCGG + Intronic
1152923906 17:83079178-83079200 CGGGCAGCCCCGGCGCGGAGCGG - Intergenic
1155257855 18:24014452-24014474 CGGTGGGCGAAGGCGCGGCTTGG + Intronic
1160567832 18:79798147-79798169 CGGTGCGCGCGGGCGCGGGAGGG + Intergenic
1160706274 19:531686-531708 CGGTGCGCGCAGGCGCAGCGGGG + Intergenic
1160896948 19:1407589-1407611 CGGTGACCGTTGGCGCCGAGGGG + Intronic
1161104150 19:2434930-2434952 GGGTGAGTGCGGGCGCGGGGCGG + Intronic
1161697621 19:5778350-5778372 CGGTGGGGGGAGGCGGGGAGAGG - Intronic
1162486140 19:10961433-10961455 CGGCGAGAGCGCGCGCGGAGAGG - Intronic
1162914163 19:13865436-13865458 AGGTGAGCGCGGGCGCCGGGCGG + Intronic
1163544497 19:17933084-17933106 CGGGGAGCAGAGGCGCGGGGCGG + Intronic
1163708529 19:18831996-18832018 AGGGGAGCTGAGGCGCGGAGGGG + Exonic
1165226596 19:34359477-34359499 GGTTGAGCGCAGGCGCGGATGGG - Intronic
1166306852 19:41940242-41940264 CGGGGAGCCCGGGGGCGGAGGGG + Intergenic
1167748427 19:51366410-51366432 TGCTGCGCGCAGGCGCAGAGAGG - Intronic
926090762 2:10047780-10047802 CTCTGAGCGGGGGCGCGGAGAGG + Exonic
926722832 2:15974649-15974671 CAGTGAGCACAGGTGCAGAGAGG - Intergenic
927637604 2:24827507-24827529 CTGTGAGTGCAGGCCAGGAGGGG + Intronic
927836360 2:26402143-26402165 CGGTGAGCGCGGGGGCGGGCGGG + Exonic
930701085 2:54457673-54457695 CGGGGGCCGCAGGCGCCGAGCGG - Intronic
932252648 2:70258093-70258115 CGGAGCGCGCAGCCGCGCAGCGG + Intronic
932396701 2:71453773-71453795 GGGTGAGCGCAGCCGGGGCGGGG + Intronic
933966361 2:87432572-87432594 AGGTGAGGGCAGGCACTGAGTGG + Intergenic
936327434 2:111517913-111517935 AGGTGAGGGCAGGCACTGAGTGG - Intergenic
941367025 2:164621561-164621583 CGGCGAGGCAAGGCGCGGAGGGG + Exonic
948248652 2:236507467-236507489 CGGAGCGCGCAGGCGCAGAGAGG + Exonic
948945766 2:241218109-241218131 GGGGGCGCGCAGGGGCGGAGCGG + Intronic
948945790 2:241218162-241218184 GGGGGCGCGCAGGGGCGGAGCGG + Intronic
948945798 2:241218183-241218205 GGGGGCGCGCAGGGGCGGAGCGG + Intronic
949012211 2:241687129-241687151 AGGGGAGCGCAGGGTCGGAGGGG + Intergenic
1169088362 20:2840930-2840952 CGGGGAGAGCCGGCGCGGGGCGG - Intronic
1172520960 20:35565153-35565175 TGGTGAGCGCTGGCCGGGAGCGG - Intergenic
1172684913 20:36746143-36746165 CGGTCCGCGCAGGCGCGCCGAGG + Intergenic
1172771504 20:37384874-37384896 CGGTCACCGCAGCCCCGGAGAGG + Intronic
1172873899 20:38152724-38152746 GGGTGAGCGCAGGGGCGCTGCGG - Intronic
1173726893 20:45304590-45304612 CGGCGAGAGAACGCGCGGAGAGG + Exonic
1174357671 20:50009472-50009494 CAGTGAGTGCAGGGGCGGGGGGG - Intergenic
1174380647 20:50153478-50153500 TGGTGACCGCAGGCCTGGAGGGG + Intronic
1175237551 20:57525148-57525170 GGCAGTGCGCAGGCGCGGAGCGG + Intronic
1176125045 20:63471548-63471570 AGCTGAGCGCAGGAGCTGAGGGG + Intronic
