ID: 1147937788

View in Genome Browser
Species Human (GRCh38)
Location 17:44023536-44023558
Sequence CAGAGCAAGGTCAAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147937788_1147937799 28 Left 1147937788 17:44023536-44023558 CCAGCTGCCTTGACCTTGCTCTG 0: 1
1: 0
2: 3
3: 36
4: 329
Right 1147937799 17:44023587-44023609 CCCAGCTCCCCGGCTTCTTGCGG 0: 1
1: 0
2: 0
3: 25
4: 266
1147937788_1147937801 29 Left 1147937788 17:44023536-44023558 CCAGCTGCCTTGACCTTGCTCTG 0: 1
1: 0
2: 3
3: 36
4: 329
Right 1147937801 17:44023588-44023610 CCAGCTCCCCGGCTTCTTGCGGG 0: 1
1: 1
2: 2
3: 25
4: 202
1147937788_1147937796 18 Left 1147937788 17:44023536-44023558 CCAGCTGCCTTGACCTTGCTCTG 0: 1
1: 0
2: 3
3: 36
4: 329
Right 1147937796 17:44023577-44023599 CAGAAAGCTCCCCAGCTCCCCGG 0: 1
1: 0
2: 7
3: 55
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147937788 Original CRISPR CAGAGCAAGGTCAAGGCAGC TGG (reversed) Intronic
900339029 1:2179117-2179139 CAGTGCAGGGGCAAGGCAGGTGG - Intronic
900401894 1:2476122-2476144 CAGACCCAGGTCAGGGCTGCGGG - Intronic
901028219 1:6290466-6290488 CACAGCAGGGCCATGGCAGCCGG - Intronic
901316908 1:8315728-8315750 CAGAGCAAGATGGAGGCAACCGG + Intergenic
901835667 1:11922588-11922610 GAGAGCAAGGCCAAGGCCTCGGG + Intronic
903283461 1:22263184-22263206 CAGCGCCAGGTCAAGGCAGCTGG + Intergenic
904259227 1:29278991-29279013 CACTGCAAGGGAAAGGCAGCAGG - Exonic
904455320 1:30644281-30644303 CAGAGGAGGCTCAAGGGAGCAGG - Intergenic
905117316 1:35653560-35653582 CAGAGGGAGGTCAAGCCAGATGG + Intergenic
905868796 1:41391354-41391376 CAAAGCAGGGTCTAGGCAGAGGG + Intergenic
905917964 1:41698988-41699010 CAGAGGAAAGTCAAGCCCGCTGG + Intronic
905975784 1:42172683-42172705 CAGAGGGTGGTCAGGGCAGCTGG + Intergenic
906409001 1:45564236-45564258 AGGAGCTAGGTCAAGGCAGAGGG + Intronic
906966544 1:50462929-50462951 CAGAGAAAGGTTAACACAGCAGG + Intronic
907037277 1:51227693-51227715 CAAAGAAAGGTCCAGGCTGCTGG - Intergenic
907283110 1:53363472-53363494 CAGAGGGAGGGCAAGGCCGCCGG - Intergenic
907481850 1:54750474-54750496 CTGAGCAAGGCAAGGGCAGCTGG - Intergenic
908342195 1:63193069-63193091 AACAGCAAGGCCAAGGTAGCTGG + Intergenic
910073263 1:83245120-83245142 CAGAGCAAGGTCTGCTCAGCAGG + Intergenic
911658665 1:100475533-100475555 CAGAGGAAGGTGGTGGCAGCTGG + Intronic
913195066 1:116449443-116449465 GAGAGCAAGGTCAAGAGAGTTGG - Intergenic
915648982 1:157293941-157293963 CAGAGCAAGGGCAAGAGAGATGG + Intergenic
916354692 1:163891686-163891708 CAGAGCAAGCTAATGGAAGCTGG + Intergenic
918626024 1:186656683-186656705 CTGAGCAAGGTGAATGCAGTTGG - Intergenic
920243994 1:204574508-204574530 CAGAGCAAAGTTATGACAGCCGG + Intergenic
