ID: 1147935371

View in Genome Browser
Species Human (GRCh38)
Location 17:44007684-44007706
Sequence AGGCTCCGGCCAGATGCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147935361_1147935371 16 Left 1147935361 17:44007645-44007667 CCTGGACAAATTTGTGGTGAGCT 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG 0: 1
1: 0
2: 4
3: 11
4: 154
1147935365_1147935371 -7 Left 1147935365 17:44007668-44007690 CCAGCCGCCAGGGCCAAGGCTCC 0: 1
1: 0
2: 3
3: 32
4: 300
Right 1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG 0: 1
1: 0
2: 4
3: 11
4: 154
1147935357_1147935371 23 Left 1147935357 17:44007638-44007660 CCCCGTACCTGGACAAATTTGTG 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG 0: 1
1: 0
2: 4
3: 11
4: 154
1147935358_1147935371 22 Left 1147935358 17:44007639-44007661 CCCGTACCTGGACAAATTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG 0: 1
1: 0
2: 4
3: 11
4: 154
1147935360_1147935371 21 Left 1147935360 17:44007640-44007662 CCGTACCTGGACAAATTTGTGGT 0: 1
1: 0
2: 0
3: 19
4: 260
Right 1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG 0: 1
1: 0
2: 4
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147935371 Original CRISPR AGGCTCCGGCCAGATGCTGT GGG Exonic
900151275 1:1180283-1180305 GGGCCCCGGCCGGGTGCTGTGGG - Exonic
900576937 1:3387662-3387684 AGGAGCCGGCCAGAGGCTGGAGG + Intronic
900987670 1:6082653-6082675 AGGCTCCGGCCAAGTGCTGTGGG + Intronic
901373233 1:8817944-8817966 AGGCGGCGGCCAGAGGCGGTGGG + Intergenic
901914014 1:12484024-12484046 AGGCTTCAGCCAGATGTTTTTGG + Intronic
902468251 1:16631051-16631073 AGGCTGCGGTCGGACGCTGTTGG + Intergenic
902626824 1:17681602-17681624 AGTGTTCGGCCAGGTGCTGTGGG + Intronic
902642384 1:17775165-17775187 AGGCTGAGGCCAGATGGTGCAGG + Intronic
904879714 1:33686452-33686474 AAGCACTTGCCAGATGCTGTAGG + Intronic
906188231 1:43878068-43878090 GGGCTCCCTCCAGATGCTCTAGG + Intronic
906270313 1:44472656-44472678 AGGCTGAGGCCAGATCCTGAAGG - Intronic
908151277 1:61305353-61305375 AGGTTCTGGCCTGATGCTTTGGG - Intronic
914800107 1:150954970-150954992 AGGAGCAGGTCAGATGCTGTAGG + Intronic
915742705 1:158131432-158131454 AGGCTCCCTCCAGAGGCTATAGG - Intergenic
920644930 1:207795003-207795025 AGTCTCTGGCAAGATGCTTTAGG + Exonic
923015016 1:230120082-230120104 ATGCTCCGGCCAGGTGCCGAGGG - Intronic
924404761 1:243730910-243730932 AGGGTCCGGCCAGCTGTGGTGGG - Intronic
924567414 1:245210254-245210276 AGGCTGAGGCCAGAGGCTGCGGG - Intronic
1062957841 10:1552034-1552056 AGGCTCAGGCCACATGCGGGAGG - Intronic
1065060868 10:21899411-21899433 AGACTCCAGCCTGTTGCTGTTGG - Intronic
