ID: 1147936111

View in Genome Browser
Species Human (GRCh38)
Location 17:44012269-44012291
Sequence CAGGCTCAGAAGCCTGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147936107_1147936111 -6 Left 1147936107 17:44012252-44012274 CCTCTAAGACTCTCCAACAGGCT 0: 1
1: 0
2: 2
3: 6
4: 134
Right 1147936111 17:44012269-44012291 CAGGCTCAGAAGCCTGTCTGGGG 0: 1
1: 0
2: 2
3: 31
4: 268
1147936105_1147936111 10 Left 1147936105 17:44012236-44012258 CCTGGAGACATAACATCCTCTAA 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1147936111 17:44012269-44012291 CAGGCTCAGAAGCCTGTCTGGGG 0: 1
1: 0
2: 2
3: 31
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147936111 Original CRISPR CAGGCTCAGAAGCCTGTCTG GGG Intronic
900531341 1:3155002-3155024 CAGACCCTGAAGCCTGCCTGTGG + Intronic
900693917 1:3998383-3998405 AGGGCCCAGAAGCCTGCCTGGGG - Intergenic
901199614 1:7459220-7459242 CAGGCTCAGCAGTTTGTCTAAGG - Intronic
901800183 1:11704001-11704023 CAGGCTCAGAGGCGGCTCTGAGG + Intronic
904962987 1:34349380-34349402 CTGGGTCAGAAGCCTGTCATTGG + Intergenic
905849172 1:41260172-41260194 CAGGGCCAGAACCTTGTCTGAGG - Intergenic
906943686 1:50277491-50277513 GAGGCTCAGAGACTTGTCTGCGG + Intergenic
910745583 1:90570613-90570635 CAAGCTGATAAGACTGTCTGAGG - Intergenic
911856005 1:102875423-102875445 CAGAATCAGAAGCTAGTCTGTGG + Intergenic
911936692 1:103985308-103985330 AAGGTTCAGAAGCCTGACTCGGG + Intergenic
912857927 1:113188261-113188283 AAGGCTCAGAAAACTGCCTGGGG - Intergenic
914675801 1:149906473-149906495 CTGGCACAGAAGCTTCTCTGGGG - Intronic
915093709 1:153444476-153444498 CAGGCTGTGAAGCCTGGCCGTGG + Intergenic
915279883 1:154815128-154815150 CAGGCTGAGAAGTCTGTCTGGGG + Intronic
916877363 1:168983737-168983759 GAGGCTGAGAAACCTGGCTGTGG - Intergenic
919780695 1:201218851-201218873 CAGGCCCAGAAGCCAGGCAGTGG + Intronic
920260960 1:204687388-204687410 CAGGCTCAGCAGTTTATCTGTGG + Intergenic
920432435 1:205927620-205927642 CAGGATTAGAAGCCAGTGTGGGG + Intronic
921404829 1:214767241-214767263 CAGGCTCAGCAGCCTGTTGGAGG + Intergenic
921557802 1:216620125-216620147 CAGGCTCAGAAGCCAATTTCTGG + Intronic
923306785 1:232695909-232695931 GAGTCTCAGGAGCCTGTATGTGG - Intergenic
923573565 1:235138616-235138638 CCCACTCAGAAGCCTCTCTGTGG + Intronic
1063094635 10:2898811-2898833 CAGGCTGAGAAACCTCACTGTGG - Intergenic
1063179886 10:3588594-3588616 CAGGCTCAGAATCCTCTCGGAGG - Intergenic
1064243450 10:13650849-13650871 CTGGCTCAGAAGCCTGCCGTGGG - Intronic
1064637631 10:17385736-17385758 TGGGCTCAGAAGCCTGACAGAGG + Intronic
1069566189 10:69464950-69464972 CAGGGTCAGAACCCAGGCTGGGG + Intronic
1069686584 10:70322860-70322882 CAGGGTCAGAGTCCTGCCTGTGG + Intronic
1069788841 10:71006545-71006567 CAGGCTCAGAAGGCAGGGTGGGG - Intergenic
