ID: 1147930230

View in Genome Browser
Species Human (GRCh38)
Location 17:43975187-43975209
Sequence CATTAAGAACAGATGGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147930230_1147930236 22 Left 1147930230 17:43975187-43975209 CCCAGAACCATCTGTTCTTAATG 0: 1
1: 0
2: 0
3: 14
4: 244
Right 1147930236 17:43975232-43975254 TCCACATACTTACAAACCTAGGG 0: 1
1: 0
2: 2
3: 14
4: 145
1147930230_1147930240 29 Left 1147930230 17:43975187-43975209 CCCAGAACCATCTGTTCTTAATG 0: 1
1: 0
2: 0
3: 14
4: 244
Right 1147930240 17:43975239-43975261 ACTTACAAACCTAGGGGTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 140
1147930230_1147930238 23 Left 1147930230 17:43975187-43975209 CCCAGAACCATCTGTTCTTAATG 0: 1
1: 0
2: 0
3: 14
4: 244
Right 1147930238 17:43975233-43975255 CCACATACTTACAAACCTAGGGG 0: 1
1: 0
2: 1
3: 9
4: 133
1147930230_1147930239 26 Left 1147930230 17:43975187-43975209 CCCAGAACCATCTGTTCTTAATG 0: 1
1: 0
2: 0
3: 14
4: 244
Right 1147930239 17:43975236-43975258 CATACTTACAAACCTAGGGGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1147930230_1147930235 21 Left 1147930230 17:43975187-43975209 CCCAGAACCATCTGTTCTTAATG 0: 1
1: 0
2: 0
3: 14
4: 244
Right 1147930235 17:43975231-43975253 TTCCACATACTTACAAACCTAGG 0: 1
1: 0
2: 3
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147930230 Original CRISPR CATTAAGAACAGATGGTTCT GGG (reversed) Intronic
900252719 1:1679524-1679546 CATCAAGAACTTAAGGTTCTGGG + Intronic
901340196 1:8491092-8491114 CATAAAGAACTGATAGCTCTGGG + Intronic
902089276 1:13890359-13890381 CATAAGGAAAAGATGGTTTTGGG + Intergenic
902320452 1:15660289-15660311 CATGAACCACAGATGTTTCTAGG + Exonic
902766799 1:18622048-18622070 GATTAAGAACTGATATTTCTAGG + Intergenic
903100685 1:21026301-21026323 CATTTTCAACAAATGGTTCTGGG + Intronic
907730335 1:57059922-57059944 CATTACCATCAGTTGGTTCTAGG + Intronic
907808531 1:57845017-57845039 AATTAATCTCAGATGGTTCTGGG - Intronic
908410779 1:63862512-63862534 CATGAAGAACAGATGGGTTATGG - Intronic
908695899 1:66841506-66841528 ATTTAAAAACAGATGGATCTTGG - Intronic
911160546 1:94678883-94678905 AATTAAGGACAGAGAGTTCTGGG + Intergenic
912969207 1:114264686-114264708 CATTCAGAACAGATTATTATGGG + Intergenic
913058112 1:115180583-115180605 CATTAAGAGCAGCAGGTTTTAGG - Intergenic
915536046 1:156536100-156536122 GAGTAAGAAAAGATTGTTCTAGG - Intronic
915803941 1:158824667-158824689 GTTTAAGATCAGATGGTTGTAGG - Intergenic
916671380 1:167024403-167024425 TCTTTAAAACAGATGGTTCTAGG + Intergenic
917289593 1:173459449-173459471 CATAAAGAACAGATAATTCCTGG + Intergenic
918735837 1:188062142-188062164 AATGAAGATCAGATGGTTATAGG + Intergenic
918981724 1:191570284-191570306 AATTAAGAACATATGGTATTTGG - Intergenic
922594722 1:226804821-226804843 TTTTAATGACAGATGGTTCTGGG - Intergenic
