ID: 1147933520

View in Genome Browser
Species Human (GRCh38)
Location 17:43997736-43997758
Sequence GGTCGAAGCCGCATTCGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 2, 2: 1, 3: 4, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147933520_1147933525 6 Left 1147933520 17:43997736-43997758 CCCTTACGAATGCGGCTTCGACC 0: 1
1: 2
2: 1
3: 4
4: 31
Right 1147933525 17:43997765-43997787 CCCCCGCCCGCGTTCCTTTAAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1147933520_1147933531 15 Left 1147933520 17:43997736-43997758 CCCTTACGAATGCGGCTTCGACC 0: 1
1: 2
2: 1
3: 4
4: 31
Right 1147933531 17:43997774-43997796 GCGTTCCTTTAAGGCCATTTAGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147933520 Original CRISPR GGTCGAAGCCGCATTCGTAA GGG (reversed) Intronic
1062792188 10:314785-314807 GGTGGAAGTCCCATTCGTGAGGG + Intronic
1071492187 10:86143596-86143618 GGTGGAAGCTGCATTGGTGATGG - Intronic
1103724336 12:122990269-122990291 GGAAGAAGGCGCATTAGTAAGGG - Intronic
1105626004 13:22113214-22113236 GGTCAAACCCGCATTCGTAAGGG + Intergenic
1108586553 13:51875035-51875057 GGTTAAAGCCGCATTGGTTAGGG - Intergenic
1111510070 13:89249766-89249788 GGTGGAGGCAGCATTCTTAATGG + Intergenic
1127350873 15:58150724-58150746 AGTCAAATCCGCATTCATAAGGG - Intronic
1147933520 17:43997736-43997758 GGTCGAAGCCGCATTCGTAAGGG - Intronic
1161537065 19:4826187-4826209 GGAAGATGCCTCATTCGTAATGG + Intronic
1161646412 19:5455977-5455999 GGTCGAAGGTGCAGTCGTAGCGG - Exonic
1162372001 19:10285146-10285168 GGTAGCAGCCGCAGTCATAATGG + Exonic
1202644483 1_KI270706v1_random:128218-128240 GGTCAAATCTGCATTCATAAGGG - Intergenic
934506863 2:94901821-94901843 GATCAAATCCGCATCCGTAAGGG - Intergenic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
945289373 2:208112451-208112473 GGTCGCTGCTGCATTCGTAGTGG + Intergenic
1171894444 20:30747145-30747167 GGTCAAATCTGCATTCATAAGGG - Intergenic
1176607398 21:8844436-8844458 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180357481 22:11854223-11854245 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180380786 22:12138108-12138130 GGTCAAATCTGCATTCATAAGGG - Intergenic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
973370720 4:49246777-49246799 GGTCAAATCTGCATTCATAAGGG - Intergenic
973390307 4:49548680-49548702 GGTCAAATCTGCATTCATAAGGG + Intergenic
974639607 4:64611179-64611201 GATCAAACCCGCATTCATAAGGG + Intergenic
994459088 5:100050937-100050959 GGTCGAAGCCACATTCGTAAGGG + Intergenic
1022556014 7:31297089-31297111 GGACGAAGCAGCATTCCCAAAGG - Intergenic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1025229495 7:57192095-57192117 GGTCAAATCTGCATTCGTAGGGG - Intergenic
1048337763 8:133515505-133515527 GGTCAAAACCTCATTCGTAGGGG - Intronic
1054354208 9:64045626-64045648 GGTCAAATCTGCATTCATAAGGG + Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1202630198 M:10163-10185 GGTCGAAGCCGCACTCGTAAGGG - Intergenic
1203695132 Un_GL000214v1:91578-91600 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203742540 Un_GL000218v1:14738-14760 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203702731 Un_KI270742v1:9325-9347 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203567558 Un_KI270744v1:104681-104703 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203641141 Un_KI270751v1:12485-12507 GGTCAAATCTGCATTCATAAGGG + Intergenic
1201156068 Y:11132215-11132237 GGTCAAATCTGCATTCATAAGGG + Intergenic