1065803089 10:29370359-29370381 AGGCTCCGGAGAGGTTCTGTGGG + Intergenic
1067711908 10:48656509-48656531 AGGCTCGGGCGAGATGAGGTTGG - Intergenic
1070013649 10:72502504-72502526 GGGCATCAGCCAGATGCTGTGGG - Intronic
1070547268 10:77462704-77462726 AGACACCAGGCAGATGCTGTGGG - Intronic
1071458429 10:85869009-85869031 AGGCTACCTCCAGATGCTGCAGG - Exonic
1075129151 10:119723923-119723945 AGGCTCCAAACACATGCTGTGGG - Intergenic
1076606521 10:131693044-131693066 AAGCTGCGGGGAGATGCTGTGGG - Intergenic
1076845829 10:133069159-133069181 CAGCTCCTGCCAGCTGCTGTGGG + Intergenic
1077330998 11:1983744-1983766 AGGTTCCGGGCTGAGGCTGTGGG - Intronic
1077904025 11:6514884-6514906 AGACTCTCGCCAGATGCTCTTGG - Intronic
1078165551 11:8880809-8880831 AGGCTTGGGACAGTTGCTGTGGG - Intronic
1079346748 11:19659346-19659368 AAGCTACGGCCAGATGGTGTAGG + Intronic
1080152967 11:29075878-29075900 CGGCTCCGGGCTGGTGCTGTGGG + Intergenic
1080461289 11:32457224-32457246 AGCCTCATGCCAAATGCTGTAGG - Intergenic
1081623669 11:44634229-44634251 AGCCTTGGGCCAGATGCTGGAGG - Intergenic
1085019025 11:73193454-73193476 GGGCTCCTGGCAGAGGCTGTGGG - Intergenic
1085201465 11:74704728-74704750 AGGCTGCAGCAAGAGGCTGTGGG + Intronic
1085400789 11:76234380-76234402 AGGCTCCAGCCAGCTCCTGAAGG + Intergenic
1085802206 11:79601067-79601089 AGGCTTTGGCCAAATGCGGTTGG - Intergenic
1087881297 11:103419106-103419128 AGACTCCAGCCTGTTGCTGTGGG - Intronic
1089781354 11:120875341-120875363 AGGATCCAGCCTGCTGCTGTTGG - Intronic
1090044746 11:123321249-123321271 GGGCTCCGGCCAGATGTTGTAGG - Intergenic
1091215543 11:133899205-133899227 AGGCTCCTGGCAGTGGCTGTGGG + Intergenic
1202813977 11_KI270721v1_random:38920-38942 AGGTTCCGGGCTGAGGCTGTGGG - Intergenic
1098488317 12:71047083-71047105 AGGGTCTGGCCAGCTGCTTTGGG + Intergenic
1099015477 12:77338902-77338924 AGGCTCAGGCTAGCTGCTGGGGG + Intergenic
1100100051 12:91092122-91092144 AGACTCCAGCCTGTTGCTGTTGG + Intergenic
1100877745 12:98980764-98980786 AGGCTCAGGCTAGAAGCTGAGGG - Intronic
1103019582 12:117523264-117523286 AGGCCCAGAACAGATGCTGTGGG - Intronic
1107037106 13:35912949-35912971 AGGATCCGGCCAGCTACTCTGGG - Intronic
1107845509 13:44508697-44508719 AAGCAGGGGCCAGATGCTGTAGG - Intronic
1111956084 13:94759862-94759884 AGGCTTTGGGCAGAAGCTGTGGG + Intergenic
1114917392 14:27285716-27285738 ATGCTCAGGACAGAAGCTGTTGG - Intergenic
1116712206 14:48383109-48383131 GGGATCCGGCCAGCTGCTTTTGG + Intergenic
1117058062 14:51933075-51933097 ATGCTCCTGCCAGAGGCTCTAGG - Intronic
1118038297 14:61891931-61891953 AGGGTCCTGCCATTTGCTGTAGG - Intergenic
1119390853 14:74290098-74290120 AGGCTCAGTGCAGATGCTGACGG - Exonic