922688640 1:227668851-227668873 CTTAAAGATCAGATGGTTGTAGG + Intronic
924297936 1:242607637-242607659 CATAAAGAACTGAGGGTCCTGGG - Intergenic
1062774382 10:134017-134039 CATTAGGAAGAGACGGTTGTAGG - Intergenic
1064106548 10:12505241-12505263 TGTTAAGAACAGATGGCTCCTGG + Intronic
1064632909 10:17335621-17335643 CATTCAAAAAAGATGGTTCATGG + Intronic
1065585864 10:27216844-27216866 CATTACGAAATGATGTTTCTTGG + Intronic
1065775991 10:29120822-29120844 AATTAACAACAAATGGTACTTGG - Intergenic
1065785934 10:29214717-29214739 AATTGGGAACAGATGATTCTTGG - Intergenic
1067458948 10:46443356-46443378 AAAGAAAAACAGATGGTTCTAGG + Intergenic
1067923212 10:50480926-50480948 CAGTAAGAAGGGATGGATCTGGG - Intronic
1072159852 10:92755838-92755860 CAATAAGAGCAGATTGTGCTGGG - Intergenic
1072559045 10:96552958-96552980 CATTAAGAAAAGATTATGCTCGG - Exonic
1073814520 10:107191974-107191996 CATGAAATATAGATGGTTCTGGG + Intergenic
1073913527 10:108375474-108375496 CATTAAAAACAAACGGTTTTTGG - Intergenic
1073930836 10:108573978-108574000 CAGTAAAAACAGATTGTTTTAGG + Intergenic
1075866457 10:125725177-125725199 CATTAAAAACATATCTTTCTGGG - Intronic
1075961453 10:126570917-126570939 CATTGAGAAAATATGTTTCTGGG - Intronic
1076933360 10:133549932-133549954 CTTGAAGATCAGATGGTTGTAGG - Intronic
1077637469 11:3853675-3853697 CATTAAGAGAAGATGGGGCTGGG - Intergenic
1078014510 11:7601657-7601679 CATTAAGAAGAGTTATTTCTCGG + Intronic
1078548726 11:12265620-12265642 CATTTAAAACAGATGTTCCTGGG + Intergenic
1078880074 11:15439269-15439291 CATGAAGAAGAGAAGGGTCTTGG - Intergenic
1079870227 11:25788857-25788879 CATATAGCAAAGATGGTTCTGGG + Intergenic
1080790201 11:35515640-35515662 CTTATAGAACAGGTGGTTCTGGG - Intronic
1080844769 11:36017042-36017064 CCTAAAGAACTGAGGGTTCTGGG + Intronic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1082738753 11:56887113-56887135 CATGAAGACAAGATGGTTTTTGG + Intergenic
1086234465 11:84611172-84611194 TATTAATAACACATGGTCCTTGG - Intronic
1086568735 11:88258434-88258456 CTTAAAGATCAGATGGTTGTAGG + Intergenic
1087717378 11:101624131-101624153 CATTAAGAAAAGACAGTTCAGGG - Intronic
1088424078 11:109682322-109682344 TATTAAGATCAGATGGTTGCAGG - Intergenic
1088669024 11:112123036-112123058 CATTCAGAAGAGATGGCTCCTGG - Intronic
1091857908 12:3753755-3753777 CATGAAGAACAGCTGGTGTTTGG - Intronic
1092399852 12:8165759-8165781 AATTAAGAACATATGGTATTTGG + Intronic
1093914084 12:24781212-24781234 CATGAACAATAGATGGTGCTAGG - Intergenic
1094243604 12:28259893-28259915 CATTATTGACAGATGTTTCTTGG + Intronic
1098723392 12:73930507-73930529 CATGAAAAACAAATGGTTTTTGG + Intergenic
1099275050 12:80564208-80564230 CATTAAGAGCAGATTTTTATGGG + Intronic
1099369971 12:81817076-81817098 CTTGAAGATCAGATGGTTGTAGG - Intergenic
1099617160 12:84950755-84950777 CATTAAGAACACATGGACATAGG + Intergenic