920433023 1:205930769-205930791 CAGAGGATGGTCCAGGCAGAAGG - Intronic
920702159 1:208226078-208226100 CTGGGCTAGGTGAAGGCAGCAGG - Intronic
923681172 1:236119877-236119899 CAGAGCAAGGTCCTGGAAGCAGG + Intergenic
1062835198 10:630908-630930 CAGAGCAGGGTCATCGAAGCAGG + Intronic
1062920400 10:1274807-1274829 AGGGTCAAGGTCAAGGCAGCTGG - Intronic
1067777674 10:49175187-49175209 CTGAGCAGGGTCAGAGCAGCTGG + Intronic
1068959807 10:62855160-62855182 CAGAGCATGTTCTAGGCACCAGG + Intronic
1069547873 10:69341697-69341719 CTTTGCAAGGCCAAGGCAGCAGG - Intronic
1069615627 10:69804320-69804342 CAGGGCATGGTCAGGCCAGCAGG - Intronic
1070516565 10:77213754-77213776 CAGAGCAAGATCATGGGAGTGGG - Intronic
1070595657 10:77831009-77831031 CAGAGTCAGGTCAAGGCTGCTGG + Intronic
1070736944 10:78869657-78869679 CAGACCAAGGACACGGCAGGAGG - Intergenic
1070770071 10:79077163-79077185 CAGGGCAAGGTCCAGGCACCTGG - Intronic
1071292221 10:84196063-84196085 CAGAACCAGGTCCAGGCATCGGG + Intronic
1072798338 10:98374025-98374047 GTGAGCCAGGTCAGGGCAGCCGG - Intergenic
1073251829 10:102124887-102124909 CATTGGAAGGTCAAGGCAGGAGG - Intergenic
1074782411 10:116811486-116811508 CACACCAAAGGCAAGGCAGCTGG + Intergenic
1074986606 10:118665090-118665112 CAGAGCGATGCCAAAGCAGCTGG - Intergenic
1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG + Intronic
1077102096 11:827008-827030 CGGAGCAGGGACAAGGCTGCGGG - Intronic
1077460652 11:2707721-2707743 CATAGCAAGGTCAAGGGATTGGG + Intronic
1077530654 11:3093307-3093329 CAGTGAGAGGTCACGGCAGCCGG + Intronic
1077820293 11:5730763-5730785 CAGAACAGTGTCAAGGCAGAGGG + Intronic
1078672006 11:13373981-13374003 GAGAGCAAGGTCAAAGCTGCAGG - Intronic
1078948493 11:16099994-16100016 GAGAACAAGGACAAGGCAGGAGG + Intronic
1079207552 11:18429774-18429796 CACAGCAGGTGCAAGGCAGCAGG + Exonic
1080087091 11:28296521-28296543 TTCATCAAGGTCAAGGCAGCAGG - Intronic
1080300186 11:30775562-30775584 CAGAGCAGCCTCAAGGCAGAGGG - Intergenic
1080849876 11:36058992-36059014 CAGAGGGAGGTAAAGGAAGCAGG - Intronic
1081625742 11:44654129-44654151 CAGGGCAAGGTCTGGGCACCAGG - Intergenic
1084154408 11:67305506-67305528 CAGGGCGAGGTCATGGCTGCAGG + Intronic
1084664967 11:70571412-70571434 CAGAGAAAGGGCATGGCAGCAGG + Intronic
1084768491 11:71327471-71327493 CAGAGCAAGGTGCTGGGAGCCGG - Intergenic
1085258643 11:75191584-75191606 CAGAGCAGGGCCAAGCCAGCTGG - Intronic
1085331480 11:75655564-75655586 CAGGGCAAGGCCCAGGCATCTGG - Intronic
1085409900 11:76284688-76284710 CAGGGCAGGGTGAAGACAGCAGG + Intergenic
1085858600 11:80205679-80205701 CAGGGCAAGCTCAAGGCACGAGG + Intergenic
1086827150 11:91513097-91513119 CTAAGCATGCTCAAGGCAGCCGG - Intergenic
