ID: 1147931380

View in Genome Browser
Species Human (GRCh38)
Location 17:43983672-43983694
Sequence CACCCAACGCTCCCCGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147931375_1147931380 -2 Left 1147931375 17:43983651-43983673 CCCTCATTCAACAAGCTCAGACA 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 145
1147931374_1147931380 4 Left 1147931374 17:43983645-43983667 CCACTGCCCTCATTCAACAAGCT 0: 1
1: 0
2: 0
3: 20
4: 209
Right 1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 145
1147931369_1147931380 27 Left 1147931369 17:43983622-43983644 CCCCTCAGATACCACTAGCTCAC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 145
1147931371_1147931380 25 Left 1147931371 17:43983624-43983646 CCTCAGATACCACTAGCTCACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 145
1147931376_1147931380 -3 Left 1147931376 17:43983652-43983674 CCTCATTCAACAAGCTCAGACAC 0: 1
1: 0
2: 0
3: 18
4: 120
Right 1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 145
1147931372_1147931380 16 Left 1147931372 17:43983633-43983655 CCACTAGCTCACCCACTGCCCTC 0: 1
1: 0
2: 4
3: 49
4: 364
Right 1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 145
1147931370_1147931380 26 Left 1147931370 17:43983623-43983645 CCCTCAGATACCACTAGCTCACC 0: 1
1: 0
2: 0
3: 14
4: 210
Right 1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 145
1147931373_1147931380 5 Left 1147931373 17:43983644-43983666 CCCACTGCCCTCATTCAACAAGC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147931380 Original CRISPR CACCCAACGCTCCCCGGGGC CGG Intronic
900170795 1:1267721-1267743 CACCCCACTCACCCCGGGGGAGG + Intronic
900414198 1:2527657-2527679 CACCCAGGCCTCCCTGGGGCAGG - Intergenic
901067862 1:6502918-6502940 GCCCCAGCTCTCCCCGGGGCCGG - Intronic
901686366 1:10945821-10945843 CACTGAAGCCTCCCCGGGGCTGG + Intergenic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
904030035 1:27528018-27528040 CAGCCAAGTCACCCCGGGGCTGG - Intergenic
905235280 1:36542223-36542245 CACCCAGCTTTCCCAGGGGCTGG - Intergenic
908720452 1:67119961-67119983 CACCCATGGCTCCACTGGGCAGG - Intronic
916792730 1:168137486-168137508 CACTCCCCACTCCCCGGGGCTGG - Exonic
921177390 1:212607117-212607139 CACCCACCTCTCCACGGGCCTGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1071563542 10:86660213-86660235 CCCCCCACCCACCCCGGGGCTGG - Intronic
1072938095 10:99732440-99732462 GGCCGAAGGCTCCCCGGGGCGGG + Intronic
1075198732 10:120383438-120383460 CACCAAAGGCTCCCCAGGCCTGG - Intergenic
1076864320 10:133159809-133159831 CACCCGACCCTCCCCGGTCCTGG - Intergenic
1077116009 11:884937-884959 CACCCAGCTCTCCCTGGGCCAGG - Intronic
1077206882 11:1349070-1349092 CACCCGGAGCTCCCCGGGGATGG + Intergenic
1077216680 11:1397978-1398000 CTCCCACCTCTGCCCGGGGCCGG - Intronic
1077331163 11:1984365-1984387 CACCCCAAGCTCCACTGGGCGGG + Intronic
1078797951 11:14612093-14612115 CAACCAAGACTCCCTGGGGCTGG - Intronic
1083772837 11:64878033-64878055 CACCCATCACTCCAGGGGGCGGG - Intronic