1069813897 10:71181309-71181331 CAGTCTCAGCACTCTGTCTGAGG - Intergenic
1070668650 10:78362896-78362918 CAGGCCCAGCAGGCTGTCTATGG - Intergenic
1070775564 10:79107884-79107906 CAGGCACAGAGTCCTGCCTGAGG + Intronic
1070916983 10:80161267-80161289 CAGGGGCAGAGGCCTGCCTGGGG - Intronic
1071275855 10:84054438-84054460 CAGGCCCAGCAGCAGGTCTGGGG - Intergenic
1072003950 10:91224154-91224176 CATGCTCAGGACCCTGCCTGGGG + Intronic
1073804153 10:107078407-107078429 AAGGGACAGAAGCCTGTTTGTGG + Intronic
1075762420 10:124866712-124866734 CAGGCACATCAGCGTGTCTGTGG + Intergenic
1076987433 11:249028-249050 CAGACTCTGAAGACTGCCTGGGG + Exonic
1077532456 11:3103622-3103644 CAGGCTCAGGAGCCAGGCAGAGG - Intronic
1078663971 11:13309343-13309365 CAGGCCCAGCATCCTGGCTGTGG + Intronic
1078666293 11:13328416-13328438 GAGGCTCATAAGCAAGTCTGAGG - Intronic
1080401841 11:31943421-31943443 GAGGCACAGCAGCCTCTCTGAGG + Intronic
1081657387 11:44866440-44866462 TTGGCAAAGAAGCCTGTCTGCGG - Intronic
1081760054 11:45570878-45570900 CAGCCTCAGATACCTGTATGGGG - Intergenic
1081774069 11:45665748-45665770 CGGGCTCCGGAGCCTGGCTGCGG - Intergenic
1082777052 11:57253816-57253838 CTGGGTCAGGAGCCTGGCTGTGG - Intergenic
1084676781 11:70639963-70639985 CAGGCCCACAGGCCCGTCTGGGG + Intronic
1085223509 11:74896416-74896438 CAGGCAGAGGAGCCTCTCTGTGG - Intronic
1086081100 11:82902678-82902700 CAGGGTCAGAAGACGGTTTGGGG - Intronic
1086414110 11:86571683-86571705 CAGACTCAGAACCCTGACTTTGG + Intronic
1087269073 11:96092769-96092791 CTTGCTCCGGAGCCTGTCTGAGG + Exonic
1089634912 11:119805833-119805855 CAGGCTGAGAAGCCAGGCAGTGG - Intergenic
1091545892 12:1501052-1501074 CAGGCCCAGAGGCCTCTGTGAGG - Intergenic
1091591910 12:1847415-1847437 CAGGCTCAGAGGCTGGACTGCGG + Intronic
1094330949 12:29292662-29292684 CATGTTCAGAAGCCATTCTGAGG + Intronic
1096599698 12:52720884-52720906 CAGCCTCAGCAGCCCCTCTGAGG + Intergenic
1096869351 12:54583727-54583749 CAGGCTAAGAAGCTAGGCTGGGG - Intronic
1100101873 12:91118156-91118178 GTGGTTCAAAAGCCTGTCTGAGG - Intergenic
1100602037 12:96120366-96120388 CAGGCACAAAAGCCTGTATATGG + Intergenic
1103615012 12:122146287-122146309 GAGGCTCAGCAGCATGTTTGTGG + Exonic
1103728552 12:123011291-123011313 CAGGGTCAGGAGCAAGTCTGAGG + Intronic
1104127552 12:125861943-125861965 CAGGTGCAGAAGCCAGGCTGCGG + Intergenic
1104756429 12:131272509-131272531 CAGGCTCACAAACCTGTCACTGG - Intergenic
1104760166 12:131293381-131293403 AAGGCCCAGAAGCCTTTCTGAGG - Intergenic
1104819606 12:131667265-131667287 AAGGCCCAGAAGCCTTTCTGAGG + Intergenic
1105845737 13:24292188-24292210 CATGCACAGAAGCCTTTGTGTGG + Intronic
1107452032 13:40518524-40518546 GAGTCTCAGAAGCCTCTATGTGG - Intergenic