1122023693 14:98859445-98859467 AGGCTCCAGCCCCAAGCTGTGGG + Intergenic
1122757930 14:103997429-103997451 AGGCTCCTGCGAGATGGTGAAGG + Intronic
1122895578 14:104755124-104755146 GTGCTCTGGCCAGAGGCTGTAGG + Intronic
1124646221 15:31439359-31439381 AGGCTCCGGCCCTTTGCTGATGG + Intergenic
1127705916 15:61547069-61547091 GGGCTCAGGCCACATGCTGGGGG - Intergenic
1129204719 15:74030102-74030124 AGGCTCCCGACAGAGGCTGCTGG - Intronic
1129923838 15:79344396-79344418 TGGCTCCTTCCAGATGCTCTGGG + Intronic
1132522534 16:398071-398093 TGGCTCTGTCCAGATTCTGTGGG + Intronic
1132585135 16:702881-702903 TGGCTCAGGCCAGATGGTGGAGG - Intronic
1133981770 16:10638096-10638118 AGACTCCCACCAGGTGCTGTGGG - Intronic
1134017922 16:10902141-10902163 AGCCTCCGGCCAGATGCGCCTGG + Exonic
1136229457 16:28878091-28878113 AGGCTCCGGGCAGATGAGGCAGG + Intergenic
1139560031 16:67736041-67736063 AGGCTCTGGACAGTTGCAGTGGG - Intronic
1140990665 16:80208217-80208239 AGGCTCAGGCAAGAGGCTTTGGG + Intergenic
1142002108 16:87669991-87670013 AGGCTGCGTCCCGAGGCTGTGGG + Intronic
1142421461 16:89972898-89972920 AAGCTCTGGCCAGGTGCTGTCGG - Intergenic
1143350482 17:6284536-6284558 AGGCTCAGGCGAGGTGCTTTGGG + Intergenic
1146064975 17:29627422-29627444 AGGCCCCAGACAGATGCTGTTGG - Exonic
1146601617 17:34221984-34222006 AAGATCTGGCCAGATGCTGATGG - Intergenic
1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG + Exonic
1148597700 17:48870078-48870100 AGGCTCCATCCCGAGGCTGTAGG + Intergenic
1150921879 17:69492570-69492592 AGGCTCCCTCCAGAGGCTCTGGG + Intronic
1152304893 17:79514687-79514709 AGGCTTGTGCTAGATGCTGTGGG - Intronic
1152580591 17:81164031-81164053 AGGAGCCAGCCACATGCTGTAGG + Intronic
1153940536 18:9972931-9972953 AGGCCTCAGCCAGATGCTGCTGG + Intergenic
1154384527 18:13880928-13880950 AGGATCCAGCCAGCTGCTTTGGG - Intergenic
1155546699 18:26923205-26923227 AGGCTCCAGCAAGATACTATTGG + Intronic
1157872266 18:51241428-51241450 AGCCTGGGGCCAGATGCTGGAGG + Intergenic
1158114813 18:53983479-53983501 AGGCAGCGACCAGATGATGTAGG - Intergenic
1160700035 19:501771-501793 AGGCTCCGGGGAGGTGGTGTCGG - Exonic
1161055532 19:2188971-2188993 GGGCTCTGCCCCGATGCTGTTGG + Intronic
1162898131 19:13777716-13777738 AGGCTGGGACCAGAGGCTGTGGG + Intronic
1163768764 19:19178280-19178302 AGGCTCCGGGCAGGTGCAGGAGG + Intronic
1166899088 19:46044456-46044478 AGACTCCGGCCTGTTGCTGTTGG - Intronic
1167514118 19:49913043-49913065 AGGGCCGGGCCACATGCTGTGGG + Intronic
926772529 2:16391269-16391291 AGGATTCGGCAAGATGTTGTTGG + Intergenic
927642931 2:24856876-24856898 AGTCTTCAGCCAAATGCTGTAGG + Intronic
932618692 2:73252817-73252839 CGGCCCCGGCCTGCTGCTGTGGG - Exonic
