ID: 1147933829

View in Genome Browser
Species Human (GRCh38)
Location 17:43999869-43999891
Sequence TGGAGCAATGCTCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 321}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147933829 Original CRISPR TGGAGCAATGCTCAGGAGGA AGG Intronic
900606041 1:3523972-3523994 TAGAGCCATGCTCCGCAGGAAGG + Intronic
901120088 1:6884175-6884197 GGGAGCAAGGCTGAAGAGGAAGG + Intronic
903533118 1:24047344-24047366 TGGGGCAATTCCCAGGAGGAGGG + Intergenic
903930854 1:26861718-26861740 TGGGGCAATGGTCAAAAGGAAGG + Intergenic
904615513 1:31747380-31747402 AGGAGAACTGCTCAGGAGGCAGG - Intronic
906607908 1:47184242-47184264 TGCAGCAGTCCACAGGAGGAGGG - Intronic
906788566 1:48638223-48638245 TGGGGCAACGCTGAGAAGGATGG - Intronic
907273446 1:53304169-53304191 TGGAGCAATGTTGAGAAGGCTGG - Intronic
907722078 1:56981456-56981478 TGAAGGAATGCACAGGTGGAGGG - Intergenic
908462008 1:64355244-64355266 TGGAGCAAAGAACAGGAGGACGG + Intergenic
908835289 1:68223692-68223714 TGTAGCAATCCCCATGAGGAAGG + Intronic
908839722 1:68266800-68266822 GAGAGTAATGCTCAGGAGGATGG - Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
914251013 1:145921375-145921397 AGGAGAAATGCTAGGGAGGATGG + Intergenic
915111690 1:153567981-153568003 TGGAGGAGTGCTTAGGAGCAAGG + Intergenic
916521223 1:165565026-165565048 TGGTGCAATGCTTAAGAGCATGG + Intergenic
916714004 1:167434932-167434954 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714013 1:167434957-167434979 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714026 1:167434994-167435016 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714039 1:167435031-167435053 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714052 1:167435068-167435090 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714065 1:167435105-167435127 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714078 1:167435142-167435164 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714091 1:167435179-167435201 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714104 1:167435216-167435238 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
916714117 1:167435253-167435275 TGGAGGAGGGCTCCGGAGGAAGG - Intronic
918034647 1:180855898-180855920 GAGAGCAGTGCACAGGAGGAAGG - Intronic
918305291 1:183240425-183240447 TGGAGCAAAGCCCTGGAGCATGG - Intronic
918346702 1:183613693-183613715 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
918653318 1:186993221-186993243 TGCAGCTTTCCTCAGGAGGAAGG - Intergenic
920004827 1:202825499-202825521 TGTGGCAAAGCTCATGAGGAAGG - Exonic
920829067 1:209449308-209449330 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
920935928 1:210434406-210434428 TGCAGGAATGTTCAGGAAGAGGG + Intronic
921083530 1:211764910-211764932 AGGAACAAGGCTCAAGAGGAGGG - Intronic
921115092 1:212082497-212082519 TGGAGCAATGTTAAGCATGAGGG + Intronic
921732529 1:218594112-218594134 TGGAGCAAAGGGCAGGAGGACGG - Intergenic
921733404 1:218599561-218599583 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922887195 1:229029185-229029207 TGGAGCTCAGCTCAGAAGGAAGG + Intergenic
923015349 1:230122088-230122110 TACAGCACCGCTCAGGAGGAAGG - Intronic
923031449 1:230252158-230252180 TAGAGCAGTGCTAAGGAGAAAGG - Intronic
923771021 1:236937420-236937442 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