1084109225 11:67002743-67002765 CACTCAGCACTCCCGGGGGCAGG - Intergenic
1084956311 11:72693503-72693525 CACCAACCCCTACCCGGGGCTGG + Intronic
1090623008 11:128578191-128578213 CACCCAAAGCTTGCCAGGGCAGG + Intronic
1202814144 11_KI270721v1_random:39541-39563 CACCCCAAGCTCCACTGGGCGGG + Intergenic
1095349178 12:41188862-41188884 CACCCAGGGCTGGCCGGGGCGGG + Exonic
1096109546 12:49020742-49020764 CACCCAACCCGTCCAGGGGCTGG + Exonic
1097182637 12:57179970-57179992 CACCCCATGCTCCCCGGCCCTGG - Intronic
1097191178 12:57220330-57220352 CCCCCACCGCGCCCCGGAGCCGG + Intronic
1101083295 12:101209992-101210014 CTCCGAACGCACCCCGAGGCGGG + Exonic
1102973554 12:117190158-117190180 CGCCCCGCGCCCCCCGGGGCCGG - Intronic
1104929236 12:132329457-132329479 CCCTCACCGCTCCCCGGGGCGGG - Intergenic
1106197631 13:27507975-27507997 CACACAAAGCTCCCCAAGGCAGG - Intergenic
1114516108 14:23301383-23301405 CACCAAAGGCACCCGGGGGCGGG - Exonic
1119757711 14:77130618-77130640 CTCCCAACTGTCCCCAGGGCTGG + Intronic
1123008997 14:105338214-105338236 CAGCCAACACTCTCCAGGGCTGG - Intronic
1124004608 15:25785849-25785871 CACCCACCTCGCCCAGGGGCAGG + Intronic
1124622247 15:31280322-31280344 CTCCCATGGCTCCCCGGGGAGGG + Intergenic
1127922434 15:63504317-63504339 CGCCCCACCCTTCCCGGGGCCGG + Intergenic
1129161902 15:73752179-73752201 CCCCCAAGGCTCCCTAGGGCGGG + Exonic
1130296099 15:82647825-82647847 CACCCGCCGCTCGCCTGGGCGGG - Intronic
1131261403 15:90889947-90889969 CACTCACCGCTCCCGGGGGTGGG - Exonic
1132639733 16:972349-972371 CACACCACGCTCCCGGAGGCTGG - Intronic
1132975972 16:2711425-2711447 CACCCAGGGCTCTCCGAGGCTGG + Intergenic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1134773333 16:16830064-16830086 CACCCATGGCTCTCCTGGGCTGG + Intergenic
1135207966 16:20499080-20499102 CTCCCAGGGCTCCCAGGGGCAGG - Intergenic
1135210933 16:20524620-20524642 CTCCCAGGGCTCCCAGGGGCAGG + Intergenic
1136003687 16:27314241-27314263 CACCCAGCGCTCCCCAAAGCCGG + Intronic
1136717169 16:32290015-32290037 CCACCAACGCTCCCGGGGGAGGG + Intergenic
1136835543 16:33496269-33496291 CCACCAACGCTCCCGGGGGAGGG + Intergenic
1138598326 16:58041209-58041231 CACCGAGCCCTCCTCGGGGCTGG + Intronic
1141450086 16:84093479-84093501 CACTCCACGCTCTCCGGGACAGG + Intronic
1203009261 16_KI270728v1_random:227763-227785 CCACCAACGCTCCCGGGGGAGGG - Intergenic
1143164115 17:4889474-4889496 CACCCAAGGGCCCGCGGGGCTGG - Intronic
1143510539 17:7393204-7393226 CACCTCACGGTCCCCGGGGTCGG + Exonic
1143785599 17:9253400-9253422 GACCAAAAGCTCCCCTGGGCAGG + Intronic
1147132875 17:38419338-38419360 CCCCCTGCGCCCCCCGGGGCCGG + Intergenic
1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG + Intronic
1149122475 17:53186183-53186205 CTCCCAATGCTCCCCCAGGCTGG + Intergenic
1152121885 17:78423868-78423890 CAGCCCACACTCCCTGGGGCTGG - Exonic
1152220671 17:79063452-79063474 TACCCACCGCTTCCCTGGGCTGG - Intergenic
1152427378 17:80225649-80225671 CTCCCAACGCCCCCTAGGGCAGG - Intronic
