ID: 1147930715

View in Genome Browser
Species Human (GRCh38)
Location 17:43978851-43978873
Sequence CTTCTGATGCAGAGTATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147930715_1147930722 -5 Left 1147930715 17:43978851-43978873 CCCTCCATACTCTGCATCAGAAG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1147930722 17:43978869-43978891 AGAAGGGCCAAGGCATTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 186
1147930715_1147930724 14 Left 1147930715 17:43978851-43978873 CCCTCCATACTCTGCATCAGAAG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1147930724 17:43978888-43978910 TCGGTCTAACCCTTAAACTGTGG 0: 1
1: 0
2: 0
3: 3
4: 28
1147930715_1147930721 -9 Left 1147930715 17:43978851-43978873 CCCTCCATACTCTGCATCAGAAG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1147930721 17:43978865-43978887 CATCAGAAGGGCCAAGGCATTGG 0: 1
1: 0
2: 2
3: 12
4: 179
1147930715_1147930725 15 Left 1147930715 17:43978851-43978873 CCCTCCATACTCTGCATCAGAAG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1147930725 17:43978889-43978911 CGGTCTAACCCTTAAACTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147930715 Original CRISPR CTTCTGATGCAGAGTATGGA GGG (reversed) Intronic
900406931 1:2496870-2496892 CTTCTGCTGCAGAATCTGGTGGG - Exonic
903112649 1:21149950-21149972 CTTCTACTGCAGAGAATGGGTGG + Intronic
903714373 1:25353180-25353202 CTTCTTATCCAGAGCCTGGAAGG + Intronic
904483734 1:30810331-30810353 CTTCTAAGGCAGAGGATGGGGGG - Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
906932156 1:50180623-50180645 CTTCCAATGCATAGTGTGGATGG + Intronic
908080569 1:60573684-60573706 CTCCTGATGAAGAAAATGGAAGG - Intergenic
910387186 1:86697752-86697774 CTGCTGATGAAGAGTAAGGAAGG - Intergenic
911043194 1:93608004-93608026 CTTCTGAGTCAGAGGCTGGATGG + Intronic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
913956399 1:143300260-143300282 CTTGTGATTCAGAATATGAATGG - Intergenic
913956407 1:143300484-143300506 CTTGTGATTCAGAATATGAATGG - Intergenic
913981032 1:143515183-143515205 CTTGTGATTCAGAATATGAATGG + Intergenic
914075396 1:144341611-144341633 CTTGTGATTCAGAATATGAATGG + Intergenic
914075404 1:144341835-144341857 CTTGTGATTCAGAATATGAATGG + Intergenic
914103774 1:144624661-144624683 CTTGTGATTCAGAATATGAATGG - Intergenic
914103782 1:144624885-144624907 CTTGTGATTCAGAATATGAATGG - Intergenic
914775794 1:150733850-150733872 CCTCTGCTGCAGAGTAGGTAAGG - Intronic
915799160 1:158770285-158770307 TTGCTTAGGCAGAGTATGGAGGG - Intergenic
917779787 1:178381305-178381327 CTTCTCATGCAGATTATGGCAGG - Intronic
919527828 1:198676967-198676989 GTCCTGATTCAGAGAATGGATGG + Intronic
921704905 1:218311504-218311526 GTTCTTTTGAAGAGTATGGAAGG - Intronic
922772250 1:228192216-228192238 GTTCTGCTGCAGAGAATGGAGGG + Intergenic
1066781754 10:38956773-38956795 CTTGTGATTCAGAATATGAATGG + Intergenic
1066955273 10:42162822-42162844 CTTGTGATTCAGAATATGAATGG - Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067462422 10:46467491-46467513 CTTCTGCAGCAGAGCATGGGAGG - Intergenic
1072686077 10:97537748-97537770 CTTCTACTGCAGGGGATGGAGGG - Intronic
1072741546 10:97912927-97912949 CTGCTGATGCAGAGGGTGCAGGG - Intronic