1088814209 11:113410403-113410425 CAGAGGAAGGTCAAGGAAGGCGG + Exonic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089549017 11:119255976-119255998 CTGTGCAAGGCCAAGGCAGGAGG - Intronic
1089555894 11:119315861-119315883 CAGGGCAAGGGCCAGGCAGTGGG + Intronic
1089630373 11:119780471-119780493 CAGAGCCAGGCGGAGGCAGCAGG - Intergenic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1092287599 12:7137887-7137909 CAGAACAAGTTCAAAGCAGCAGG - Intronic
1092822536 12:12365993-12366015 CAGAACAACGTCAAAGCAGGAGG - Intronic
1093545157 12:20337024-20337046 CCCAGCAAGGTCAAGGCAGAAGG - Intergenic
1094635845 12:32226827-32226849 AGGAGCAAGGTCACCGCAGCTGG - Intronic
1094853603 12:34393202-34393224 AAGGGCCAGGCCAAGGCAGCAGG + Intergenic
1096587050 12:52629534-52629556 CAGAGCAAGTTCAGGGCCCCAGG + Intergenic
1097117685 12:56710162-56710184 GGGAGCAGGGTCAAGGGAGCAGG + Intergenic
1102132054 12:110539453-110539475 CAGAGCCAGCCAAAGGCAGCAGG - Intronic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103215970 12:119201823-119201845 CAGAGCTGGGTCAAGGCAGGGGG - Intronic
1103317394 12:120067321-120067343 TAGAGCAAGGTCTAGGCTCCAGG - Intronic
1103325100 12:120115264-120115286 CAGAGCTAGGTCAGGGAAGTGGG - Intronic
1103463911 12:121126826-121126848 CAGAGGAAGGTAAAGCCTGCTGG + Intergenic
1103949467 12:124543113-124543135 CAGACCAAGGCCAAGGGGGCTGG + Intronic
1104521507 12:129480138-129480160 CAGAGGAGGGTCCAGGCAGCGGG + Intronic
1106045863 13:26141186-26141208 AAGAACAAAGTCAAGGCAGGTGG + Intronic
1106454982 13:29919262-29919284 CAGAGCAGGTTCAGGGCAGGAGG + Intergenic
1107106747 13:36651622-36651644 AAGAGAAAGGTCAAAGGAGCAGG + Intergenic
1107937414 13:45356755-45356777 CAGATCTAGGCCAAGGTAGCTGG - Intergenic
1109492948 13:63127237-63127259 AAGACCAAGATCAAGGCACCAGG + Intergenic
1109898280 13:68724189-68724211 CAGATTAAGGCCAAGGCAGGTGG - Intergenic
1110481807 13:75986859-75986881 AACAGCAAGGTCAGTGCAGCTGG - Intergenic
1111102829 13:83610432-83610454 TAGAGCAAAGCCAAGGCAGAAGG + Intergenic
1113792162 13:113034699-113034721 CAGGGCAAGGGCAAGGGCGCGGG - Intronic
1113842848 13:113370119-113370141 CAGGGCAAGGTGCAGGCTGCAGG + Intergenic
1116342452 14:43741664-43741686 ATGAGCAAGGTTAAGGCAGAAGG - Intergenic
1117201578 14:53395169-53395191 TAGAGGAAGGTCAAGTCAGTGGG + Intergenic
1118879949 14:69817446-69817468 AAGAGAAAGGCGAAGGCAGCAGG - Intergenic
1118917561 14:70120654-70120676 CACAGCAAGCTAAAGGCAGAGGG - Intronic
1119035279 14:71225163-71225185 CTTAGGAAGGTCAAGGCAGGAGG - Intergenic
1120025318 14:79577125-79577147 AGGAGCAAAGTCATGGCAGCAGG - Intronic