1107981668 13:45739899-45739921 CAGGCTCAAAAGCTTGTTTGCGG + Intergenic
1108112756 13:47094064-47094086 CAGGTTCACAAGCCTATCTGGGG + Intergenic
1108185785 13:47887198-47887220 CAGGCTCAGAAGCCATTTTATGG - Intergenic
1108528794 13:51309288-51309310 TAAGATCAGAAGCTTGTCTGGGG + Intergenic
1109311485 13:60699663-60699685 CAGGCTCAGAAGCCTGCAATGGG + Intergenic
1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG + Intergenic
1114946491 14:27688255-27688277 TTGACTCAGAAGCATGTCTGGGG + Intergenic
1115899637 14:38130142-38130164 CAGGCTCTGAAAACTGTCAGAGG + Intergenic
1116173696 14:41436971-41436993 CAGGCTCACAAGCCTTCATGAGG + Intergenic
1120094822 14:80376503-80376525 CAGGCTCTGAAGCATGTGTGAGG - Intronic
1122401876 14:101472201-101472223 CTGGCTCAGATGCCTGCCTTGGG + Intergenic
1122814128 14:104303986-104304008 CGTGCTCAGAAGGCTGTCGGGGG - Intergenic
1124243942 15:28054404-28054426 CAGGCACAGCAGCATGTTTGTGG + Intronic
1124264224 15:28219335-28219357 CAGGCTCTGATGCCTCTGTGGGG + Intronic
1125720426 15:41842588-41842610 CAGGGTGAGAGGCCTGGCTGGGG + Exonic
1125753783 15:42048752-42048774 GAGGCTAAGGAGCTTGTCTGAGG + Intronic
1126858909 15:52865075-52865097 CAAGCAAGGAAGCCTGTCTGAGG - Intergenic
1126898050 15:53281066-53281088 AAGGTTCAGAATCTTGTCTGAGG + Intergenic
1127565537 15:60184605-60184627 CAGACTCAGCTGCTTGTCTGAGG - Intergenic
1128381182 15:67114237-67114259 CAGTCTCAGAGGCATGTCAGAGG - Intronic
1128659898 15:69491214-69491236 CAGCCTCACAGGACTGTCTGTGG - Intergenic
1129710264 15:77817215-77817237 AAGTCACAGAAGCCTGCCTGGGG + Intronic
1131861911 15:96662764-96662786 CCAGCTCAGCTGCCTGTCTGTGG + Intergenic
1132934243 16:2472940-2472962 CCTGGTCAGAAGCCTGTCTGGGG - Intronic
1135205400 16:20479748-20479770 CAGACTCAGAAGCGTCTGTGGGG + Intronic
1135213506 16:20544064-20544086 CAGACTCAGAAGCGTCTGTGGGG - Intronic
1135845209 16:25912514-25912536 CAGGATCTCAAGCCTTTCTGAGG + Intronic
1136012008 16:27369869-27369891 CAGGATCAGAAGTCAGTCTGTGG - Intergenic
1136517980 16:30779262-30779284 GGGGCTCAGAGGCCAGTCTGGGG - Exonic
1136545319 16:30951039-30951061 CTGGCCCAGATCCCTGTCTGTGG + Intronic
1136633935 16:31507531-31507553 GAGACTCAGAAGTCTGTGTGGGG + Intronic
1137252947 16:46753190-46753212 CGGGGTCCGAAGCCTCTCTGGGG - Intronic
1137590957 16:49693402-49693424 CAGGACCAGGAGCCTGACTGTGG - Intronic
1140293031 16:73681666-73681688 CAGGATCAGGTGCCTGTCTTTGG - Intergenic
1141916370 16:87099962-87099984 CATGCTCTGGAGCCTGTGTGTGG - Intronic
1141925222 16:87164006-87164028 CAGGATCAGAGGCCAGCCTGAGG + Intronic
1142613431 17:1121678-1121700 AAGGCTCAGAGCCCTGCCTGGGG - Intronic
1142974347 17:3634802-3634824 TTGGCTCAGAAGCATTTCTGAGG - Intronic
1143026460 17:3944517-3944539 AGGGTTCTGAAGCCTGTCTGCGG + Intronic