1156530028 18:37806150-37806172 CACACCAAGCTCCCAGGGGCAGG - Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160764084 19:799334-799356 CACCCAGCTGTCCCCGGGCCAGG - Intronic
1160846435 19:1168186-1168208 CACCCAACGCTGCCCCGGGGTGG - Intronic
1160853635 19:1206284-1206306 CCCCGAACGCTCGCCCGGGCCGG + Intronic
1160979921 19:1812172-1812194 CACCCGCCGCTCACCGGCGCAGG + Exonic
1161295322 19:3516753-3516775 CACTCAACGCTGCCCAAGGCTGG - Intronic
1161324337 19:3656158-3656180 CACCCAGCCCTGCCCGGGGACGG + Intronic
1161400801 19:4065711-4065733 CTCCCCGCGCTCCCCGGGGAGGG - Intronic
1161401586 19:4067947-4067969 CAGCCAGCCCTCCCCGGGCCGGG - Intergenic
1161583063 19:5091243-5091265 CAGTCAACTCTCCCCGTGGCAGG - Intronic
1163604269 19:18265550-18265572 CAGCCAGCTGTCCCCGGGGCAGG + Exonic
1164649394 19:29881054-29881076 CACCCCAGGCTCCCCGCTGCTGG - Intergenic
1165420516 19:35719952-35719974 CACCCCAAGCACCCCGGAGCCGG + Exonic
1165455740 19:35909528-35909550 CACCCACCGCTCCTTGGGCCTGG + Intergenic
1167486670 19:49767003-49767025 CAGCCAGCCCTCCCCGCGGCCGG + Intronic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
927709095 2:25314196-25314218 CACCCCACCCTCCCTGGGTCAGG + Intronic
930097901 2:47580901-47580923 AACCCAACAATCCCCTGGGCCGG + Intergenic
938107829 2:128545286-128545308 CACCCCTCCCTCCCCTGGGCTGG - Intergenic
938108590 2:128549773-128549795 CACCCACCCCACCCTGGGGCTGG + Intergenic
938374754 2:130798080-130798102 CGCCCAGCGTCCCCCGGGGCGGG + Intergenic
938473692 2:131589308-131589330 CACCCAAAGTACCCCCGGGCCGG + Intergenic
946228376 2:218276906-218276928 GCCCCAAAGGTCCCCGGGGCAGG - Intronic
946404093 2:219483619-219483641 CACCCAGGCCTCCCCGGGCCAGG - Exonic
946408643 2:219505775-219505797 CACCCTTCCCTCCCTGGGGCTGG - Intronic
947435512 2:230068764-230068786 CACCAAACGCTCACCTGGCCTGG - Exonic
948980861 2:241494074-241494096 CCCCCAACCCTCCTCAGGGCTGG + Exonic
1171532315 20:25860822-25860844 CTCCCAACCCTCCACCGGGCTGG + Intronic
1172296023 20:33811696-33811718 CCCCCCAGGCTCCCCGGGCCCGG + Intronic
1172523462 20:35583754-35583776 CAGCCAACACACCCCGGGCCTGG + Intergenic
1172591165 20:36119226-36119248 CACCCTGCTCTCCCCAGGGCTGG - Intronic
1172634299 20:36399537-36399559 CACCCATAGCTCCCCAGTGCTGG - Intronic
1172895809 20:38299211-38299233 CCCCCAACGCTTCCGGGGGGAGG - Intronic
1172979248 20:38928413-38928435 CACCCAAAGCACCTCAGGGCTGG - Intronic
1175923206 20:62459450-62459472 CAGCCCAGGCTCCCCGTGGCAGG - Intergenic
1175975478 20:62708565-62708587 CCCCTCGCGCTCCCCGGGGCAGG - Intergenic
1180174613 21:46081612-46081634 CTCCCAGCGCTCCCCCTGGCAGG + Intergenic
1181390828 22:22579687-22579709 CACCCCACTCTCACCTGGGCCGG - Intergenic
1181420175 22:22792380-22792402 CACCCCACCCTCACCTGGGCTGG - Intronic
1182361564 22:29749473-29749495 CACCCAAGGCTCCCCAGGGAGGG + Intronic
1183264930 22:36819197-36819219 CACCCACCGCCCCCCGTGGCTGG - Intronic
1184680595 22:46070718-46070740 CACCCCTTGCTCCGCGGGGCCGG + Intronic