1120974104 14:90233993-90234015 CATAGCAAGGAAAAGGGAGCAGG + Intergenic
1121262280 14:92575246-92575268 CAGAGCAAGGTCAGGACAGAGGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1123049643 14:105534778-105534800 CAGAGGGAGGTCAAGACAGGGGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1127532007 15:59852579-59852601 CAGAGCACAACCAAGGCAGCAGG + Intergenic
1128727656 15:69999758-69999780 AAGGCCAAGGTCAAGGCACCTGG + Intergenic
1129117721 15:73374636-73374658 CAGATCAAGGGCAATGCAGCTGG - Intergenic
1129419239 15:75410258-75410280 CAGAGAAATGCCAAGGAAGCTGG - Exonic
1130970199 15:88726377-88726399 CAGAGGAGGGTGAGGGCAGCGGG + Intergenic
1131055132 15:89370540-89370562 CAGAGAAAGATCGCGGCAGCAGG + Intergenic
1132582020 16:689128-689150 CAGAGGCAGGTCAGGGCAGGTGG - Intronic
1132737401 16:1393757-1393779 CGGAGCAAGGCCCAGGCAGTGGG + Intronic
1132752653 16:1465887-1465909 CAGGGCAGGGGCAGGGCAGCGGG + Intronic
1132753145 16:1468228-1468250 CAGGCCAAGGTGAAGGCTGCCGG + Intronic
1133026534 16:2991158-2991180 CAGAGCAGAGTCAGGGCACCAGG + Intergenic
1133288798 16:4704374-4704396 CATAGCCAGGCCAAGGCTGCTGG - Intronic
1133805704 16:9124657-9124679 TGGACCAAGGTCAAGGCAGTTGG + Intergenic
1134029902 16:10983728-10983750 CAGACCAGGATTAAGGCAGCTGG - Intronic
1134176116 16:12007815-12007837 AAGAGCAAAGACAAGGCAGCTGG - Intronic
1136748826 16:32615189-32615211 CAGGGCAATGCCAAGGCAGTGGG - Intergenic
1137660789 16:50204262-50204284 CAGAGCACGGTCAGGGAAGGTGG + Intronic
1141080297 16:81045481-81045503 CTGACGAAGGTCCAGGCAGCAGG - Exonic
1141725015 16:85782217-85782239 AAGAGCAACCTCAGGGCAGCTGG + Intronic
1141786056 16:86201626-86201648 CAGAGGAAGGTCATAGCTGCAGG + Intergenic
1142016989 16:87754559-87754581 CAGAGAAAGATCAACGCATCAGG - Intronic
1203050959 16_KI270728v1_random:874403-874425 CAGGGCAATGCCAAGGCAGTGGG - Intergenic
1143411321 17:6711177-6711199 CACAGCACGGGCAGGGCAGCTGG - Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144784642 17:17824789-17824811 GAGAGCAAGGTTGAGGCCGCAGG - Intronic
1145982037 17:29018667-29018689 CAGAACAGGTTCAAGGTAGCTGG - Intronic
1147046444 17:37755611-37755633 CAGAGCGGGGACATGGCAGCTGG + Intergenic
1147365621 17:39957309-39957331 CAGAGCAGTGTCAAGGCATTTGG - Intergenic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1149940181 17:60855924-60855946 CTGTGCAAGGCCAAGGCAGGCGG - Intronic
1152375563 17:79917147-79917169 CACAGGAAGGCCAAGCCAGCTGG - Intergenic
1153567598 18:6434373-6434395 CAGTGGGAGGTCAAGGCAGAAGG - Intergenic
1156449640 18:37259640-37259662 CAGAGCAGGGGCAGGGCAGGAGG - Intronic
1156717002 18:40023671-40023693 CAGAGCAAGCTCTAGGCATTCGG - Intergenic