1105911850 13:24876137-24876159 CCTTAAGAACTGAGGGTCCTGGG - Intronic
1107345658 13:39458056-39458078 CAGTAATAACAGCTGATTCTGGG + Intronic
1108843694 13:54652388-54652410 CATTAAAAAAAAATGGTACTAGG - Intergenic
1108917215 13:55629819-55629841 CAGTAAGAACATATGGTATTTGG + Intergenic
1110481705 13:75985494-75985516 CATTAAGAATAATTGCTTCTGGG - Intergenic
1111038758 13:82715631-82715653 CATTATGAACAGAATGTTTTTGG - Intergenic
1111224129 13:85247072-85247094 CATTTAAAACAAATGGATCTTGG - Intergenic
1112677732 13:101722935-101722957 CATCATGCAAAGATGGTTCTCGG + Exonic
1112972521 13:105277951-105277973 CAATAATCACAGATGCTTCTTGG + Intergenic
1113522783 13:110952604-110952626 CATTAAGACCAGCTACTTCTGGG - Intergenic
1113702587 13:112398233-112398255 CATTAAGACCAGCTATTTCTGGG + Intronic
1114263082 14:21053174-21053196 CGTTACCAACAGATGGTTTTTGG - Intronic
1114279177 14:21175205-21175227 GTTGAAGATCAGATGGTTCTAGG - Intergenic
1114907247 14:27145326-27145348 AATTGAGAACATATGGTACTTGG + Intergenic
1115764131 14:36605268-36605290 CATTATGACCAGATTGTTTTAGG + Intergenic
1115915321 14:38306002-38306024 GTTGAAGATCAGATGGTTCTAGG - Intergenic
1116210804 14:41940910-41940932 CCTAAAGAACTGATGGTTCTGGG + Intergenic
1116243889 14:42383254-42383276 CTTAAAGAACTGAGGGTTCTGGG - Intergenic
1118412950 14:65501783-65501805 CATTAAGAATATCTGGGTCTGGG - Intronic
1118660355 14:68002818-68002840 CTTGAAGATCAGATGGTTATAGG + Intronic
1121275612 14:92665731-92665753 CATTAAGAAAAGGTGGGGCTGGG - Intronic
1124171845 15:27381283-27381305 CGTTAAGAACAGAATGCTCTCGG + Intronic
1124970158 15:34480946-34480968 AATTAAGAAAGGATGGATCTTGG + Intergenic
1125634171 15:41173288-41173310 TATTAAAAGCGGATGGTTCTAGG + Intergenic
1126444312 15:48725251-48725273 CATTAACAACAGAGGAGTCTGGG + Intronic
1127696579 15:61454224-61454246 TGTTAAGATCAGATGGTTGTAGG + Intergenic
1130734849 15:86537275-86537297 CAATCAGAGCAGATGGTTATTGG - Intronic
1132189192 15:99835048-99835070 AATTAAGAAAGGATGGATCTTGG - Intergenic
1132758843 16:1499299-1499321 CTGTAAGAACAGAAGCTTCTGGG - Exonic
1135971714 16:27076887-27076909 CATTAAGAGCAGGTGGCCCTAGG - Intergenic
1137783629 16:51119010-51119032 TATTAAGAATAGGTGGTTGTAGG - Intergenic
1140645170 16:77022100-77022122 TATTAAAACTAGATGGTTCTGGG + Intergenic
1140977878 16:80077857-80077879 CATTCAGAACAGAGGGGTCCTGG - Intergenic
1141100007 16:81190679-81190701 CATTCATCCCAGATGGTTCTTGG + Intergenic
1145328502 17:21851063-21851085 CATTAAGCAGAGGTGGCTCTGGG + Intergenic
1146979368 17:37145466-37145488 CATTAATAAGAGAAGTTTCTAGG - Intronic
1147930230 17:43975187-43975209 CATTAAGAACAGATGGTTCTGGG - Intronic
1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG + Exonic
1150261782 17:63798959-63798981 GATTAGAAACAGATGGTTGTGGG + Intronic