934105588 2:88691892-88691914 GGGGGCCGGGCAGATGCTGTTGG - Exonic
934548653 2:95240725-95240747 AGACTCCAGCCAGTTGCTGTTGG - Intronic
935344555 2:102093863-102093885 AGGCTCCCGGCAGCTGCAGTGGG + Intronic
939656766 2:144835907-144835929 AGGCTCTCAGCAGATGCTGTTGG - Intergenic
940057167 2:149525557-149525579 AGACTCCAGCCTGTTGCTGTTGG + Intergenic
940361134 2:152797441-152797463 AGGCCCCTGCAAGATGCTATTGG + Intergenic
948019614 2:234719853-234719875 AGGCTGTGGTCAGATTCTGTAGG - Intergenic
1172744381 20:37195185-37195207 AGGCTTCAGCCAGCTACTGTCGG - Intronic
1174487479 20:50870533-50870555 AGGCTTCGGCCAGACGCAGCAGG + Intronic
1179166100 21:38936452-38936474 AGGCTCAGGACACATGGTGTTGG - Intergenic
1179913291 21:44461229-44461251 AGCCTCCAGCCAGCTCCTGTGGG - Exonic
1180951000 22:19720547-19720569 AGGCTGCGGCCAGTGGATGTGGG + Exonic
1182359452 22:29738149-29738171 AGGCCCTGGCCAGAGGCTGAGGG - Intronic
1182456479 22:30454159-30454181 AGCCTCCTGCAAGATGCTGAAGG + Intronic
1184802444 22:46769824-46769846 AGGCCGAGGCCAGATGCTGTGGG + Intronic
950563413 3:13749149-13749171 AGGGTCAGGCCAGATGATGTGGG - Intergenic
950577687 3:13842571-13842593 AGACTCTGGACAGATGTTGTAGG + Intronic
950617050 3:14168212-14168234 AGGCTCCTGTCACATGCAGTAGG - Intronic
952900254 3:38107747-38107769 AGACTGCTGCCTGATGCTGTGGG - Intronic
955971216 3:64440469-64440491 CAGCTCCTGCCAGATACTGTCGG + Intronic
961332631 3:126151984-126152006 GGTCTCTGGACAGATGCTGTGGG + Intronic
961695117 3:128698791-128698813 AGGCTCCGGGCTGCTGTTGTCGG - Intergenic
962913112 3:139873109-139873131 ATTCTCAGGCTAGATGCTGTAGG + Intergenic
967920091 3:194608091-194608113 AAGCTTTGGCCAGATGCTGCAGG + Intronic
968127404 3:196169932-196169954 AGGCTCAGGGCAGACCCTGTGGG + Intergenic
968658065 4:1787132-1787154 AGGCTGCGGCCAGAGGCCCTTGG - Intergenic
969646562 4:8433137-8433159 AGGCCCCAGCCAGAGGCTGCTGG - Intronic
971105514 4:23520032-23520054 AGGCTCTGGCCATAAGATGTTGG - Intergenic
972336452 4:38111051-38111073 CGGCTCCGGCCAACTGCTGCAGG + Intronic
972882635 4:43445300-43445322 AGGCTCCAGCCAGGTGGTTTAGG + Intergenic
984812131 4:183804494-183804516 AGGCCCAGGCCAGGTCCTGTGGG + Intergenic
984860419 4:184232662-184232684 AGAATCAGGCCAGATTCTGTGGG - Intergenic
985956118 5:3267458-3267480 AGGCCCCGCCCAGGTGCTGTGGG - Intergenic
989181998 5:38587544-38587566 AGGCAGGGACCAGATGCTGTGGG + Intronic
993404940 5:87499819-87499841 GGGATCCGGCCAGCTGCTGCAGG - Intergenic
995804443 5:116035791-116035813 AGGCTCTGGCCAGCTGCCGCTGG + Intronic
998053210 5:139053578-139053600 AGGCTGGGGCCAGATACTGCAGG - Intronic