1157175566 18:45449012-45449034 CAGAGGAAGGTGCAGCCAGCAGG + Intronic
1157323834 18:46655275-46655297 CTGAGCACAGTCAAGGCAGGCGG - Intronic
1157626790 18:49057453-49057475 AAGAGCCAGGGCAAGGGAGCTGG + Intronic
1158069332 18:53452195-53452217 CAGTGGAACATCAAGGCAGCAGG + Intronic
1159005249 18:63004975-63004997 CTGAGCATGGTCAGGGCTGCTGG + Intergenic
1159938459 18:74387214-74387236 CAGAAGAAAGCCAAGGCAGCTGG - Intergenic
1160722705 19:604415-604437 CTGAGCAGGGTCGAGGCAGCAGG + Intronic
1160908984 19:1466192-1466214 CAGGTCAAGGTCAAGCCGGCTGG - Exonic
1160980117 19:1812761-1812783 CAGAGCAGGGTCAGGGTAGGAGG + Intergenic
1163623184 19:18372863-18372885 CACAGCAAGGATCAGGCAGCTGG + Intergenic
1164180174 19:22811420-22811442 GTGAGCAGGGTGAAGGCAGCAGG - Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1165018496 19:32902691-32902713 AGCAGGAAGGTCAAGGCAGCTGG + Intronic
1165055550 19:33174222-33174244 CAGAGCAAGTCAAATGCAGCAGG - Intronic
1166344195 19:42155182-42155204 CAGAGAAAGATGAAGGCAGCCGG - Intronic
1166352767 19:42207944-42207966 TAGAACAAGCTCAAGGAAGCTGG - Intronic
1168678359 19:58295386-58295408 CGGAGCAAAGGCAGGGCAGCCGG + Exonic
926533440 2:14081861-14081883 CCCAGCAAGGTCAACGCAGAAGG + Intergenic
928197576 2:29226571-29226593 GAGAGGAAGGTTAAGGCAACAGG + Intronic
928859466 2:35839455-35839477 CATTGCAAGGACAAGGCTGCAGG - Intergenic
929886127 2:45880160-45880182 CAGAGCAACGTAAATGCAACTGG - Intronic
930755154 2:54966084-54966106 TAGAGCAAGCTCCAGGAAGCAGG - Intronic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931210301 2:60187882-60187904 CAGAGCAAGGTGAAACCACCTGG + Intergenic
932143371 2:69298474-69298496 CAGAGCAAGGCCAAACCACCAGG + Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
933779015 2:85788608-85788630 GAGAGCACTGTCAAGGCAGAAGG + Intergenic
936008887 2:108912175-108912197 GAGAGAAAGGCCAAGCCAGCTGG + Intronic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
937285891 2:120750931-120750953 CAGAGCAAGGTAGAGGCAGGCGG - Intronic
937463436 2:122109370-122109392 CAGAGCAAGGTAAAGAAAGGAGG - Intergenic
938555452 2:132419202-132419224 CAGAGTAAAGTCAAGTCAGCTGG - Intronic
939177931 2:138771740-138771762 CAGAGTCGGGGCAAGGCAGCTGG + Intronic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
941994789 2:171592121-171592143 CAGAGTAAAGTCAAGGCAGTGGG - Intergenic
942831734 2:180244527-180244549 CAGAGCCAGTCCAAGGCAACTGG - Intergenic
943025356 2:182621313-182621335 CAAAGCAAGGTTAAGGGAGTGGG - Intergenic
943483643 2:188454038-188454060 CTGAGCAAGGCTCAGGCAGCAGG - Intronic
944243854 2:197512070-197512092 CCGAGCAAAGTTGAGGCAGCAGG - Intronic
945213701 2:207411309-207411331 CATAGCAAGGTCACTGGAGCAGG + Intergenic