924454527 1:244208466-244208488 TGTGGAAATGCTCAGGAGGCAGG - Intergenic
1062868407 10:877022-877044 AGGAGCAATGCACAGGATGTGGG + Intronic
1063620644 10:7645024-7645046 TGGAGCCAAGCACATGAGGAAGG + Intronic
1064682875 10:17828974-17828996 TGGAGCCAGCATCAGGAGGAGGG - Intronic
1064863227 10:19850115-19850137 GAGAGCAATGGTCAGGAGGGTGG + Intronic
1065132673 10:22638042-22638064 TGGGGGACTGTTCAGGAGGAAGG - Intronic
1065845514 10:29739557-29739579 TGGAGCAGGGATCAGGAGGCTGG - Intergenic
1066696936 10:38087438-38087460 TGGAGCAAAGCTGGGGTGGAAGG - Intergenic
1067037604 10:42931719-42931741 AGGAGCAACGCCCAGCAGGAGGG + Intergenic
1069842580 10:71348979-71349001 TGGAGCATGGCTGAGCAGGAGGG + Intronic
1070001183 10:72378671-72378693 TGGAGCAATGCAGAGGAGCAAGG + Intronic
1070428974 10:76317049-76317071 TAGAGTAATGGTCAGGAGAAGGG + Intronic
1071907167 10:90187123-90187145 GGGAGAAATGGTCAGAAGGAAGG - Intergenic
1072285094 10:93906472-93906494 TTGAGCAGAGCTCAGGAGGTAGG - Intronic
1073129234 10:101176018-101176040 TGGAGGAATTAGCAGGAGGAGGG + Intergenic
1073286646 10:102393909-102393931 AGGAGCTCTGCTCAGGAGAAGGG - Intergenic
1074948434 10:118303914-118303936 GGGAGCAAAGCCCATGAGGAAGG - Exonic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1076840481 10:133042821-133042843 TGGAGCTGCGCTCTGGAGGAAGG + Intergenic
1079032377 11:16995240-16995262 TGGCCCAGTGCTCAGGAGCATGG - Intronic
1079418131 11:20259831-20259853 TGTAGCAAAGCTCTGGAGGGTGG + Intergenic
1079672874 11:23189219-23189241 TGGAGCAAAGAGCAGGCGGATGG + Intergenic
1080252871 11:30255171-30255193 TGTAGAAATGCTCAAAAGGATGG - Intergenic
1080714929 11:34790909-34790931 TGCAGAAATGCTCAGCTGGATGG - Intergenic
1082163228 11:48907478-48907500 TGGAACAATGCTCAGAATGAAGG + Intergenic
1082169581 11:48987158-48987180 TGGAACAATGCTCAGAATGAAGG - Intergenic
1082234630 11:49808911-49808933 TGGAACAATGCTCAGAATGAAGG + Intergenic
1082238172 11:49845252-49845274 TGGAACAATGCTCAGAATGAAGG - Intergenic
1082608333 11:55269616-55269638 TGGAACAATGCTCAGAATGAAGG + Intronic
1082611466 11:55303763-55303785 TTGAACAATGCTCAGAATGAAGG - Intergenic
1082658451 11:55879927-55879949 TGGAACAATGCTCAGAATGAAGG + Intergenic
1083699301 11:64464513-64464535 TGGAGGGATCCTCAGGAGTAGGG + Intergenic
1083858764 11:65407926-65407948 TGCAGCCATGCGCATGAGGAGGG + Intronic
1083860562 11:65417992-65418014 TGGGTGAGTGCTCAGGAGGACGG + Intergenic
1084628115 11:70324537-70324559 TGGAGCCACTGTCAGGAGGAGGG + Intronic
1084767777 11:71323712-71323734 GGGTGCAGTCCTCAGGAGGATGG + Intergenic
1084789973 11:71468394-71468416 TAGGGCAATGCTCTGTAGGAGGG + Intronic
1084805551 11:71576628-71576650 TGGAGAAATGCTCTGAGGGAGGG + Intergenic
1086043973 11:82510993-82511015 TGGGGCACAGCTCAGAAGGACGG + Intergenic
1086125542 11:83345113-83345135 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1086408405 11:86519571-86519593 TGCAGCTGGGCTCAGGAGGAGGG + Intronic
1086696252 11:89849483-89849505 TGGAACAATGCTCAGAATGAAGG + Intergenic
1086702275 11:89912906-89912928 TGGAACAATGCTCAGAATGAAGG - Intronic
1086703892 11:89931544-89931566 TGGAACAATGCTCAGAATGAAGG + Intergenic
1086709904 11:89995006-89995028 TGGAACAATGCTCAGAATGAAGG - Intergenic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1088695347 11:112361507-112361529 GGGAGCATTGCTGTGGAGGAGGG + Intergenic