1072833013 10:98679228-98679250 CTGCTGATGTAGAGTGAGGATGG - Intronic
1072858203 10:98972721-98972743 CTTTTAGTGCAGAGTATTGAGGG - Intronic
1073677498 10:105665111-105665133 ATTCTGAGGCAGAGAATGCATGG - Intergenic
1074230222 10:111526322-111526344 ATTCTGATGCAGAGGGTAGAAGG + Intergenic
1077537012 11:3129274-3129296 CTTCTGAGGCAGGGTGAGGAGGG + Intronic
1078648243 11:13162772-13162794 CTTATAATGCAGAGGCTGGAAGG - Intergenic
1082201624 11:49378101-49378123 CTTGTGGAGCAGAATATGGAAGG - Intergenic
1083932251 11:65852453-65852475 TTTCTGATGCAGAAGCTGGAGGG + Exonic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1084942660 11:72621328-72621350 CTTCAGCTGCTGAGTATGGGAGG - Intronic
1085119931 11:73960625-73960647 CTTCTGAGGAAGAAAATGGAGGG - Intronic
1087781495 11:102305709-102305731 CTTCAGATGCTGAGTATAAATGG + Intergenic
1089021289 11:115217775-115217797 CTCCTGCTGCAAAGGATGGATGG - Intronic
1089310593 11:117555857-117555879 CCTCTCCTGCAGAGTATGGAGGG + Intronic
1090281528 11:125460336-125460358 CTCCTGATGCCGAGTAAGAAAGG + Intronic
1092174715 12:6395528-6395550 CTACTGAGACAGAGTAGGGATGG + Intergenic
1093061932 12:14616488-14616510 TTTCTCTTGCAGAGGATGGAGGG + Intronic
1098141715 12:67456764-67456786 CTCCTTATGCAAAGTCTGGATGG + Intergenic
1102627324 12:114245525-114245547 CTACTAGTCCAGAGTATGGATGG - Intergenic
1103753062 12:123180405-123180427 TTTCTGTTGCATAGAATGGAGGG - Intronic
1108684009 13:52803357-52803379 CTTCTGATGGAGTGTATGTGGGG + Intergenic
1109162129 13:58988663-58988685 CTTATGGTGAAGAGGATGGAAGG - Intergenic
1110872926 13:80473634-80473656 TTTCCCATGCAGAGTATTGATGG - Intergenic
1114595711 14:23910008-23910030 CTTCTGAGGCAGGGTGTAGATGG + Intergenic
1115467761 14:33734812-33734834 CTTCTGATAAAGGGTAAGGAAGG - Intronic
1116206092 14:41868573-41868595 CTACTGATGCATGGTATGAATGG + Intronic
1116822249 14:49636780-49636802 TTTCTGAAGGAGAGTATAGATGG - Intergenic
1117529799 14:56649026-56649048 CTTCAAATCCAGAGAATGGAGGG - Exonic
1123394310 15:19914114-19914136 CTTGTGATTCAGAATATGAAAGG + Intergenic
1124658027 15:31524461-31524483 CTTGTGAGGCAGAGTTTGAAAGG + Intronic
1128615404 15:69104970-69104992 CTACGGATTCAGAGTAGGGAGGG + Intergenic
1129408294 15:75334267-75334289 CTTCTGTTGCTCAGGATGGATGG + Intergenic
1131814039 15:96203900-96203922 TTTCTGATGCCCAGTTTGGATGG - Intergenic
1132036218 15:98487048-98487070 CTTCTGAGGCAGAGTCAGCAGGG - Intronic
1133663203 16:7939100-7939122 CTTCAGTAGCAGAGGATGGAAGG + Intergenic
1133939040 16:10293189-10293211 ATGCTGGTGCAGGGTATGGAAGG - Intergenic
1135815394 16:25627927-25627949 GTTCTGATGGAGACCATGGAAGG - Intergenic
1136697563 16:32099172-32099194 CTTGTGATTCAGAATATGAATGG - Intergenic
1136700332 16:32132003-32132025 CTTGTGATTCAGAATATGAATGG + Intergenic
1136700339 16:32132227-32132249 CTTGTGATTCAGAATATGAATGG + Intergenic
1136767316 16:32795239-32795261 CTTGTGATTCAGAATATGAATGG - Intergenic
1136767323 16:32795463-32795485 CTTGTGATTCAGAATATGAATGG - Intergenic
1136798064 16:33042454-33042476 CTTGTGATTCAGAATATGAATGG - Intergenic
1136800825 16:33075238-33075260 CTTGTGATTCAGAATATGAATGG + Intergenic