945987243 2:216364691-216364713 CAGAGCTTGGACAAGCCAGCAGG + Intronic
946173420 2:217908752-217908774 CAGTTCAGGGCCAAGGCAGCTGG + Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947844937 2:233236333-233236355 CAGATCTTGGTAAAGGCAGCAGG + Intronic
948417912 2:237829442-237829464 CAGAACTAGGCCACGGCAGCTGG + Exonic
948825677 2:240572575-240572597 GGGAGCAAGGTGACGGCAGCTGG - Intronic
948992785 2:241563248-241563270 CAAATCCAGGCCAAGGCAGCTGG - Intronic
1168762992 20:362462-362484 CAGAGCAAGGCCAGGGTTGCCGG - Intergenic
1168906624 20:1409125-1409147 CAGAGCAATATCAAGGAGGCAGG - Intergenic
1169045886 20:2534330-2534352 AAGAGCAGGGTAAAGGCAGGAGG + Intergenic
1170162014 20:13322877-13322899 GAGAGACAGGTCAGGGCAGCGGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1172013864 20:31861716-31861738 CGGGGCGGGGTCAAGGCAGCCGG + Intronic
1172128805 20:32642285-32642307 CAGAGCAGGGCCAAGTCTGCAGG - Intergenic
1173780992 20:45757311-45757333 CAGCACAAGGCCAAGGCAGGTGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174358268 20:50012443-50012465 AAGAGAAGGGCCAAGGCAGCAGG - Intergenic
1174480235 20:50826111-50826133 CAGGGCAAGGTCAGAGCACCGGG - Intronic
1174897586 20:54467464-54467486 TAGAGCAAGGTCAGGGTGGCTGG - Intergenic
1175171858 20:57086371-57086393 TGGAACAAGGTCATGGCAGCAGG - Intergenic
1175337731 20:58206976-58206998 CAGAGCAGGTTCTAGGGAGCAGG + Intergenic
1176098890 20:63356170-63356192 CAGGGCCAGGGCAGGGCAGCAGG + Intronic
1176098941 20:63356294-63356316 CAGGGCCAGGACAGGGCAGCAGG + Intronic
1176704895 21:10107958-10107980 CTTTGGAAGGTCAAGGCAGCAGG + Intergenic
1178765067 21:35442818-35442840 AAGAGCAAGGTGATAGCAGCAGG - Intronic
1178893360 21:36538905-36538927 CAGCACCAGGTCAAGGCTGCAGG + Intronic
1179309918 21:40186230-40186252 AAAATCAAGCTCAAGGCAGCTGG - Intronic
1179354755 21:40648990-40649012 CTGAGCAAGGCCCAGGCAGGGGG + Intronic
1180730114 22:17974963-17974985 CAGAGCTGGGCCCAGGCAGCTGG + Intronic
1180802258 22:18637418-18637440 GAGAGCAAGGTGGGGGCAGCTGG - Intergenic
1180853498 22:19032970-19032992 GAGAGCAAGGTGAGGGCAGCTGG - Intergenic
1181219467 22:21357841-21357863 GAGAGCAAGGTGGGGGCAGCTGG + Intergenic
1181462651 22:23094649-23094671 CAGAGCAAGGTGGAGGCTTCAGG - Intronic
1182109430 22:27712374-27712396 CAGAGAGAGGCCAAGGCAGGAGG - Intergenic
1182261824 22:29078427-29078449 CAGAGGAAAGCCCAGGCAGCAGG + Intronic
1182353565 22:29711918-29711940 CTTAGCGAGGTCAAGGCAGGAGG + Intergenic
1182355961 22:29722302-29722324 CAGTGCAGGGGCAAGGCCGCAGG + Intronic
1182628444 22:31665722-31665744 CAGCGTAAGTTCAAGGCACCTGG + Intergenic