1089079845 11:115766481-115766503 AGGAGGAAAGCTCAGGAGGCTGG + Intergenic
1089676908 11:120096451-120096473 TGGATCAAAGCTCAGGAAGGAGG + Intergenic
1090611208 11:128472618-128472640 TGGAGCAGTCCCCAGGATGAGGG - Intronic
1090872235 11:130758614-130758636 TGGAGCAAAGAACAAGAGGACGG + Intergenic
1091074716 11:132604558-132604580 TGGTAGAATGTTCAGGAGGAAGG - Intronic
1092205302 12:6611174-6611196 TGGTGCTCTGCTCAGGAGCAGGG - Intergenic
1092860948 12:12718273-12718295 CGGAGCAATGCGCAGGAATAAGG + Exonic
1093578437 12:20763410-20763432 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1094329422 12:29275004-29275026 TGGAGCAAAGAGCAGGAGGACGG - Intronic
1095508854 12:42927630-42927652 TGGAGCAGGGCTCTGGAAGATGG - Intergenic
1096070679 12:48773913-48773935 TCGAGCAGTGCTCAGGCGGTGGG - Intronic
1096626068 12:52896886-52896908 TGCAGCAAGGCTCAAGAGGCAGG - Intergenic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1097492088 12:60282917-60282939 TGCAGCTATGCTCAGGAAGGTGG + Intergenic
1098429354 12:70402701-70402723 AGGAGAAATGCACAGGTGGACGG + Intronic
1098591653 12:72221281-72221303 TGAAGAAATCCTCAGGAGCATGG + Intronic
1099135384 12:78891727-78891749 TTGAACTGTGCTCAGGAGGAAGG + Intronic
1101789023 12:107911511-107911533 GGGACTAATGCACAGGAGGAGGG - Intergenic
1103504282 12:121430986-121431008 TGGAGCAATTCACAGCATGAGGG + Intronic
1104122747 12:125814643-125814665 TGGAGGAAGTCCCAGGAGGAGGG + Intergenic
1106943183 13:34799408-34799430 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1107826151 13:44330780-44330802 TGGAGCAGTGATTAAGAGGATGG - Intergenic
1112652518 13:101415729-101415751 AGGAGCAATCCACAGGAGCATGG + Intronic
1112721530 13:102251509-102251531 TGCAGCAGTCCTCAGGATGAAGG - Intronic
1113209015 13:107953019-107953041 TGGAGCAATGCTTGAGGGGATGG + Intergenic
1113323970 13:109265571-109265593 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1113385744 13:109846357-109846379 TGGAGCTTTGCTCACGAGGCTGG - Intergenic
1115240921 14:31250598-31250620 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1116179370 14:41516372-41516394 TGGAGCAAAGAACAGGAGGACGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116952614 14:50893662-50893684 TGGAGCAAAGAGCAGGAGGATGG - Intronic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1124220284 15:27845295-27845317 TGGAGGAAAGCTAAGGAGAATGG + Intronic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1128111807 15:65081184-65081206 TTCAGCACTGGTCAGGAGGAAGG - Intergenic
1129473250 15:75766706-75766728 GGGGGCAATGCTCAGGGGGCAGG + Intergenic
1130827972 15:87568939-87568961 TGGAGTGCTGCTCTGGAGGATGG - Intergenic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1134273901 16:12758774-12758796 TGGAGCAGTGTTCAGGAAGAAGG + Intronic
1137238490 16:46634559-46634581 GGGATCAATGCCCAGGAGTATGG - Intergenic
1137315594 16:47317846-47317868 TGGAGCAGTGTTCAAAAGGAAGG - Intronic
1137480622 16:48849130-48849152 TGAACCAATGCACAGAAGGAGGG + Intergenic
1137848001 16:51710714-51710736 TGGAGCCAGGCTCTGGAGGCTGG - Intergenic
1138962048 16:62038772-62038794 TGGAGCATTGCGGGGGAGGAAGG + Intergenic
1139544289 16:67642385-67642407 TGGAGCCATGCCCAGGTGGAGGG - Intergenic
1139649700 16:68356131-68356153 TGGATCACAGCTCAGGAAGATGG + Intronic