1143189574 17:5031778-5031800 CACGCGCAGAAGGCTGGCTGGGG + Intergenic
1143410622 17:6706371-6706393 CAGGCTTGGAAGGCTTTCTGGGG - Intronic
1144764932 17:17727478-17727500 AGGGCCGAGAAGCCTGTCTGGGG - Intronic
1144807408 17:17977155-17977177 CAGGCTGACAGGCCTGGCTGGGG + Intronic
1146075382 17:29723987-29724009 CAGGCACAGTAGCCTCTCTTAGG + Intronic
1146829675 17:36057776-36057798 CAGGCACAGAAGAGTCTCTGAGG - Intergenic
1146894153 17:36529082-36529104 CTGGCTCAGACGGCTGTCTGAGG + Intronic
1147242098 17:39097147-39097169 CAGCCACTGAACCCTGTCTGGGG - Intronic
1147651993 17:42068043-42068065 CAGGCCCAGCAGCCTGGCTGGGG - Intergenic
1147936111 17:44012269-44012291 CAGGCTCAGAAGCCTGTCTGGGG + Intronic
1147953453 17:44119730-44119752 CAAGCACAGATTCCTGTCTGGGG + Intronic
1148325627 17:46781982-46782004 CATTCTCAGAAGCTTCTCTGGGG + Intronic
1148582429 17:48752941-48752963 CAGGCTCGGGGGCCTGCCTGCGG + Intergenic
1151653692 17:75485697-75485719 CAGGCTCAGGAGCCACTCTGAGG - Intronic
1152441420 17:80312434-80312456 CCGGGTCAGGAGCCTGGCTGTGG + Intronic
1152441447 17:80312521-80312543 CCGGGTCAGGAGCCTGGCTGTGG + Intronic
1152565733 17:81099554-81099576 AAGGCACAGAAGCCTGGGTGTGG - Intronic
1152753439 17:82077235-82077257 GAGGCTCACAGGCCTATCTGGGG - Intergenic
1155670004 18:28358597-28358619 TATGCTAAGAAGCCTCTCTGTGG + Intergenic
1156172695 18:34505482-34505504 AAGCCTCAGAAACCTGTGTGTGG - Intronic
1157101195 18:44731389-44731411 CAGTCTCATAAACCTCTCTGCGG - Intronic
1159069286 18:63605432-63605454 CAGCCACAGTAGTCTGTCTGAGG + Intergenic
1159621291 18:70641654-70641676 CAGGGTCAGAAATATGTCTGTGG - Intronic
1160522930 18:79519111-79519133 GAGGCTCTGAAGCCTTTCTGAGG - Intronic
1160841672 19:1149181-1149203 CAGGCTGAGACCCCTGTTTGTGG - Intronic
1160938639 19:1609794-1609816 CAGGCTCCCAAGCCAGTCTGGGG + Exonic
1161075321 19:2282415-2282437 CAGCCTCAGAGGCCAGGCTGGGG + Intronic
1161154777 19:2726948-2726970 CAGGCACAGAAGCCTGTTCTGGG + Intronic
1161992786 19:7694501-7694523 CAGGCTCAGATCCCAGGCTGTGG + Intronic
1162064509 19:8117002-8117024 CAGGGTGAGCAGCCTGCCTGGGG + Intronic
1163600789 19:18247972-18247994 CAGGTTCAGCAGCCTGGGTGGGG + Intronic
1164100544 19:22051073-22051095 CAGACTTAGTAGCCTGTGTGCGG + Intergenic
1165223566 19:34338035-34338057 CAGGCTCAGAAGCCTGGAAAGGG - Intronic
1167736383 19:51296900-51296922 GAGGCTCAGAAGCCTCCCTGAGG + Intergenic
1168197894 19:54789036-54789058 GAGCCTCAGAATCCAGTCTGGGG - Intronic
1168201789 19:54820557-54820579 GAGCCTCAGAATCCAGTCTGGGG - Intronic
925415352 2:3666474-3666496 CAGACTAAGCAGCCTGGCTGTGG - Intronic
926014151 2:9434480-9434502 CAGGATCAGCAGGCTGTCTCTGG + Intronic
926405682 2:12549978-12550000 AAGGCTCAGAAGCTAATCTGTGG + Intergenic
926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG + Intergenic