1183427632 22:37747905-37747927 CTGAGCAAGGGTAAGGCTGCCGG + Intronic
1184362664 22:44027496-44027518 CAGAGACAGCTGAAGGCAGCGGG + Intronic
1184450710 22:44580936-44580958 CAGTGGAAGGTAATGGCAGCTGG - Intergenic
1185005063 22:48270979-48271001 AAGTCCAAGGTCAAGGCACCGGG + Intergenic
1185045629 22:48527402-48527424 CAGGGCAAGGCCAGGGCAGCAGG + Intronic
1185058031 22:48591454-48591476 CAGGGCAAGGCCATGGCTGCAGG - Intronic
1185244027 22:49763786-49763808 CAGAGGAAGGTCAAAGCACCTGG + Intergenic
1185349556 22:50327326-50327348 CAGAGCAAGCTGCAGCCAGCCGG + Intergenic
1185413976 22:50699825-50699847 CAGAACAAGGCCAAGGAAGGAGG - Intergenic
949773174 3:7601137-7601159 AATAACAAGATCAAGGCAGCAGG - Intronic
950309042 3:11939908-11939930 CAGAGTAAGGTCGTGGCAGTTGG + Intergenic
950486437 3:13276659-13276681 CAGAGCAAGGCCAAGGCTGATGG + Intergenic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950720845 3:14881606-14881628 CAGAGAGAGCTCAAGGGAGCAGG - Intronic
950906918 3:16546866-16546888 CAGAGCAAGTTCAAGTCATAAGG - Intergenic
952275554 3:31872299-31872321 CAGAGCAAGGACAAGAAAGCAGG + Intronic
952513072 3:34076442-34076464 CAGAGAGAGGGCAGGGCAGCTGG + Intergenic
953191858 3:40695147-40695169 CAGAGCAGGGGCAGGGCAGGAGG + Intergenic
953797049 3:45994012-45994034 CAGAGCAAGATCAGAGCAGCTGG - Intronic
954444853 3:50541086-50541108 CAGGGCAAGGACTAGGCTGCTGG + Intergenic
956027279 3:64996605-64996627 CAGAGCAAGTTCAGGGTAGGAGG + Intergenic
957185822 3:76939956-76939978 CAGAGGAAGGACAAAGCAACAGG + Intronic
958984777 3:100767650-100767672 GAGACCAAGTTCAAGGCAGGTGG - Intronic
959907636 3:111728314-111728336 CAGTGGAAGGTCAAGGCAGCTGG + Intronic
960254688 3:115499353-115499375 CAGGGCAAGGAAAAGGCAGTGGG + Intergenic
962554653 3:136535417-136535439 CACAGGAAGGCCAAGGCAGGTGG + Intronic
962634869 3:137319979-137320001 CCCAGCAAGATCAAGGCAGAAGG - Intergenic
965517862 3:169641187-169641209 CAGAGCAAGATTAAGGAATCAGG + Intronic
966638016 3:182157102-182157124 CCCAGCAAGATCAAGGCAGAAGG - Intergenic
967996953 3:195174005-195174027 GAGAGGAAGCTCAAGGCAGAAGG + Intronic
968083644 3:195864036-195864058 TGGAGCAAGGCCAAGGCTGCGGG - Exonic
968435687 4:587687-587709 CAGCTCCAGGGCAAGGCAGCAGG - Intergenic
968931367 4:3581315-3581337 CAGAGCCAGGTCTGGGCTGCAGG + Intronic
970600643 4:17638851-17638873 CAGAGCAAGTTCAGGGCAGGAGG - Intronic
970708884 4:18838791-18838813 AAAAGCCAGGCCAAGGCAGCTGG - Intergenic
972775034 4:42232535-42232557 CAGAGGAAAGTCAAGGCAAAGGG - Intergenic
974056033 4:56983749-56983771 CACTGGAAGGCCAAGGCAGCAGG - Intronic
976210609 4:82664886-82664908 GAGGCCAAGGTCAAGGCAGGAGG + Intronic
978686346 4:111449384-111449406 CAGAGCAAAGTAAAAGCAGTTGG - Intergenic