1140456481 16:75108788-75108810 TGAAGGAATGCTAAGGAGGTAGG - Exonic
1143491934 17:7289895-7289917 TGGGGCAAGGGACAGGAGGATGG - Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1144104331 17:11972239-11972261 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1144626057 17:16845012-16845034 TGGAGCAGGGGTCAGCAGGAAGG - Intergenic
1144880376 17:18427708-18427730 TGGAGCAGGGGTCAGCAGGAAGG + Intergenic
1145151859 17:20516679-20516701 TGGAGCAGGGGTCAGCAGGAAGG - Intergenic
1146163227 17:30570950-30570972 TGGAGCAGGGGTCAGCAGGAGGG - Intergenic
1146270811 17:31484468-31484490 TGGTGCTATGCTCAGAAGGCAGG + Intronic
1147220461 17:38925799-38925821 TGGAGAACAGCTCAGAAGGAAGG + Intergenic
1147933829 17:43999869-43999891 TGGAGCAATGCTCAGGAGGAAGG + Intronic
1148464351 17:47856053-47856075 TGGAGGAAAACTCAGGAAGAGGG - Intergenic
1148772545 17:50075743-50075765 AGGAGCAAGGGTCAGGATGAGGG + Intronic
1149302921 17:55321212-55321234 TGAAGCAAAGCTGAGGAGGCAGG - Exonic
1149591574 17:57833617-57833639 TGGAGAAATGTTCAGCAGCAAGG + Intergenic
1151138651 17:71971267-71971289 TGGAGAAATGGTCTGGAGGATGG + Intergenic
1151214657 17:72569358-72569380 TGGTACAATGCCCAGGAGGAGGG + Intergenic
1152195958 17:78918505-78918527 TGGAGAGATGGTCAGGAGCATGG - Intronic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1157472113 18:47997577-47997599 TGGAGCAGAGCTCAGGATGTAGG + Intergenic
1158091447 18:53718407-53718429 TGGAGAAATGCTGAGCAAGAGGG + Intergenic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1159621607 18:70645247-70645269 TGGAGTAATGTCCAGGATGAGGG - Intronic
1160306917 18:77748533-77748555 CCGAGCAATGCTCAGTAGCACGG - Intergenic
1163324580 19:16594989-16595011 AGGAGCAGAGTTCAGGAGGAAGG - Intronic
1163466775 19:17472429-17472451 GTGCGCAATGCTCAGGAGTATGG - Intronic
1164483719 19:28636930-28636952 TGCTGCAATGCTCAGGAACAAGG - Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165687602 19:37835514-37835536 TGGGGCATTGTTCAGGAGGTGGG - Intergenic
925167520 2:1727255-1727277 TGGTCCAAGGCTCAGGAGGAGGG - Intronic
925264856 2:2559917-2559939 TGCAGCAGTGCTCAGTTGGAGGG - Intergenic
926037539 2:9647017-9647039 TGGGACCATGCTCAGGAAGATGG - Intergenic
926109218 2:10171413-10171435 GGAAGCACGGCTCAGGAGGAAGG - Intronic
926819410 2:16836077-16836099 TGGAGTAGAGCTAAGGAGGATGG + Intergenic
927154236 2:20212555-20212577 TGAAGCCATTCCCAGGAGGAGGG + Intronic
927851942 2:26504831-26504853 TGGGGCCATACCCAGGAGGAGGG - Intronic
929402222 2:41597731-41597753 TGGAGCAGTCCTCAGGACAATGG - Intergenic
930166747 2:48210590-48210612 TGGAGCTTTTCTCAGGAGAATGG - Intergenic
932359161 2:71090473-71090495 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
932974266 2:76579180-76579202 CGGAGCAAAGAACAGGAGGACGG + Intergenic
933012767 2:77088726-77088748 AGGAGCAAAGAGCAGGAGGACGG - Intronic
933078979 2:77965618-77965640 TGGAGCAAAGAACAAGAGGAAGG - Intergenic
933329825 2:80879722-80879744 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
934125133 2:88881148-88881170 AGAAGCAGTGGTCAGGAGGAAGG - Intergenic
936994239 2:118396841-118396863 TGGATAAATGCTCAAGGGGATGG - Intergenic
937727171 2:125180939-125180961 GGGAGCCATGATCAGAAGGATGG - Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
938774759 2:134531667-134531689 TGGAGCAAGGCACAGGAGAAGGG + Intronic
939153711 2:138501279-138501301 TGGAGCAGTTTTCAGGTGGAGGG - Intergenic