926991564 2:18685971-18685993 AAGGCTCAGAAAGCTGCCTGGGG - Intergenic
928935915 2:36677905-36677927 TAGGATCAGAAGCCTGTGTCTGG + Intergenic
929526094 2:42704273-42704295 CAGCCTCAGAATCCTCTCTTAGG + Exonic
931905940 2:66844167-66844189 CATGCTCAGAACCCTGTCAGAGG + Intergenic
932257347 2:70299347-70299369 CTGGCTCACAAGCCCCTCTGAGG - Intronic
932326642 2:70866872-70866894 TAGGCTCAGAAGCCTGACCCTGG + Intergenic
932497173 2:72151625-72151647 CAGAGTCAGAAGTCTATCTGAGG - Intergenic
932886581 2:75554416-75554438 CAGCCTCAGATGCCAGGCTGGGG + Intronic
933969304 2:87457345-87457367 GAGGCTCAGAAGCCAGGCTGAGG + Intergenic
935676726 2:105600772-105600794 CAGGCTCAGAAGTGTGCCTCTGG + Intergenic
936116844 2:109709525-109709547 CAGGCTCAGTGGTCTGTCTAGGG - Intergenic
936175642 2:110217880-110217902 TAGGCTCAGAGGCCTGACAGTGG - Intergenic
936324483 2:111493149-111493171 GAGGCTCAGAAGCCAGGCTGAGG - Intergenic
936339468 2:111618380-111618402 CACGCTCAGATCCCTGTCTGGGG - Intergenic
936947146 2:117941153-117941175 CAGCCTCAAGAGCTTGTCTGTGG + Intronic
938763660 2:134446174-134446196 CAGCAGCAGAAGCCTGCCTGGGG - Intronic
939272892 2:139962879-139962901 TAGGGGCAAAAGCCTGTCTGTGG - Intergenic
940345270 2:152622138-152622160 CCTGCTCAGCAGCCTGTCTCAGG - Intronic
943725815 2:191250330-191250352 CAGGTTCAGAACCCTGACTGAGG + Intronic
944019131 2:195079600-195079622 CACACACAGAGGCCTGTCTGGGG + Intergenic
944106709 2:196086926-196086948 CAGAGTGAGAAGCCTGTCTTGGG - Intergenic
945276901 2:207997276-207997298 CAGGCTCTTGAGCCTTTCTGAGG - Intronic
945357318 2:208855958-208855980 CTGGTTAAGAAGCCTTTCTGGGG + Intergenic
946194137 2:218023053-218023075 CAGGCTCAAAGGCCAATCTGGGG + Intergenic
946957170 2:224943710-224943732 TAGGCTCTGAAGCCAGTCTAGGG + Intronic
947304529 2:228729087-228729109 GAGCAGCAGAAGCCTGTCTGTGG + Intergenic
947355034 2:229283299-229283321 CTGGCTCAAAAGACAGTCTGTGG - Intergenic
1169235040 20:3924160-3924182 GAGTCTCAGAAGACTGCCTGAGG + Intronic
1170542741 20:17405398-17405420 GAGCCTCAGAAGCTTCTCTGTGG + Intronic
1172132430 20:32664615-32664637 CACGCTGAGGAGCCTGCCTGTGG - Intergenic
1172999602 20:39096065-39096087 CAGGCTAAGAAGCCTGCCCTGGG - Intergenic
1173146402 20:40528381-40528403 CAGGCCCTGGAGCCTGCCTGAGG - Intergenic
1173247945 20:41349025-41349047 CAGGCTCTCATGCCTGCCTGGGG + Intronic
1173249229 20:41355931-41355953 CAGGATCACAGGGCTGTCTGGGG - Exonic
1173823232 20:46031681-46031703 CAGGCTAAGAAGCCTCCCCGGGG - Intronic
1174082997 20:47983976-47983998 CAGTCTCTGAAGACTCTCTGGGG - Intergenic
1174282790 20:49451599-49451621 GAGGCCCAGCAGCTTGTCTGAGG + Intronic
1174347539 20:49941592-49941614 AAGCCGAAGAAGCCTGTCTGTGG + Exonic
1174644997 20:52078153-52078175 GAGAGACAGAAGCCTGTCTGAGG - Intronic