1176240241 20:64072525-64072547 CTGTGAGGGCAGGTGGGGAGAGG + Intergenic
1176414566 21:6467357-6467379 CTCTGGGCGGAGGCGCGGAGAGG + Intergenic
1176428382 21:6562322-6562344 AGGTGAGCCCAGGCACTGAGAGG + Intergenic
1179243841 21:39613096-39613118 CGGGGAGCGCTGGCCGGGAGCGG + Intronic
1179690064 21:43075679-43075701 CTCTGGGCGGAGGCGCGGAGAGG + Intronic
1179703872 21:43170638-43170660 AGGTGAGCCCAGGCACTGAGAGG + Exonic
1179950643 21:44707229-44707251 CGGTGGGGGCAGGGGTGGAGCGG - Intronic
1181491386 22:23262717-23262739 GGGTGAGGGCGGGGGCGGAGAGG + Intronic
1183353192 22:37344810-37344832 GGGTGAGAGCAGGCGTGGACGGG - Intergenic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
949860646 3:8501738-8501760 GCGCGAGCGCCGGCGCGGAGTGG + Exonic
950683874 3:14602882-14602904 CGGTGAGCGCGCGCGCGGCGCGG - Intergenic
950683992 3:14603228-14603250 CGGTGGGGGCGGGCGCGGAGAGG + Intergenic
956468705 3:69542815-69542837 CGGTGCCAGGAGGCGCGGAGCGG + Intergenic
967596304 3:191329611-191329633 CGGTCACCGCCGGCGCCGAGCGG - Exonic
968433025 4:570019-570041 CAGTGAGGGGAGGGGCGGAGAGG - Intergenic
968872624 4:3249480-3249502 CGGCGAGCGCAGGCTGGGCGAGG + Exonic
969119835 4:4900000-4900022 CGGTGAGCTCAGGTGCAGTGAGG - Intergenic
969413286 4:7043258-7043280 GGGGGCGCGCAGGCGCAGAGCGG + Intronic
969597867 4:8159013-8159035 CGGCCAGCGCAGGCGCAGACGGG + Intergenic
982000263 4:151015549-151015571 GGCTGAGCGCAGGGGCGGGGCGG - Intronic
984952616 4:185018487-185018509 CGCGGAGCGCAGGGGCGCAGCGG - Intergenic
985783713 5:1883616-1883638 CGGTGGGCGCACGCCCGGGGCGG - Intronic
988263865 5:28926717-28926739 TGGTGAGAAAAGGCGCGGAGAGG + Intergenic
991099931 5:62781107-62781129 ATGGGAGCGCAGGAGCGGAGCGG + Intergenic
991454580 5:66788764-66788786 CGGTGAGCGAGGGCGCCGACTGG - Exonic
992249916 5:74866416-74866438 CGGTGGGCGCGGGCGCGGAGCGG - Intronic
992297183 5:75337224-75337246 CAGTTAACGCAGTCGCGGAGCGG - Exonic
993901351 5:93585679-93585701 AGATGAGCGCAGGCCGGGAGGGG - Intronic
999727200 5:154446537-154446559 CGGCAAGCGCGGCCGCGGAGTGG + Exonic
1001605154 5:172954465-172954487 CGGTGGGGGCAGGGGCGGCGGGG + Intergenic
1003603669 6:7541484-7541506 CGGCGGGCGCAGGTGGGGAGGGG + Intergenic
1003995648 6:11537655-11537677 CGGGGAGCGCAGGGGAGGAGGGG + Intergenic
1006932766 6:37697634-37697656 CGGCGAGCGGAGGCGGCGAGCGG - Exonic
1019021767 6:168924565-168924587 GGGTGAGAGCAGGAGCAGAGTGG - Intergenic
1019538249 7:1539830-1539852 CTGAGAGCGCAGGCGTGCAGGGG + Intronic
1019541677 7:1554517-1554539 CGGTGTGCGCAGGGGTGGGGTGG - Intronic
1026737992 7:72960979-72961001 CTGGGTGCGCAGGCGTGGAGAGG - Intronic
1026822318 7:73557752-73557774 CGGGGCGCGCAGGCGCGCTGAGG - Exonic