1136800832 16:33075462-33075484 CTTGTGATTCAGAATATGAATGG + Intergenic
1136863576 16:33720635-33720657 CTTGTGATTCAGAATATGAATGG - Intergenic
1136944657 16:34633440-34633462 CTTGTGATTCAGAATATGAATGG + Intergenic
1136947606 16:34672576-34672598 CTTGTGATTCAGAATATGAACGG + Intergenic
1136955014 16:34772534-34772556 CTTGTGATTCAGAATATGAATGG + Intergenic
1136966848 16:34922247-34922269 CTTGTGATTCAGAATATGAATGG + Intergenic
1137085443 16:36115759-36115781 CTTGTGATTCAGAATATGAATGG - Intergenic
1137091888 16:36202558-36202580 CTTGTGATTCAGAATATGAATGG + Intergenic
1137221943 16:46463056-46463078 CTTGTGATTCAGAATATGAATGG - Intergenic
1203069713 16_KI270728v1_random:1057485-1057507 CTTGTGATTCAGAATATGAATGG - Intergenic
1203125066 16_KI270728v1_random:1568780-1568802 CTTGTGATTCAGAATATGAATGG - Intergenic
1143760851 17:9103000-9103022 CTTCTGATGGTGAGTGTGGGGGG + Intronic
1145689249 17:26718423-26718445 CTTGTGATTCAGAATATGAATGG + Intergenic
1145711016 17:26977216-26977238 CTTGTGATTCAGAATATGAATGG + Intergenic
1146706048 17:35001511-35001533 CTCCTGAGGCAGAGCAAGGAGGG + Intronic
1147930715 17:43978851-43978873 CTTCTGATGCAGAGTATGGAGGG - Intronic
1149107232 17:52984008-52984030 TTAGTGATGGAGAGTATGGAGGG - Intergenic
1149138804 17:53404333-53404355 CATCTGAGTCAGGGTATGGATGG + Intergenic
1151179635 17:72317602-72317624 CTTCTGACTCAGAGTGAGGAGGG + Intergenic
1151682685 17:75630121-75630143 CTTCTGCGTCAGAGTATGGAGGG + Intronic
1203182433 17_KI270729v1_random:74071-74093 CTTGTGATTCAGAATATGAATGG + Intergenic
1203190381 17_KI270729v1_random:179570-179592 CTTGTGATTCAGAATATGAATGG + Intergenic
1153724906 18:7944483-7944505 ATTCTGATGCTGGGAATGGAAGG - Intronic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1155884224 18:31187591-31187613 GTTCTGCAGCAGAGGATGGAGGG - Intergenic
1156511057 18:37637197-37637219 CTCCTGATCCAGGATATGGATGG - Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159859108 18:73626009-73626031 GGTATGATGCAGTGTATGGAAGG + Intergenic
1163380157 19:16960919-16960941 CTTCTGAAGAAGGGAATGGAGGG + Intronic
1164701144 19:30285475-30285497 TTTCTGATGCATAATAAGGAAGG + Intronic
1165634522 19:37329357-37329379 CTACTGCTGCAGGCTATGGATGG + Intronic
1166152236 19:40882661-40882683 CTTCTGTTGCGGAGGATGCAGGG + Exonic
1166798588 19:45442781-45442803 CTTCTGATGGAGGGCTTGGATGG + Intronic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
928238948 2:29569872-29569894 CTTATAATGCAGAGGAGGGAAGG - Intronic
928793360 2:34985704-34985726 CTTCTGTTTCAGAGGATTGATGG - Intergenic
931093872 2:58917796-58917818 CCTCTGATGCCGAGTGTCGATGG - Intergenic
938094984 2:128455747-128455769 ATTCTGATGCAGGGCATGCATGG - Intergenic
938220827 2:129565907-129565929 CTGCTGATTCACAGTATGGGAGG - Intergenic
938517142 2:132023237-132023259 CTTGTGATTCAGAATATGAATGG - Intergenic
939826440 2:147021477-147021499 ATTCTGATGCAGAGCATTCAAGG - Intergenic
940278078 2:151960587-151960609 CTTCTGTTCCAGAGACTGGAGGG + Intronic
942160531 2:173181272-173181294 CTTGTGAGGCAGAGGATGGCAGG + Intronic
942553469 2:177146048-177146070 GTTGTGATGCAGATTAGGGAAGG + Intergenic
945011578 2:205469530-205469552 CTTCTGAAGCAGAGACTGGATGG - Intronic
