ID: 1147937446

View in Genome Browser
Species Human (GRCh38)
Location 17:44020747-44020769
Sequence TATCCCACTCCCATTGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 2, 2: 2, 3: 5, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147937442_1147937446 30 Left 1147937442 17:44020694-44020716 CCTGGGCGACAGAGAGACACTCT 0: 4
1: 618
2: 15568
3: 92296
4: 180438
Right 1147937446 17:44020747-44020769 TATCCCACTCCCATTGGTATTGG 0: 1
1: 2
2: 2
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147937446 Original CRISPR TATCCCACTCCCATTGGTAT TGG Intronic
902212646 1:14914675-14914697 CATCCCAGTCCCATTGATAATGG + Intronic
908671936 1:66557597-66557619 TATCCCAATCCCATTGCCAGAGG - Intronic
912803215 1:112734756-112734778 GATCCTATTACCATTGGTATAGG + Intergenic
919550741 1:198983405-198983427 TATCCCTTTCCCATTGGCATTGG + Intergenic
1067565645 10:47334754-47334776 AACCCCACTCCCCTTGGAATTGG + Intergenic
1069213724 10:65793500-65793522 TATCCATCTCCCATTGCTCTGGG - Intergenic
1075265305 10:120995981-120996003 TATCTCACTGCCATTAGCATAGG - Intergenic
1079677509 11:23248726-23248748 TATACCAGTACCATTGGTTTGGG + Intergenic
1085283524 11:75345668-75345690 TATACCACTCCTATTAGCATGGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1092695712 12:11169424-11169446 TATTCCCGTCCCATTGGAATAGG + Intronic
1097151612 12:56983487-56983509 TCTCCGACTCCCTCTGGTATTGG - Intergenic
1100219294 12:92486629-92486651 CAACCCATTGCCATTGGTATTGG + Intergenic
1100804975 12:98273744-98273766 TGTCTCAGTGCCATTGGTATAGG - Intergenic
1106448535 13:29858753-29858775 TACCCCACTCACATTGTTGTTGG - Intergenic
1108019521 13:46112835-46112857 TAGCACACTCCCATTTGTCTAGG + Intergenic
1108391730 13:49953784-49953806 TATCTCACTCCCATTCACATAGG + Intergenic
1110026170 13:70542557-70542579 TATCACACACCCATTGTCATGGG + Intergenic
1111468815 13:88649466-88649488 TATCTCACTGTCATTAGTATAGG - Intergenic
1112360358 13:98711871-98711893 TATTCCACTCCCAATGTTCTGGG - Exonic
1122246655 14:100407924-100407946 TCTCCCACTCCCATCAGGATAGG - Intronic
1125551635 15:40549482-40549504 TACCCCACTCCAACTGGTCTAGG + Intronic
1128134410 15:65252185-65252207 TTTCCCACTCTCATTGGTCTTGG - Intronic
1131469103 15:92680552-92680574 TATCCCATTCCCATTGTTATAGG + Intronic
1141529343 16:84635393-84635415 TTTCACACTCCCATTGGTCAAGG - Intergenic
1147937446 17:44020747-44020769 TATCCCACTCCCATTGGTATTGG + Intronic
1148630523 17:49104755-49104777 TATGCCACTGCCATTGTCATGGG - Intergenic
1162225726 19:9220663-9220685 TATCGCACTCCCATGTTTATTGG - Intergenic
1164393919 19:27847613-27847635 TATCCAACTGGCATTGGCATTGG - Intergenic
927613278 2:24563840-24563862 TATCCCACTTCCAGTGGCCTAGG + Intronic
929183287 2:39066871-39066893 TATGCCACTCCTAAAGGTATGGG + Intronic