941041920 2:160632924-160632946 TGGAGTAGTGTTCAGGAGAAGGG + Intergenic
941340105 2:164296310-164296332 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
942435851 2:175975563-175975585 TGGATGAATGCTCAAGGGGAAGG - Intronic
943667094 2:190620350-190620372 TGGAAGAATGCTCAGGGGAAAGG + Intergenic
944028177 2:195197518-195197540 TGGAGAAATACACATGAGGAAGG - Intergenic
944129974 2:196337217-196337239 CGGAAGAATGCTCAGAAGGATGG + Intronic
945023190 2:205594584-205594606 TGAAGCTATGCTCTTGAGGAAGG - Intronic
945177008 2:207053123-207053145 TGGGGCAAGGCCCAGGAGGAAGG + Intergenic
946920779 2:224580017-224580039 TGGAACAAAGCCCAGGAGTAAGG + Intronic
948628098 2:239283115-239283137 AGGAGCAATGCTGAGGCTGAGGG + Intronic
948630472 2:239299363-239299385 TGGTGCAATGATCAGGACGGAGG + Intronic
948671097 2:239569448-239569470 AGGTGCAATGCTCCGTAGGAGGG + Intergenic
949035987 2:241815972-241815994 TGGAGGAAGGCACAGGGGGACGG - Intronic
1169092020 20:2866663-2866685 TAGAGCAATGCTGAGGAGCGGGG + Exonic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169880393 20:10341184-10341206 TGCAGCAATGCCCAGGAGTGTGG - Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170786791 20:19474204-19474226 TGAAGCAAGGCACAGCAGGACGG + Intronic
1171328514 20:24317526-24317548 GGGAGCAAGGCAGAGGAGGAAGG - Intergenic
1173691348 20:44963552-44963574 TTGAGCATGGCTCAGCAGGAAGG - Intergenic
1173839003 20:46144809-46144831 TGGAGGAATCCTCAGAAGGTGGG + Intergenic
1174649150 20:52110124-52110146 TGGAGCACTTCTCAGGTGGCTGG - Intronic
1174682516 20:52422476-52422498 TGGATAAATGCTTGGGAGGATGG - Intergenic
1176110956 20:63410510-63410532 TGCGGCAAGGCACAGGAGGACGG + Intronic
1176379744 21:6106290-6106312 TGGAGCCAAGCTGAGGAGCAAGG - Intergenic
1177040785 21:16107731-16107753 TGATGCAGTGCTGAGGAGGAAGG + Intergenic
1177073563 21:16543290-16543312 TGAAATAATGCTCAGGAAGACGG - Intergenic
1177774098 21:25549152-25549174 TGTAGCCATGCTCAGGAGCCAGG - Intergenic
1178141215 21:29685963-29685985 CTGACCCATGCTCAGGAGGAAGG + Intronic
1179743730 21:43431947-43431969 TGGAGCCAAGCTGAGGAGCAAGG + Intergenic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1181114387 22:20621941-20621963 TGAGGCACTGCTCAGGAGCAGGG - Intergenic
1182547252 22:31083404-31083426 TGGGGGAAAGGTCAGGAGGAGGG + Intronic
1183384914 22:37509195-37509217 TGGAACAATGGCCAGGAGGCAGG + Intronic
1183546872 22:38458976-38458998 AGGAACAATGGTCTGGAGGAAGG + Intergenic
1183947200 22:41333167-41333189 TGCTGCAAAGCTCTGGAGGAGGG - Intronic
1184330311 22:43823085-43823107 GGGAGCCAGGGTCAGGAGGAGGG - Intergenic
1184944055 22:47788460-47788482 TGCAGGATTTCTCAGGAGGAGGG + Intergenic
949229224 3:1730743-1730765 TGGAGCAATGGTCTGAAGGTGGG - Intergenic
950867930 3:16204246-16204268 AGGAGGAATGGTCATGAGGAAGG - Intronic
950987408 3:17389687-17389709 TTGAGCAGGGCTCAGTAGGATGG - Intronic
951904913 3:27695564-27695586 TGGATAAATGCTTAAGAGGATGG + Intergenic
952657386 3:35802136-35802158 TGCAGCTGTGCCCAGGAGGATGG + Intergenic
952931504 3:38364458-38364480 TGAAACCATGCTCAGGAGGCTGG - Intronic
954659805 3:52221036-52221058 TGGAGGCATGGACAGGAGGAGGG - Intergenic
954941144 3:54374380-54374402 TGGAGCCCTGCTCAGGGCGAGGG + Intronic
955583633 3:60452260-60452282 TGGTGCAGTGCTCAGGAAGTAGG - Intronic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