1150636609 17:66917674-66917696 CATGTAAAACAGATGGTTCTAGG + Intergenic
1152446897 17:80350155-80350177 CAGTAAGAACAGATAGTCCAGGG - Intronic
1152496082 17:80672877-80672899 CCTAAAGAACGGAGGGTTCTAGG + Intronic
1203193092 17_KI270729v1_random:207241-207263 CATTAAGCAGAGGTGGCTCTGGG + Intergenic
1203202456 17_KI270730v1_random:6676-6698 CATTAAGCAGAGGTGGCTCTGGG + Intergenic
1155861632 18:30908956-30908978 GATGAAGATCAGATGGTTGTAGG - Intergenic
1156102414 18:33613200-33613222 CATCATGGCCAGATGGTTCTGGG + Intronic
1158150636 18:54365232-54365254 CATAAAGAACAGATTATTCTGGG - Intronic
1158292935 18:55962239-55962261 CATTAAGAACAAAAGGCTTTTGG + Intergenic
1159546107 18:69840881-69840903 CATTAAAAACAGCTTTTTCTGGG + Intronic
1168212686 19:54902121-54902143 CATTAATAACAGAATGTCCTTGG + Intergenic
925936219 2:8764150-8764172 AAGTAAGAACATATGGTTGTTGG - Intronic
926307577 2:11649762-11649784 CCTTAAGAACAGTTGGATCTAGG + Intergenic
928718627 2:34093352-34093374 CATTAGGAACAGATATTTATAGG + Intergenic
928740517 2:34346817-34346839 TATTAAGTACAGATGACTCTTGG - Intergenic
930987349 2:57606633-57606655 GTTGAAGAACAGATGGTTGTAGG - Intergenic
933407185 2:81875626-81875648 CATGCAGAAAAGATGATTCTGGG + Intergenic
940600536 2:155853746-155853768 CATTAAGATCAGACGTTCCTTGG - Intergenic
941329066 2:164154850-164154872 CATTAAGAAGAAATAGTTCTTGG - Intergenic
942056286 2:172186291-172186313 CGTTAAGATCAGATGGTTACAGG + Intergenic
943993171 2:194723680-194723702 CTCTAAGAACAGATGGTTTGTGG - Intergenic
946593569 2:221279357-221279379 AATCAAGACCAGATGGTTCAAGG + Intergenic
948089956 2:235285023-235285045 CATTAAGAAAAGATTATTCAAGG - Intergenic
1170537214 20:17352549-17352571 CTTGAAGATCAGATGGTTGTAGG - Intronic
1173278468 20:41605190-41605212 TGTTAATAACAGGTGGTTCTAGG + Intronic
1173942520 20:46923749-46923771 CATTAACAGCAGATGCATCTGGG + Intronic
1175282961 20:57816919-57816941 CCTTAAGAACTGAGGGTCCTGGG + Intergenic
1176364057 21:6021898-6021920 CATGTAGAAGAGATGGTTCCAGG + Intergenic
1177061571 21:16381257-16381279 GATTTAGAACAGATGTTTATAGG + Intergenic
1177904460 21:26958798-26958820 CATTATGAACAGATTGTTCAGGG + Intronic
1179759461 21:43516647-43516669 CATGTAGAAGAGATGGTTCCAGG - Intergenic
1180221701 21:46363239-46363261 GATAAAGAACAGTCGGTTCTCGG + Intronic
1180652593 22:17390774-17390796 TATTAAAAACAAATGGTTTTGGG - Intronic
1180838970 22:18949433-18949455 CATTAAGGTCAGATGTTCCTGGG + Intergenic
1181966837 22:26662412-26662434 TATTAAGAACAGATGCTAATTGG - Intergenic
1182482822 22:30620630-30620652 CATGAATACCAGCTGGTTCTGGG - Intronic
1182828547 22:33285895-33285917 CATTAACCACGGATGGTTTTAGG - Intronic
1183943178 22:41308137-41308159 CAATCAGAAGACATGGTTCTCGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949419246 3:3848307-3848329 CATTTAGAGCAGATGGAACTAGG + Intronic