931673872 2:64673678-64673700 TATCCCAATTCCATGGGTCTGGG - Intronic
932980815 2:76663614-76663636 TATTCCACCCACATGGGTATAGG + Intergenic
939582792 2:143970290-143970312 AATCCTGCTCACATTGGTATTGG - Intronic
947123714 2:226844306-226844328 TCTCCCACTCCCATTGGATGCGG - Intronic
948972544 2:241440554-241440576 TGTGCCACTCCCATTGGCAAAGG + Intronic
952040897 3:29260522-29260544 TTTCCCACTCCCACTGATTTTGG - Intergenic
959187555 3:103065445-103065467 TAGCCGACTCCCCTTGGTATTGG + Intergenic
965758069 3:172045265-172045287 TACCCCACTCCTAATGGAATAGG + Intronic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
973797588 4:54444129-54444151 ATTACCAGTCCCATTGGTATGGG - Intergenic
977301580 4:95273793-95273815 TCTCCCACTCCCAGTGGCCTTGG + Intronic
986951549 5:13092582-13092604 TATGCCACTCCCATGTGTTTTGG - Intergenic
987965753 5:24869985-24870007 TTTCCCACTCCTTTTGATATAGG + Intergenic
988268740 5:28986524-28986546 TACTCCATTCCCATTGGTAGTGG - Intergenic
992948173 5:81830168-81830190 TTTCAGACTCCCATTGGGATTGG - Intergenic
995947181 5:117662522-117662544 TATCTCACTTCCATTGATGTCGG - Intergenic
1004298232 6:14433701-14433723 CTTCCCACTCCCAGTGGTAGTGG + Intergenic
1005716804 6:28557246-28557268 AATGCCACTCCCATTTGTATTGG - Intergenic
1007937735 6:45748279-45748301 TATCCCTCTCCCTTTGGGAGTGG - Intergenic
1012307602 6:97677696-97677718 CTTCCCACTCTCATTGGTCTGGG + Intergenic
1012347314 6:98206701-98206723 TATCCCACTCTCTTTGTTCTTGG - Intergenic
1024815411 7:53263152-53263174 TGTGTCACTCCCATTGGTAGGGG - Intergenic
1024875181 7:54013900-54013922 TGTCTCACCCCCATTGCTATTGG - Intergenic
1030672216 7:112350180-112350202 TCACCCACTCCCATTGGTCATGG + Intergenic
1038875477 8:31543773-31543795 TATTTCACTCCCATTCCTATAGG + Intergenic
1043853726 8:85242398-85242420 TATCCCTCTCCCTCTGTTATTGG + Intronic
1051451884 9:17206173-17206195 TACCCCACCCCCATTGGTATCGG - Intronic
1051523421 9:18015798-18015820 TATCCTAATCTCATTGGTCTCGG - Intergenic
1053113076 9:35479260-35479282 TCTCCCACTCCCATAGCTACTGG - Intergenic
1058059878 9:100483826-100483848 TAACCCTCTCCCTTTGGTAGGGG - Intronic
1185791833 X:2933035-2933057 GACCCCACTCCTATTGGAATAGG - Intergenic
1186149254 X:6656647-6656669 TATCACACCCCTACTGGTATTGG + Intergenic
1188526492 X:31093660-31093682 TCTCCCACTCCCATTGAGATGGG + Intergenic
1194152523 X:90343581-90343603 TGCCCCACTCCCAGTGGTACTGG + Intergenic
1194820162 X:98496065-98496087 TATCCCACTCTCATGGATAATGG - Intergenic
1197028328 X:121782594-121782616 TAACCAACACCTATTGGTATTGG + Intergenic
1200498871 Y:3920330-3920352 TGCCCCACTCCCAGTGGTACTGG + Intergenic
1201281823 Y:12349238-12349260 GACCCCACTCCTATTGGAATAGG + Intergenic
1202151185 Y:21845115-21845137 TACCCCAATCCCATGGGGATTGG + Intergenic
1202151189 Y:21845119-21845141 TATCCCAATCCCCATGGGATTGG - Intergenic