956697429 3:71930471-71930493 TGCAGGAATGCAGAGGAGGAAGG - Intergenic
958265617 3:91434117-91434139 TTGCCCAATGCTCAAGAGGAGGG + Intergenic
959521273 3:107325711-107325733 GAGAGCAATTCTCAGGAGAAGGG - Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
961459378 3:127040522-127040544 TGGAGAAGTGCGCAGGTGGAGGG + Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
962105366 3:132383478-132383500 TGTGGCCATGCTCAGGAGAATGG + Intergenic
963086255 3:141439196-141439218 TGGAGATATGAACAGGAGGAAGG - Intronic
964015531 3:151941259-151941281 TGGAGCTATGCTGAGAAGAAAGG - Intergenic
967459119 3:189724781-189724803 TGGAACAGTGCTCAGCACGAAGG - Intronic
968825776 4:2895667-2895689 TGGTGCACAGCTGAGGAGGAGGG - Intronic
969538493 4:7771056-7771078 TGAAACAGTGCTGAGGAGGAGGG - Intronic
971075015 4:23138307-23138329 TGGAGAAATGCTAAGGAGCTGGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG + Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
979956293 4:126956791-126956813 TGGAGTAATACTCAGGCAGAAGG + Intergenic
980205359 4:129712527-129712549 TGGAGATATGTTGAGGAGGAGGG + Intergenic
980388620 4:132118642-132118664 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
980612083 4:135172615-135172637 GGGAGCAAAGAGCAGGAGGATGG + Intergenic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
982535123 4:156600696-156600718 TGGAGCAAAGAACAGGAGGATGG - Intergenic
982997062 4:162362596-162362618 TGGGGGAATGCTGAGAAGGATGG + Intergenic
983055200 4:163093654-163093676 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
983360086 4:166716627-166716649 CGGAGCAAAGAACAGGAGGACGG - Intergenic
984566949 4:181342601-181342623 TGGAGAAATCGCCAGGAGGACGG + Intergenic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
985443232 4:190000335-190000357 TGAAGCAATGGTCAGGATGCAGG + Intergenic
986034843 5:3927626-3927648 TGGCTCAAGGCTGAGGAGGATGG - Intergenic
986453295 5:7888952-7888974 AGGAGCTATTGTCAGGAGGAGGG - Intronic
986502369 5:8414542-8414564 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
986551130 5:8957209-8957231 TATGGCACTGCTCAGGAGGAAGG - Intergenic
986905490 5:12490372-12490394 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
988484750 5:31659367-31659389 TGAGTCAGTGCTCAGGAGGAGGG - Intronic
989973142 5:50548520-50548542 TGGAACACTCCTCAGGAGCAAGG - Intergenic
991085779 5:62647228-62647250 TGGAGCCAGGCTCTGGAAGATGG + Intergenic
991258991 5:64646441-64646463 TGGGGCAATTCTCAGGAGAAGGG + Intergenic
993836359 5:92824225-92824247 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
994532897 5:100989721-100989743 TGGAGCAAAGAGCAGGAGGAGGG + Intergenic
994632987 5:102308766-102308788 TGGAGCTAGGGTCAGCAGGAGGG - Intergenic
994879215 5:105464614-105464636 TAGAGCGATGCACATGAGGAAGG + Intergenic
995973077 5:117996894-117996916 TAGGGCACAGCTCAGGAGGAAGG + Intergenic
996799478 5:127387208-127387230 TGGAGAGGTGCTCTGGAGGAAGG - Intronic
997360020 5:133289064-133289086 TGCAGCATTTCTCAGGAGCAAGG + Intronic
997746126 5:136301885-136301907 TGGAGCAAAGAGCAGGAAGACGG - Intronic
997872296 5:137516631-137516653 TGGAGGCAAGTTCAGGAGGAGGG + Intronic
997872494 5:137517550-137517572 TGGAGGCAAGTTCAGGAGGAGGG + Intronic
999231698 5:150065606-150065628 TGGGGCAAGGCAGAGGAGGATGG + Intronic