951937663 3:28039589-28039611 CATTAAGAACACATTGTCTTTGG - Intergenic
954800954 3:53186599-53186621 CACAAAGAACAGGTGGTCCTGGG - Exonic
955691328 3:61593194-61593216 CATGAAGAAGAGATGGATATGGG - Intronic
956689590 3:71863660-71863682 CATTAAAAAAAGAGGGTTCCAGG + Intergenic
956756670 3:72394814-72394836 TTTTAGGAACAGATGTTTCTTGG + Intronic
960700366 3:120433523-120433545 CACTAAGCACAACTGGTTCTAGG + Intronic
964543811 3:157810368-157810390 CATTAAAAACAAATGAATCTGGG + Intergenic
965415921 3:168391901-168391923 CATTAAGAACATATGATATTAGG + Intergenic
966621881 3:181974108-181974130 CATTAAGAAGAGATCTGTCTTGG + Intergenic
970409809 4:15793653-15793675 CATTGAGAACAGATGGTAGCAGG + Intronic
971525064 4:27606429-27606451 CATTAAGAACATTTGTTTCATGG + Intergenic
971630324 4:28984470-28984492 CATGAAGAAAAGATTTTTCTTGG + Intergenic
973012246 4:45091628-45091650 GTTTAAGATCAGATGGTTATAGG - Intergenic
973582304 4:52356494-52356516 AATTAAGAACATATGAATCTAGG - Intergenic
974702199 4:65466246-65466268 ATTTTAGAAAAGATGGTTCTCGG + Intronic
974951394 4:68587033-68587055 CATTGAGAACAGATGATGTTTGG - Intronic
975111469 4:70632956-70632978 AGTCAAGAAAAGATGGTTCTGGG + Intronic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
975339293 4:73219863-73219885 GATTAAGTTCAGATTGTTCTGGG - Intronic
975632636 4:76418243-76418265 CATTAAAAGCAGATGGTGCTGGG + Intronic
975661897 4:76696739-76696761 ACTTAAGAACAGATGGTATTGGG - Intronic
976481379 4:85550336-85550358 CTTGAAGATCAGATGGTTGTAGG + Intronic
977159785 4:93619331-93619353 TATTTATAACACATGGTTCTGGG - Intronic
978354281 4:107854508-107854530 ACTTAAAAACAGATGCTTCTAGG + Intronic
978831459 4:113090470-113090492 ATTTAAGAACAGATAGTTCAGGG - Intronic
979097379 4:116567895-116567917 GTTGAAGAACAGATGGTTGTAGG - Intergenic
979563889 4:122132427-122132449 CCTAAAGAACTGAGGGTTCTGGG - Intergenic
980037288 4:127899749-127899771 CAATAAGAACACATGGGGCTGGG - Intergenic
980224151 4:129959513-129959535 CATTTTGAACAAATGGTGCTGGG - Intergenic
980555712 4:134401227-134401249 GTTAAAGAACAGATGGTTGTAGG + Intergenic
981664870 4:147212653-147212675 GTTGAAGATCAGATGGTTCTAGG + Intergenic
981773012 4:148331808-148331830 CAGTAATAAGAGATGGTACTTGG - Intronic
981936428 4:150244854-150244876 CATTTATAGCAGCTGGTTCTTGG - Intronic
981985282 4:150846827-150846849 ATATAAGAACAGATGGTACTGGG + Intronic
982726709 4:158913951-158913973 AATTAACAACAGATGGGGCTGGG + Intronic
984335545 4:178384884-178384906 CATTGAGAACACATGGATCCAGG + Intergenic
987461009 5:18210093-18210115 CAATAATAAAAGATGGTTATTGG + Intergenic
988665874 5:33326745-33326767 CAGTGAGAACACATGGATCTAGG - Intergenic
990426018 5:55689945-55689967 CAATTAGAACAGATTGATCTAGG + Intronic
991141390 5:63248100-63248122 CATCAAGAAAAGATGGTGTTTGG - Intergenic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