1175118150 20:56698213-56698235 AAGGCTCGGAAGGTTGTCTGTGG + Intergenic
1175506899 20:59492441-59492463 CAGGCTCAGAGCCCAGTGTGAGG - Intergenic
1175895694 20:62334689-62334711 CAGACTGAGAAGCCTGCCTGGGG + Intronic
1176044844 20:63087207-63087229 CAGGTTCATGACCCTGTCTGTGG + Intergenic
1176059935 20:63168108-63168130 CAGGCCCAGACGCCTGCCAGGGG - Intergenic
1177811813 21:25932582-25932604 AAGACTCAGAAGCCTGGATGAGG - Intronic
1178302438 21:31464339-31464361 CAGGCTCAGAATCCTGTTCAAGG + Intronic
1179014359 21:37582659-37582681 CATGCTCAGAAGACTGTCCATGG - Intergenic
1179289055 21:40002806-40002828 CACGGTCAGAAGCTTATCTGTGG + Intergenic
1179451408 21:41470808-41470830 CAGGCCCAGCAGCCTGCATGTGG - Intronic
1179583837 21:42362364-42362386 CAGCTGCAGAAGCGTGTCTGAGG + Exonic
1180004851 21:45015598-45015620 CAGACTCAGAGTCCTGTTTGTGG + Intergenic
1180904388 22:19398435-19398457 CATGCTCAGAAGGCTCTCGGAGG - Intronic
1181545450 22:23599718-23599740 CAAGCTCCCAGGCCTGTCTGAGG + Intergenic
1181648640 22:24247106-24247128 CAGGCACAAAACCCTGTTTGTGG + Intergenic
1182553931 22:31118632-31118654 CAGGGTCAGAATTCAGTCTGTGG + Intronic
1183167032 22:36155782-36155804 CTGGCTCGGAATCTTGTCTGGGG + Intronic
1184087976 22:42276966-42276988 CTGGCTCAGAAGTCTGTCAGTGG + Intronic
1184890510 22:47376201-47376223 CTGGCTCAGGAGCATGGCTGTGG + Intergenic
952911772 3:38195819-38195841 CAGGCTATGAAGCCTGACAGGGG + Intronic
953272074 3:41455576-41455598 CAGGCCCAGAAGTCTGGCTCAGG - Exonic
954117540 3:48475534-48475556 CAGGCCCTCAAGCCTGTCTGGGG - Intronic
954250323 3:49362370-49362392 GAGGCTCAGAAGCCCCTCTGTGG - Intronic
954265154 3:49465932-49465954 CAGGCCCACAGGCCTGCCTGAGG - Intergenic
954377217 3:50201558-50201580 CAGGGTCAGAAGCATATGTGGGG - Intergenic
955404006 3:58613878-58613900 CAGAGCCAGAAGGCTGTCTGAGG - Intronic
956502643 3:69903407-69903429 CAGGCTCAGAAGAAGGTCTCAGG - Intronic
957732078 3:84151617-84151639 CAGGCTCACAGTCCTGGCTGTGG - Intergenic
958170000 3:89927572-89927594 CAAGCTCTTAAGCCTGTCTGAGG - Intergenic
958892476 3:99795843-99795865 CAGGTGAAGATGCCTGTCTGCGG - Exonic
959477406 3:106827837-106827859 CAGGCTCAGAAACCAGTCACCGG + Intergenic
960408459 3:117291662-117291684 CTGGCACAGAACACTGTCTGGGG + Intergenic
960846383 3:122007823-122007845 CAGACACAGAACCCTGTCTATGG - Intronic
961496930 3:127300099-127300121 CAAGCTCTCAAGCCTGTTTGGGG + Intergenic
961649926 3:128412261-128412283 CAGGGCCAGACCCCTGTCTGGGG + Intergenic
961805213 3:129484229-129484251 CAATCTCAGGCGCCTGTCTGTGG - Intronic
962606693 3:137038042-137038064 CAGGCTCAGAGGCCTGGATAAGG - Intergenic
962716394 3:138129433-138129455 CAGCCACAGAAGCTTGTCAGAGG + Intronic
963296090 3:143548274-143548296 CAAGCTCCCAGGCCTGTCTGGGG + Intronic