999360503 5:150982219-150982241 TAGAGAAAAGCTGAGGAGGAGGG - Intergenic
1000294292 5:159899533-159899555 AGGAGTCCTGCTCAGGAGGATGG - Intergenic
1000873188 5:166602763-166602785 AGGATCAATGCTCAGTTGGATGG + Intergenic
1001566916 5:172705685-172705707 TTCAGCACTGCTCATGAGGAGGG - Intergenic
1001653439 5:173330694-173330716 TGGAGCGATGGCCAGGGGGATGG + Intergenic
1002856073 6:1039378-1039400 TGGAGCAATCCTCAGGAATCCGG - Intergenic
1003564320 6:7209815-7209837 TTGAGAAATTCTCAGGAGTAGGG - Intronic
1010694672 6:78956127-78956149 TGGTAGAATGCTCAGGAGAAGGG - Intronic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1010969900 6:82252379-82252401 AGGAGCAATTCTCAGTAAGATGG - Intergenic
1011213626 6:84981329-84981351 TGGAGAAATGCAGAGGATGAGGG + Intergenic
1011551547 6:88535281-88535303 TAGAGGAATGCTCAGGAGAAGGG + Intergenic
1012325933 6:97917511-97917533 TGGAGCAGTGCACAGCAGCAAGG + Intergenic
1012889829 6:104885549-104885571 TGCAGCAGTGCCCAGGAGCATGG - Intergenic
1012959825 6:105610579-105610601 TGGATAAATGCTCAAGGGGATGG - Intergenic
1013828757 6:114247700-114247722 TGCAGCAATGCTCAGAGGCATGG - Intronic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015693657 6:135955962-135955984 TGCAGCACAGCTCAGAAGGAGGG + Intronic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016884314 6:148944965-148944987 TAGAGCAATGCTCAGAAAGATGG - Intronic
1018726132 6:166614739-166614761 TGGAGGAAGGGTCAGGAGCAAGG - Intronic
1019519167 7:1452914-1452936 TGGAGCCATGGTCTGGAGGCTGG - Intronic
1019549522 7:1595055-1595077 TGGAGGGATGGACAGGAGGATGG - Intergenic
1019907728 7:4077358-4077380 TGGTGGAATGCTCTGGAGAATGG - Intronic
1021960602 7:25869179-25869201 TGGCACAAAGGTCAGGAGGAAGG - Intergenic
1022372596 7:29785441-29785463 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1022389227 7:29928955-29928977 TGGAGCAGTGGGGAGGAGGAGGG + Intronic
1022710322 7:32843027-32843049 TGGAGCAAAGAGCAGAAGGAGGG + Intergenic
1023237805 7:38108831-38108853 TGAAGCAAGGCTCAGGAGTTAGG - Intergenic
1023879097 7:44308510-44308532 TGGGGGGATGCACAGGAGGAGGG - Intronic
1026869551 7:73842124-73842146 AGGAGCATGGCCCAGGAGGAGGG - Exonic
1027774528 7:82447262-82447284 AGTATCAATGCTCAGGAGAATGG + Intergenic
1028037960 7:86009116-86009138 TGAAGCTATTCTCAGCAGGATGG + Intergenic
1029347674 7:99990567-99990589 TGGAGCAATGGTCGGGGGGTGGG - Intergenic
1030524529 7:110637381-110637403 TGGAGCTATGCTTGGCAGGAAGG - Intergenic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031728221 7:125264117-125264139 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031777029 7:125918022-125918044 TGGAGCAAAGAGCAGGAGGAAGG - Intergenic
1032301337 7:130690099-130690121 AGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1033465324 7:141583971-141583993 TGGAGCAAAGAGCAGGAGGACGG + Intronic
1036453787 8:8891736-8891758 TGGAGGGATGCCCAGGAGGAGGG - Exonic
1037121288 8:15290415-15290437 TGGAGCCAGCCTCAGGAGGCAGG + Intergenic
1042332899 8:67599805-67599827 TGGAGAAATGCTCAGCTAGAGGG + Intronic
1042930514 8:74008722-74008744 GGGATCAATGCTCAGGAGAAAGG + Intronic
1043937284 8:86156108-86156130 TGATGAAATGTTCAGGAGGAGGG - Intergenic