992163165 5:74022016-74022038 CAATGAGAACACATGGATCTGGG - Intergenic
992376824 5:76196549-76196571 AATGAAGAACAGATGTTACTTGG + Intronic
992673054 5:79078761-79078783 CATTAAGAACAAGTTCTTCTTGG - Intronic
992857427 5:80877102-80877124 CAAAAAGAACACATGGATCTGGG - Intergenic
993375525 5:87145454-87145476 GTTTAAGATCAGATGGTTGTAGG + Intergenic
993514811 5:88818268-88818290 TTTTATGAACAGATGGTTTTGGG - Intronic
994537077 5:101045891-101045913 CATTAAGAACAGAAGGTGGCAGG - Intergenic
995713270 5:115055856-115055878 CTTTAGGAACAGATGAGTCTGGG + Intergenic
996109161 5:119544397-119544419 CATAAAGATCAGATGGCTGTAGG + Intronic
996504599 5:124255442-124255464 CAGTGAGAACATATGGTTTTTGG + Intergenic
996599247 5:125242680-125242702 GTTTAAGATCAGATGGTTGTAGG + Intergenic
997611051 5:135215997-135216019 GGTTTTGAACAGATGGTTCTGGG - Intronic
997842490 5:137254926-137254948 CATTGGGAACAGAGAGTTCTGGG - Intronic
998496139 5:142591077-142591099 CCTTCAAAACAGATGGTTCCTGG + Intergenic
1001485830 5:172119060-172119082 CATAAAGAACAAAAGGCTCTTGG - Intronic
1004438596 6:15623586-15623608 CATCTAGAACAGAAGATTCTGGG - Intronic
1004550428 6:16641841-16641863 CATTAAGAACATTTGATTCATGG + Intronic
1004880634 6:20003904-20003926 CAGCAGTAACAGATGGTTCTCGG - Intergenic
1005313355 6:24580499-24580521 AATTAGAAACAGGTGGTTCTTGG - Intronic
1008779514 6:55086130-55086152 AAGTAAGAACAGATGGTATTTGG - Intergenic
1009821008 6:68801204-68801226 TATTAAGAACAGAAGATTCAAGG - Intronic
1010892575 6:81332851-81332873 GAATAAGAACTTATGGTTCTGGG + Intergenic
1011008309 6:82673975-82673997 CAGTGAGAACACATGGTGCTTGG - Intergenic
1014890769 6:126842548-126842570 TCTTAAGAACAGACAGTTCTTGG + Intergenic
1015898058 6:138035879-138035901 CATTATGAATAGATTGTTTTTGG + Intergenic
1016033279 6:139359562-139359584 CAATGAGAACACATGGTTTTTGG - Intergenic
1018684566 6:166293932-166293954 GATTCAGAACTGATGCTTCTTGG - Intergenic
1022275406 7:28849990-28850012 CATTCAAAACAAAAGGTTCTGGG + Intergenic
1023471582 7:40527812-40527834 CATTAGAAACATATGGTTCTGGG + Intronic
1024813993 7:53246014-53246036 CATAAAGAAAAGAGGGTTATTGG - Intergenic
1027691830 7:81357048-81357070 AATTGAAGACAGATGGTTCTGGG + Intergenic
1028675669 7:93457825-93457847 CTTTAAGAACACATCTTTCTAGG + Intronic
1028823061 7:95234924-95234946 CATTACTAACAAATGGTGCTGGG + Intronic
1029220159 7:98982355-98982377 CAGAAAGCACAGATTGTTCTAGG + Intronic
1033149420 7:138900277-138900299 CATAAAGAACAGATTGTTGAGGG - Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1034481759 7:151326584-151326606 CGTTAAGAACTGAGGGTCCTGGG + Intergenic
1035594680 8:847089-847111 CATTAAAAACACATGGGCCTGGG + Intergenic
1035664209 8:1368833-1368855 CATCAGGAATAGATGGTTCCAGG - Intergenic