999177839 5:149644101-149644123 AGGCTGGGGCCAGATGCTTCGGG + Intergenic
999270876 5:150295726-150295748 AGGGTCTGGCCTGAGGCTGTTGG - Intergenic
1001124050 5:169003566-169003588 AGGCTCAGGGCAGAAGCTGAAGG + Intronic
1003626513 6:7746240-7746262 AGGCTGACGCCAGATGCTGAGGG + Intronic
1004228882 6:13813871-13813893 ACGCTCCGGGCAGATGCCGGTGG + Intronic
1005878501 6:30034737-30034759 AGGCTCTTGCCAAATGCTGGTGG + Intergenic
1006671588 6:35732628-35732650 AAGCTCCAGACAGATACTGTTGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1016423858 6:143913415-143913437 AGGCTCCGCCCTGTTGCTGATGG + Intronic
1017811960 6:157990023-157990045 ATGCCCCGGCCAGGTCCTGTGGG + Intronic
1019430341 7:996211-996233 AGGCTCCGGGCTGTTGTTGTGGG - Intergenic
1019713936 7:2529856-2529878 AGGCTGCGGGCAGAGGCTGCTGG + Intergenic
1022445696 7:30468975-30468997 TGGCTCCTGCCAGATGCTGTTGG - Intronic
1024047629 7:45596060-45596082 AGTCTCCAGGCAGATGCTGAGGG - Intronic
1027192160 7:76002988-76003010 TGGCTCAGGCCAGGAGCTGTTGG + Intronic
1030692112 7:112546830-112546852 AGGCACCGACCTGATGCTGGTGG + Intergenic
1034088828 7:148345301-148345323 AGTATTCGTCCAGATGCTGTGGG - Intronic
1036807470 8:11845427-11845449 AGGATCTGGCGCGATGCTGTGGG + Intronic
1043304893 8:78782474-78782496 AGGCTCCTGTCAGTTGCTGGGGG + Intronic
1044447612 8:92297074-92297096 AGACTCCAGCCTGCTGCTGTTGG + Intergenic
1049235858 8:141511942-141511964 AGGCTCCTGCCAGAACCTCTGGG + Intergenic
1049777864 8:144414776-144414798 AGGCTCCACTCAGCTGCTGTTGG + Exonic
1051364861 9:16314732-16314754 AGGCTCAGGCCAGATGCTGAAGG - Intergenic
1053327530 9:37168804-37168826 AGCCTTGGGCCAGATGCTGGAGG + Intronic
1053653936 9:40196969-40196991 AGTCACCGGCCATATGCTGGAGG + Intergenic
1057998243 9:99840173-99840195 AGGCTCCAGCCAGATCCTCTGGG - Intronic
1059510007 9:114836289-114836311 AGACTCCAGCCTGTTGCTGTTGG + Intergenic
1060151613 9:121292475-121292497 AGGGTCTGGACACATGCTGTAGG + Intronic
1060522469 9:124301469-124301491 AGGCTGCAGACAGCTGCTGTGGG - Intronic
1060549173 9:124477087-124477109 AGGCCCCGGCCTGATGCCCTAGG + Intronic
1062602431 9:137323926-137323948 AGGCTCCTGCCCCATGCTGGCGG - Intronic
1186964457 X:14772538-14772560 AGACTCCAACCAGCTGCTGTTGG + Intergenic
1190157343 X:48004637-48004659 AGGCTGGGGCCAGGTGCTGTAGG + Intronic
1190173113 X:48127522-48127544 AGGCTGGGGCCAGGTGCTGTAGG + Intergenic
1192032033 X:67524209-67524231 AGGCTCTGGCCCCATGATGTGGG - Intergenic
1194278290 X:91914092-91914114 AGGCTCTGGGCTGATGCTGCAGG - Intronic
1196085887 X:111681741-111681763 GGGCTCCGGCCAAGTGCTGAGGG - Intronic
1200595626 Y:5136168-5136190 AGGCTCTGGGCTGATGCTGCAGG - Intronic