1185018936 22:48362307-48362329 CACCCTGTGCTCCCCAGGGCAGG + Intergenic
950215300 3:11154527-11154549 CACCAAACTTTCCCCGGAGCCGG + Intronic
953748633 3:45593817-45593839 CGCCCAGCGCTGCCAGGGGCGGG + Intronic
953814313 3:46141890-46141912 CAGCCAGCGATCCCCGGGGCTGG + Intergenic
954747187 3:52793988-52794010 CACCCAGAGCTCCTGGGGGCTGG - Intergenic
963056847 3:141193221-141193243 CACCCACTGCTTCCCTGGGCAGG - Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968440810 4:623627-623649 CACTCCACGCTCCCTTGGGCAGG + Intergenic
968505277 4:968447-968469 CCCCCAGGGCTCCCTGGGGCCGG + Intronic
968985328 4:3871719-3871741 CACCCGGGGCTCCGCGGGGCTGG - Intergenic
969590411 4:8118734-8118756 CACACAGTGCTCCCCGGAGCAGG - Intronic
973330492 4:48906628-48906650 CCGTCAACACTCCCCGGGGCGGG + Intronic
975342762 4:73259307-73259329 CACCTCACACTGCCCGGGGCCGG - Intergenic
980517225 4:133878512-133878534 CACCCATCACTTCCCTGGGCAGG + Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
988925864 5:35990779-35990801 CACCCTAAGCTCCATGGGGCCGG - Intronic
996502866 5:124236054-124236076 CACCCAAATCTTTCCGGGGCAGG + Intergenic
996567236 5:124892667-124892689 CACCCACCTCCCCACGGGGCAGG + Intergenic
997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG + Intergenic
1002044990 5:176536760-176536782 CCCCCAAGGCCCCCCGTGGCCGG - Intronic
1006063434 6:31442598-31442620 GACCCCAGGCTTCCCGGGGCTGG - Intergenic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006448541 6:34092888-34092910 CACCCAACCATCCCCAGGACAGG + Intronic
1011099937 6:83709218-83709240 CACACACCGCCCCCCGGGGCCGG + Exonic
1011435585 6:87333261-87333283 CTCCCCACGCTCCCCGAGGAAGG + Intronic
1018031448 6:159845020-159845042 CACTCAGCGCTACCCAGGGCTGG + Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019343622 7:519630-519652 CGCCCTCCGCTCGCCGGGGCCGG + Intronic
1025076955 7:55951886-55951908 CGACCGGCGCTCCCCGGGGCAGG + Exonic
1032404015 7:131642841-131642863 CACCTCACGCTCCCCTGGACTGG - Intergenic
1034435744 7:151062073-151062095 CACCCAAGGCTGCCCAGGGAGGG - Intronic
1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG + Intronic
1037892750 8:22632270-22632292 GACCCTGCGCTCCCCGGGGAAGG + Intronic
1038436806 8:27541891-27541913 CACCTAACGCTCCTCTGGGCTGG - Intronic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1059437170 9:114283896-114283918 GGCCCAGCGCTCCCTGGGGCAGG - Intronic
1061099946 9:128484916-128484938 CACCCAGCCCTCCTCAGGGCAGG - Intronic
1061119630 9:128635041-128635063 CCCCCAAGGCTCACCGGCGCAGG + Intronic
1061498944 9:130991346-130991368 CCCCCAACCCTCCGCGGGACAGG - Intergenic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1185779213 X:2830127-2830149 CACCCACTGCTCCCGGGCGCAGG + Exonic
1189740888 X:44116149-44116171 CCCCCAACAGTCCCCAGGGCTGG - Intergenic
1193061905 X:77215593-77215615 CACTCAACGCTTCCCTGGGTGGG + Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1202044754 Y:20727073-20727095 CACCCCAGGCTCCCCGGCTCCGG + Intergenic