1044148786 8:88747350-88747372 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1044359133 8:91260785-91260807 TGTAGCAAGTCACAGGAGGAAGG + Intronic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044612857 8:94111458-94111480 TGGAAAAATGCTCAGGGTGAAGG - Intergenic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1047730731 8:127725996-127726018 TGGAGCAAGGGTGACGAGGATGG - Intergenic
1047829823 8:128617106-128617128 GGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1048168741 8:132085479-132085501 TGGAGCAAAGAACAGGAGGACGG + Exonic
1048585748 8:135772508-135772530 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1048685376 8:136899173-136899195 TGGAGCTATGTTCTGGTGGAAGG - Intergenic
1049352859 8:142173329-142173351 TGGAGGATGGCTCAGGGGGAAGG + Intergenic
1050474638 9:6027798-6027820 AGAAGCAATGCTTAGGGGGAGGG + Intergenic
1052353881 9:27484685-27484707 AGGTGCAAGGCTCAGGAGGTGGG - Intronic
1052374309 9:27700636-27700658 TGGAGCAAAGTTGAGGGGGAAGG + Intergenic
1052378257 9:27741865-27741887 TGGAACAAAGCTGAGAAGGAAGG - Intergenic
1054710281 9:68504241-68504263 TGGAGGAGTGCACAGGAGGCTGG - Intronic
1055798632 9:80005382-80005404 TGCAGCAATGATCAGGAAGAAGG + Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1057004968 9:91549040-91549062 TGGAGCCAAGAGCAGGAGGAAGG - Intergenic
1057029738 9:91766386-91766408 TGGAGAAATGCCCAGGAGCCAGG - Intronic
1057377691 9:94540349-94540371 TGGAGCAAAGAGTAGGAGGACGG - Intergenic
1059156894 9:111997994-111998016 TGGGGCCATGATCAGGATGACGG + Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1060017777 9:120101813-120101835 TGGTGCAATGCTGAGGTGCATGG - Intergenic
1061608646 9:131730897-131730919 TGAAGGAATCCTCAGGATGATGG + Intronic
1062294172 9:135814877-135814899 TGGAGGAACACCCAGGAGGACGG - Intronic
1062307338 9:135915633-135915655 TGGAGCAATGATGAGCAGAATGG - Intergenic
1062406529 9:136399515-136399537 GTGAGCAATGATCAGCAGGAAGG + Intergenic
1062633884 9:137479750-137479772 TGCAGCAATGGCCAGGTGGAAGG + Intronic
1185536040 X:862344-862366 TGGGGCCACCCTCAGGAGGAAGG - Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1185961015 X:4545799-4545821 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189556892 X:42154222-42154244 TGGAGAACTCCTCAGGAGGAAGG + Intergenic
1191016519 X:55814681-55814703 AGGAGCAATACTCAGGCAGAAGG + Intergenic
1191755533 X:64588456-64588478 TAGAGCAATGCACATGAAGACGG - Intergenic
1192292556 X:69813162-69813184 TGGAGCAGTGCTCATGAGAAAGG - Intronic
1192989077 X:76429739-76429761 TTGGGAAATGCTCTGGAGGATGG + Exonic
1193241761 X:79178935-79178957 AGGATAAATGCTCAGGGGGATGG + Intergenic
1193941161 X:87682181-87682203 TGGAGCAGAGAGCAGGAGGATGG - Intergenic
1195624374 X:106992344-106992366 TGGTGGAATGCTGTGGAGGAGGG - Intronic
1196533833 X:116817702-116817724 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1196755782 X:119156060-119156082 TGGAACAGTGCTCAGGAAGGAGG + Intergenic
1196890648 X:120287714-120287736 GGAAGCAAGCCTCAGGAGGAGGG + Intronic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1198404070 X:136295275-136295297 TGGGGAATTGCTCTGGAGGATGG - Intergenic
1198479828 X:137031177-137031199 TGGAGGAGTGCTCTGCAGGATGG + Exonic
1198526268 X:137504027-137504049 TGGTGGATTGCTGAGGAGGAGGG + Intergenic
1199012531 X:142774738-142774760 TCAAGCAGTGCACAGGAGGAAGG + Intergenic
1199576160 X:149316084-149316106 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
1200764422 Y:7068445-7068467 TGGAGCAGTGGTCAGTGGGACGG - Intronic