1036220536 8:6918061-6918083 CATTAAAAACAGATGGCTGCAGG + Intergenic
1036633968 8:10535418-10535440 GATGAAGATCAGATGGTTGTAGG - Intronic
1036775517 8:11609197-11609219 CATAAAGAATAAATGGTTTTCGG + Intergenic
1037325755 8:17688465-17688487 CATTAAAAACCGATGTTTGTGGG + Intronic
1038351402 8:26779479-26779501 CTGTAAGAGCAGATGCTTCTAGG + Intronic
1040039309 8:42900101-42900123 AATTTGGAACATATGGTTCTTGG - Intronic
1041944709 8:63427958-63427980 TATTAAGAATATATGGGTCTTGG - Intergenic
1042205939 8:66329710-66329732 CTTTAAAAACACATGGGTCTAGG - Intergenic
1042778252 8:72460032-72460054 TATTAAGAACAGAATGCTCTGGG + Intergenic
1042950714 8:74198457-74198479 CATTAGGAGCAGATGGGACTGGG + Intergenic
1043089286 8:75876999-75877021 TTTTAAGATCAGATGGTTGTAGG + Intergenic
1044746524 8:95376362-95376384 TGTTAAGAAAAGATGGTACTTGG + Intergenic
1045450866 8:102323664-102323686 CATTAAGAAAATTTGTTTCTAGG + Intronic
1045513011 8:102829318-102829340 CATTAAAAGCAGATGGTTCATGG + Exonic
1046087305 8:109454411-109454433 CATTAAAAACACAAGATTCTGGG - Intronic
1047176933 8:122550607-122550629 CATAAAGTAAAGATGGTTATGGG + Intergenic
1048908271 8:139109547-139109569 AATTAAAAATATATGGTTCTAGG + Intergenic
1050840232 9:10139740-10139762 CCTGAAGATCAGATGGTTGTAGG - Intronic
1051044954 9:12861777-12861799 CATTAAGATTATATGGTTTTTGG - Intergenic
1052764544 9:32627402-32627424 TATTAGGAACTGATGATTCTTGG + Intergenic
1054751058 9:68906450-68906472 CATGAATAACAGATTGTCCTTGG - Intronic
1055194682 9:73574608-73574630 CATTGAGAACAGATGGTTAGAGG - Intergenic
1055590624 9:77809490-77809512 CACAAAAAACAGATGGTTGTAGG - Intronic
1056925804 9:90833610-90833632 AATTAAGAAATGATGTTTCTAGG - Intronic
1058385642 9:104431866-104431888 CCTTCAGACCAGATGGTTCTGGG + Intergenic
1061258140 9:129464802-129464824 CAATAAGGGCAGCTGGTTCTGGG - Intergenic
1186811527 X:13193985-13194007 CAATCAGAGCAGATGGTTTTGGG - Intergenic
1187850709 X:23589051-23589073 AAGTAAGAACATATGGTTTTTGG - Intergenic
1188598924 X:31936868-31936890 AATTCAGAAGAGATGGTGCTGGG - Intronic
1188644769 X:32552320-32552342 ATTGAAGAACAGATGGTTGTAGG - Intronic
1189671545 X:43415523-43415545 CATAAAGAACTGAGGGTCCTGGG + Intergenic
1191128027 X:56978643-56978665 CATGAAGAACAGCTGTTCCTAGG + Intronic
1191176801 X:57512198-57512220 GATGAAGATCAGATGGTTGTAGG + Intergenic
1193090393 X:77487876-77487898 CTTGAAGATCAGATGGTTGTGGG - Intergenic
1193152720 X:78141019-78141041 TATTGAGAACACATGGTTCTTGG - Intergenic
1193512867 X:82427346-82427368 CTTAAAGATCAGATGGTTTTAGG + Intergenic
1195900029 X:109787957-109787979 TATTTAGAACAGATTCTTCTGGG + Intergenic
1196189841 X:112782775-112782797 CATTTGGAACAGATGGTTTCTGG + Intronic
1198457679 X:136833074-136833096 CCTAAAGAACTGAGGGTTCTGGG + Intergenic
1201686341 Y:16707512-16707534 CAATAAGAACACATGGTCATAGG + Intergenic