963313278 3:143731534-143731556 CTGGCTCAGAAGTATGACTGAGG - Intronic
967104541 3:186244790-186244812 CAGGGACAGAGGCCTCTCTGGGG - Intronic
968597290 4:1491995-1492017 GTGGCTCAGAGGCCTTTCTGGGG - Intergenic
968764246 4:2459758-2459780 CAGGCCCCGAAGCCTGGCTGGGG + Intronic
971490382 4:27205988-27206010 ATGGATCAGAAGCCAGTCTGAGG - Intergenic
971954134 4:33394175-33394197 CAGGCTCAGATGTCTTTTTGAGG - Intergenic
976209084 4:82649537-82649559 CAGCCACAGAATCCTGTCAGTGG - Intronic
978814372 4:112886097-112886119 CAGTCACAGAAGTCTGTCTGGGG + Intronic
979392435 4:120142659-120142681 CAGCCTCTGAAGCCCATCTGTGG - Intergenic
979562771 4:122119141-122119163 CAGGCTAAGAAGCCAATGTGAGG - Intergenic
980745120 4:137002126-137002148 CAGGCACAGAGGGCTGTGTGAGG - Intergenic
984327666 4:178274388-178274410 CAGGTTAAGAACCCTGTATGGGG - Intergenic
988157618 5:27475671-27475693 CAGGTTAAGAACCCTGTATGTGG - Intergenic
989151968 5:38308479-38308501 CTGGATCAGAAGCCTGGCTTTGG + Intronic
990335048 5:54764268-54764290 CAGGCTCTGGAGCCTTTTTGGGG + Intergenic
990381890 5:55227228-55227250 CAGGCTCCGAAGCCAGCCAGAGG + Exonic
995764165 5:115597756-115597778 CAGGCTCTGCAGGCTGACTGTGG - Intronic
996888573 5:128389412-128389434 CAGCCTCAGATGCCCATCTGGGG - Intronic
997262464 5:132475397-132475419 CAGGGACAGAGGCCTGGCTGGGG - Intronic
998133712 5:139663893-139663915 GAGGGTCAGCAACCTGTCTGAGG + Intronic
999416918 5:151406266-151406288 CAGGCTTCGAAGTATGTCTGTGG + Intergenic
1001085119 5:168694946-168694968 CCAGCACAGAAGCTTGTCTGGGG + Intronic
1001457646 5:171877330-171877352 TAGACTCAGAGGCCTGTCAGAGG - Intronic
1001528748 5:172447601-172447623 GAGGCACAGAGGCTTGTCTGAGG + Intronic
1002487955 5:179552219-179552241 AATGCTCAGTAGCCTGTGTGTGG + Intronic
1004175439 6:13335746-13335768 CATGTTCAGAAGCCTGCTTGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006593144 6:35172741-35172763 CAGGCTTTGAACCCTGCCTGTGG - Intergenic
1006773931 6:36577320-36577342 CTGGCTCAGAAGGCTGTCCATGG + Intergenic
1007398636 6:41591234-41591256 CAGGGTCAGCTGCCTGTCAGGGG - Exonic
1009304854 6:62075820-62075842 CAGACTCCAAAGCCTCTCTGTGG + Intronic
1010988193 6:82450194-82450216 CAGGTTCAGAGGCTTCTCTGAGG + Intergenic
1011046147 6:83085445-83085467 CAGTCTAAGTAGCCTGCCTGGGG - Intronic
1014827093 6:126058930-126058952 CAGGCTCCTAGGCCTCTCTGAGG - Intergenic
1014899038 6:126940835-126940857 CAGGTTAAGAAGGCTGTCTCTGG - Intergenic
1016205806 6:141467008-141467030 CAGGTTCTTAATCCTGTCTGAGG + Intergenic
1018627441 6:165793104-165793126 CAGACTCTGAAGACTGTCTCAGG + Intronic
1018714686 6:166522638-166522660 CAGGCTCAATAGCCTTTATGGGG - Intronic
1018969559 6:168517193-168517215 CTCGCTCTGAGGCCTGTCTGCGG + Intronic