945215716 2:207431840-207431862 CTTTTGATGCAGGGTAGGTAAGG - Intergenic
946127965 2:217581023-217581045 CATGTCATGCAGAGCATGGAAGG + Intronic
947706483 2:232280746-232280768 CTTCGGCTGCAGTGTATGGAGGG - Intronic
1173117996 20:40264393-40264415 CTGCTGCTGCAGAGCTTGGAAGG - Intergenic
1175670245 20:60896390-60896412 CTTCTGCTGTAGAGAAAGGAAGG + Intergenic
1176277668 20:64282071-64282093 CTTCTGTGGGAGAGTATGGAAGG + Intronic
1176584432 21:8565361-8565383 CTTGTGATTCAGAATATGAATGG + Intergenic
1180267244 22:10542265-10542287 CTTGTGATTCAGAATATGAATGG + Intergenic
1182363142 22:29759379-29759401 CTTATGATACAGTGAATGGAGGG - Intronic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
951465937 3:23000541-23000563 CCTCTGGTGTAGAGCATGGAGGG - Intergenic
952118937 3:30218049-30218071 CTTCAGATGTAGATTATGAAGGG - Intergenic
953108765 3:39911863-39911885 CTTCAGAAGCTGAGTAAGGAGGG - Intronic
955480415 3:59384280-59384302 CTCCTGCTGCAATGTATGGAAGG - Intergenic
956923020 3:73950993-73951015 ATTCTTATGCAGAGTAGGAAAGG - Intergenic
957887970 3:86315467-86315489 CTTCTAAAGCAAAGTATTGAAGG + Intergenic
959926438 3:111926690-111926712 CTTCAGAGGCAGAGAATGGTTGG + Intronic
960949621 3:122990764-122990786 CTTCTGAGGAAGAGTAAGCAAGG - Intronic
961134961 3:124501795-124501817 CTTCTGCTGTAGAGTAGGTAGGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
962950241 3:140211994-140212016 CATCTGATGTAAAATATGGATGG - Intronic
964556833 3:157949115-157949137 CTTGTGCTGCAGAGCAGGGAGGG - Intergenic
964735271 3:159911044-159911066 CTTCACATGCACAGTATGAATGG + Intergenic
966591042 3:181683267-181683289 CTTCTGAGGCAGAACAGGGAGGG - Intergenic
969291647 4:6243884-6243906 CTTATGCTGCAGAGTAGGGAAGG - Intergenic
969387627 4:6865802-6865824 ATTCTGATGCAGAGTGGGGCTGG - Intronic
969595150 4:8144529-8144551 CATTTAATGCAGATTATGGAGGG + Intronic
972082316 4:35168439-35168461 CTTCTGAGGCAGGTAATGGAAGG + Intergenic
975962747 4:79932985-79933007 CTTATGATGGAGAATTTGGAAGG - Intronic
976027065 4:80701104-80701126 CTTTTTATTCAAAGTATGGAAGG - Intronic
976255369 4:83094885-83094907 TTTCAGATTCAGAGTTTGGATGG + Intronic
976677900 4:87723662-87723684 CTACAGATTCAGAGTATGGATGG + Intergenic
981672365 4:147301539-147301561 CTTCTGATGCAAGGTATGCTGGG - Intergenic
982834254 4:160103750-160103772 GTTCTAAGGCAGATTATGGAGGG + Intergenic
985776392 5:1846264-1846286 TTTCTGCTGCAGAGTATGGAAGG + Intergenic
986284461 5:6349167-6349189 CTTCTGATGCAAAGTCTCTAAGG + Intergenic
988363457 5:30265816-30265838 CTAACGATGCAGAATATGGAGGG + Intergenic
990384132 5:55242859-55242881 CTTCTGATCCAGACCCTGGAAGG - Intergenic
992765029 5:79990857-79990879 CTGGGGATGCAGAGTAGGGAGGG + Intronic
992809526 5:80372564-80372586 CTTCTGAAGAAGAGTAAAGAAGG + Intergenic
993977347 5:94498604-94498626 CTTCTTATGCAGAAAAGGGAAGG - Intronic
995453762 5:112331173-112331195 CTTCTAATGGAGGGCATGGAGGG + Intronic
999624865 5:153509883-153509905 TTTCTGATGAAGACTCTGGAGGG - Intronic
1000308530 5:160018733-160018755 GTTCTTATACAGAGAATGGAGGG + Intronic
1000718526 5:164677921-164677943 ATCCTGATGCATAGTATGCATGG - Intergenic
1001161923 5:169326562-169326584 TTTATGATGCAGTGTATGGGTGG - Intergenic