1027105742 7:75404089-75404111 CTGGGTGCGCAGGCGTGGAGAGG + Intronic
1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG + Exonic
1032085100 7:128879697-128879719 CGGTGAGCAAAGCCGAGGAGTGG - Exonic
1034837326 7:154364530-154364552 AGGTGAGGGCAGGGGCGGTGGGG + Intronic
1035006273 7:155663460-155663482 GGGTGAGCAGAGGCGGGGAGGGG + Intronic
1035106240 7:156443775-156443797 CCCTGAGCGCAGGCCAGGAGTGG - Intergenic
1035476104 7:159145051-159145073 CGGTGAGGAGGGGCGCGGAGCGG - Intergenic
1035673376 8:1437068-1437090 CGTTCAGCCCAGGCGCGTAGGGG + Intergenic
1035673395 8:1437150-1437172 CGTTCAGCGCAGGCGCGTAAGGG + Intergenic
1035747831 8:1974313-1974335 CGGTGACTGCGGGCGCGGCGCGG - Intronic
1036578946 8:10054782-10054804 GGGTCTGCGCAGGCGCGAAGGGG + Intronic
1036784874 8:11679569-11679591 CGGGGCGCGCAGCCGGGGAGAGG + Intronic
1037807417 8:22066430-22066452 CGGGGAGGGCAGGTGCGGCGGGG + Intronic
1037819405 8:22128538-22128560 AGGTGAGTGCAGGGGCAGAGAGG - Exonic
1037887943 8:22604882-22604904 CGGCCAGCGGAGGGGCGGAGGGG - Intronic
1039484254 8:37899050-37899072 CAGTGAGTGCGGGCGGGGAGGGG - Exonic
1039536498 8:38319368-38319390 CTGTGAGTGCAGGCGCGGAAGGG - Intronic
1045023518 8:98064526-98064548 CGTAGAGCGCAAGCGCGCAGCGG - Exonic
1047429141 8:124775768-124775790 CTGTGAGCTCAGGAGGGGAGAGG - Intergenic
1049316783 8:141973513-141973535 CCGTGAGCGCAGGCACCGTGAGG - Intergenic
1049749829 8:144277799-144277821 CGGTGCGGGCAGGGGCGGTGCGG + Intronic
1049777441 8:144413216-144413238 GGGTGAGCGCAGGCGGGGCCTGG - Exonic
1049791689 8:144475289-144475311 CCGTGAGCCCAGACGGGGAGGGG + Intronic
1049891408 9:73550-73572 CAGCGAGCGGCGGCGCGGAGAGG - Intergenic
1049981636 9:909126-909148 AGGTGAGCGCAGGAGAGGAAGGG + Intronic
1053489297 9:38487535-38487557 CGGTGGGCGCAGGAGCAGACTGG - Intergenic
1054258428 9:62838388-62838410 GAGGGGGCGCAGGCGCGGAGGGG - Intergenic
1054333343 9:63781675-63781697 GAGGGGGCGCAGGCGCGGAGGGG + Intergenic
1056379142 9:86041559-86041581 AGGTGAGGGCAGGCGCCGGGGGG - Intronic
1059234533 9:112750784-112750806 CGGCGGGCTCGGGCGCGGAGCGG + Intergenic
1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG + Intergenic
1061859354 9:133460217-133460239 CGAGGAGCGCATGCGCGGCGGGG - Intronic
1202800341 9_KI270719v1_random:169982-170004 CCGCCGGCGCAGGCGCGGAGGGG + Intergenic
1186107926 X:6226762-6226784 CGGAGGGAGCAGCCGCGGAGTGG + Intronic
1190324907 X:49200308-49200330 CGCTGTGCGCAGGCGCGTGGCGG - Intergenic
1190775340 X:53548052-53548074 CAGTGAGCGCTGGCGGTGAGGGG - Exonic
1199813180 X:151371086-151371108 CGCTGGGCGCAAGCGAGGAGAGG - Intergenic
1200068814 X:153517909-153517931 GGGTGGGCGCGGGCGCGGCGCGG + Intronic
1200244804 X:154517271-154517293 GCGTGCGGGCAGGCGCGGAGGGG - Intergenic