1019101954 6:169638804-169638826 CAGGCTCTGCAGCCTCACTGTGG - Intronic
1021768054 7:23968964-23968986 CTGGCTGAGAAGGCTCTCTGTGG - Intergenic
1021804440 7:24341170-24341192 CAGGCTCAGCAGTCTGACTTTGG - Intergenic
1027691012 7:81344648-81344670 CAGGCACAGAAGCCTTTCAGAGG - Intergenic
1028221433 7:88201520-88201542 CAAGCACAGAAGTCTGTCTTAGG - Intronic
1028324221 7:89502316-89502338 CAGGATCAGAAGCATGGGTGGGG - Intergenic
1029008375 7:97233089-97233111 CTGGCTAAGAAGCCTGTTAGAGG + Intergenic
1029459809 7:100688091-100688113 CAGGCTCAGGGCCCTGTCCGGGG - Exonic
1031971367 7:128067398-128067420 CTGCCTCTAAAGCCTGTCTGTGG + Intronic
1034072282 7:148198101-148198123 CAGGCTGAGAAGCCTGAGGGTGG + Intronic
1036074225 8:5476724-5476746 CAGACTCAGTGGTCTGTCTGAGG - Intergenic
1041483074 8:58344734-58344756 CAAGAAGAGAAGCCTGTCTGGGG + Intergenic
1041966357 8:63682970-63682992 CAGGCTTAAAAGGCTGTCTGGGG - Intergenic
1043745432 8:83868990-83869012 CAGGCTGAGCTGCCAGTCTGAGG + Intergenic
1045404557 8:101852686-101852708 CAAGCTCAGAAGCTTCTCTAAGG + Intronic
1048209475 8:132442969-132442991 CGGCCTCAGGAGCCTGTCTCTGG - Intronic
1049634866 8:143682299-143682321 CAGGCTCTCAATCCGGTCTGAGG + Intergenic
1049795773 8:144496699-144496721 TAGGCTCAGGAGCCTGGGTGGGG - Exonic
1050598696 9:7229144-7229166 CAGCCTCTGAAGGCTGTCTTGGG + Intergenic
1051681041 9:19608529-19608551 CAGGCTCAGAAGTCAGACTTGGG + Intronic
1052043347 9:23766671-23766693 CAAGCGGAGAAGACTGTCTGGGG - Intronic
1055300146 9:74874284-74874306 GAGACTCAGAAGTCTGTCAGTGG + Intronic
1055956330 9:81777001-81777023 TGAGCTCACAAGCCTGTCTGAGG - Intergenic
1057185045 9:93052808-93052830 CAGGCTTTGGAGCCTGTCTGGGG - Intergenic
1058566997 9:106296688-106296710 CAGGCTTAAAACCCTGCCTGAGG - Intergenic
1059353206 9:113680377-113680399 TATGCTCAGAAGCCTTTCAGGGG - Intergenic
1060593736 9:124835339-124835361 CAGCCACAGAAGCCTGTTGGAGG + Intergenic
1060892365 9:127196956-127196978 CAGGGACAGAAGCCTGACTGTGG - Intronic
1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG + Intronic
1062386479 9:136313709-136313731 CAGCCCCTGAGGCCTGTCTGGGG + Intergenic
1186653257 X:11584941-11584963 CAGGCACTGAGGCCTTTCTGAGG - Intronic
1187388861 X:18872822-18872844 CAGGCTCCGGGGCCTGTGTGTGG + Intergenic
1187519426 X:20000586-20000608 CAGCCCCTGAAGCCTGTCGGTGG - Intergenic
1193694824 X:84695702-84695724 CAGGCTAAGAAGCATGCCTCCGG + Intergenic
1193874606 X:86846559-86846581 CAGGATCAGAAGCCTGCCACTGG - Intergenic
1196187707 X:112762350-112762372 AAGGCTCAGAAAGCTGCCTGGGG + Intergenic
1196657743 X:118237445-118237467 CAGCCTCGGAAGACTTTCTGTGG - Intergenic
1197177723 X:123502961-123502983 CAGGCTCAGAAGCTTTTGAGAGG - Intergenic
1197772558 X:130098551-130098573 GAGGCTCAGAAGCCTGGGTATGG - Intronic