1002652387 5:180708988-180709010 TTTCTGAGGCAGAGTTGGGATGG - Intergenic
1004051011 6:12079074-12079096 TTTCTGATGTAGCGAATGGAAGG - Intronic
1007089570 6:39173780-39173802 GTTCTGATGCTGAGTGGGGAAGG - Intergenic
1008642600 6:53480028-53480050 CTTCGTATGCAAAGTAGGGATGG - Intergenic
1012494003 6:99814256-99814278 ATTCTGATGCAGAGCTTGGAGGG + Intergenic
1014935590 6:127381433-127381455 CTTCTGATGGACAGTGTGTATGG - Intergenic
1015538284 6:134289054-134289076 CTTTTATTGCAGAGTATGGAGGG - Intronic
1015712039 6:136152578-136152600 CTTTTGATACAGAGTAATGATGG - Intronic
1016415110 6:143823934-143823956 CTTCTGATGAAGAATATCCACGG - Exonic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1019235105 6:170605256-170605278 CTTCTGTGGGATAGTATGGAAGG + Intergenic
1021797174 7:24267747-24267769 CCTCTGCTGTAGAGTGTGGAAGG + Intergenic
1024807430 7:53160690-53160712 CTTGTGATTCAGAATATGAATGG - Intergenic
1025306216 7:57860140-57860162 CTTGTGATTCAGAATATGAATGG - Intergenic
1025477546 7:60943994-60944016 CTTGTGATTCAGAATATGAATGG + Intergenic
1025482967 7:61008249-61008271 CTTGTGATTCAGAATATGAATGG + Intergenic
1025554580 7:62289665-62289687 CTTGTGATTCAGAATATGAATGG - Intergenic
1025560201 7:62363611-62363633 CTTGTGATTCAGAATATGAATGG + Intergenic
1025563051 7:62395185-62395207 CTTGTGATTCAGAATATGAATGG + Intergenic
1033652038 7:143351088-143351110 TTTCTTATGCAGAGATTGGAGGG + Intronic
1038387556 8:27163564-27163586 CTACTGATGAAGAGGCTGGATGG - Intergenic
1042578590 8:70250595-70250617 CTTCTGAAGCTGGGTATGAAGGG + Intronic
1042689461 8:71481808-71481830 CTTCTGATGGAGAAAAAGGAAGG + Intronic
1046016376 8:108610152-108610174 ATTCTGATGAAGATTATCGAAGG + Intronic
1046722115 8:117632154-117632176 CTCCTGGTTCAGAGTAAGGAGGG + Intergenic
1047548253 8:125840376-125840398 CATATAATGCAGAATATGGATGG + Intergenic
1048028440 8:130608370-130608392 GGTCTGATGGAGAATATGGACGG + Intergenic
1049699428 8:144002480-144002502 CTTCTGAAGAAGATTCTGGATGG + Intronic
1049847103 8:144808142-144808164 CTTCTGGTGCAGAGTGAGGTTGG - Exonic
1053479759 9:38407425-38407447 CTTCTGCTGCATAGTACAGAAGG + Intergenic
1059347420 9:113639010-113639032 CAAATGATGCTGAGTATGGATGG - Intergenic
1059361204 9:113743215-113743237 GTGCTGATGCAGAGTTTGCAGGG - Intergenic
1062452624 9:136621913-136621935 CATCTGCTGCAGAGGAAGGAAGG - Intergenic
1203614332 Un_KI270749v1:42888-42910 CTTGTGATTCAGAATATGAATGG + Intergenic
1186214375 X:7283206-7283228 CTTCTGGTGCACAGTGAGGATGG + Intronic
1188183134 X:27080712-27080734 CTACTGATGCAATGAATGGAAGG - Intergenic
1188461994 X:30438584-30438606 GTTTTGATGCAGAAAATGGAAGG - Intergenic
1188896178 X:35671165-35671187 CTTCTGAGACAGAGTAGGGATGG - Intergenic
1191642619 X:63443869-63443891 CTTATGAAGCATAGTTTGGATGG - Intergenic
1191979410 X:66909471-66909493 CATATGATGCAGAGTGGGGAGGG + Intergenic
1193510325 X:82391513-82391535 CTTCTGGTGTAGAGTTGGGAGGG - Intergenic
1194600568 X:95915798-95915820 CCTCAGTTGCAGAGAATGGATGG + Intergenic
1196006191 X:110839726-110839748 CTTCTGATGCCTAGGCTGGAAGG + Intergenic
1198264891 X:134999911-134999933 CTTCTGAATCAGAGTATCTAGGG - Intergenic
1200846638 Y:7837397-7837419 CTTCTTCTGCTGAGTATGCAGGG - Intergenic