978889199 4:113802596-113802618 CTTTGCAAGGTCAAGGCAGGAGG - Intergenic
979147792 4:117267209-117267231 AAGAGAAGGGACAAGGCAGCAGG + Intergenic
979665090 4:123302652-123302674 CAGAGCAGGACCAAGGCTGCAGG + Intronic
980377112 4:131964389-131964411 CTTTGGAAGGTCAAGGCAGCAGG + Intergenic
981845631 4:149164922-149164944 AAGTTCAAGGTCAAGGCAGATGG - Intergenic
983332496 4:166348437-166348459 CTGCGCAAGGCCAAGGCAGGGGG + Intergenic
985627577 5:997851-997873 CAGAGCCAGGTGAGGGCAGATGG - Intergenic
986203895 5:5605115-5605137 CAGAGAAAGGTCAAGGAAGTGGG - Intergenic
987536704 5:19198948-19198970 CAAAGCAAGGTCAAAGCTTCAGG + Intergenic
988715027 5:33817149-33817171 CACAGCAAGGTCAAAGCATGTGG + Intronic
990703430 5:58500238-58500260 GAAAGCAAGGTCAAGACATCAGG - Intergenic
997207433 5:132058054-132058076 ATGAGAAAGTTCAAGGCAGCAGG - Intergenic
997553571 5:134775195-134775217 CTGAGAAAGGTCAAAGCAGCAGG - Intronic
997736555 5:136216593-136216615 CAGAGCCAGGCCAAGGCCCCTGG - Intronic
997887493 5:137643515-137643537 CAGAGGTAGCTCAAGGCAGCAGG + Intronic
998742827 5:145224601-145224623 CAGAGGAGGGTCAACTCAGCTGG + Intergenic
998804402 5:145904504-145904526 CAGAGCCAAGTCCAGGCTGCAGG - Intergenic
1001422660 5:171599385-171599407 CAGAGCCAGGAAATGGCAGCCGG + Intergenic
1001990707 5:176113565-176113587 CAGGGCAATGCCAAGGCAGTGGG - Intronic
1002226166 5:177724575-177724597 CAGGGCAATGCCAAGGCAGTGGG + Intronic
1002267684 5:178046638-178046660 CAGGGCAATGCCAAGGCAGTGGG - Intronic
1002540501 5:179903353-179903375 CAGAGCAAACTCAACCCAGCAGG + Intronic
1002581221 5:180210419-180210441 CAGAGTGAGGTGAAGGCAGCTGG - Intergenic
1002701331 5:181127315-181127337 CAGACCAAGGCCAATGAAGCAGG - Intergenic
1002703250 5:181142265-181142287 CAGACCAAGGGCAGAGCAGCTGG + Intergenic
1003351947 6:5326270-5326292 CAGAGCAAGCTCAAGGTACCTGG + Intronic
1003980375 6:11384147-11384169 CAGTGGGAGGTCCAGGCAGCTGG - Intergenic
1006699340 6:35959053-35959075 TAGGGCAAGGTCAAGGTTGCTGG - Intronic
1006799687 6:36752059-36752081 GACTGCAAGCTCAAGGCAGCAGG + Intronic
1007252149 6:40503064-40503086 GAGAGCAAGGACAGGGCAGAGGG + Intronic
1010279096 6:74003253-74003275 AAGAGCAAAGGCATGGCAGCAGG + Intergenic
1011517143 6:88166621-88166643 CACAGCGAGGTCATGGCAGCGGG - Intergenic
1011570425 6:88728724-88728746 TAGAGGAAGGTACAGGCAGCGGG - Intronic
1012005174 6:93704924-93704946 CAGGGCAAAGGCAAGGCAGAGGG - Intergenic
1012410073 6:98947383-98947405 CAGAGGGAAATCAAGGCAGCAGG + Intronic
1013285220 6:108675419-108675441 CTGGGCTTGGTCAAGGCAGCAGG - Intronic
1013297395 6:108769915-108769937 TGGAGAAATGTCAAGGCAGCTGG + Intergenic
1013563146 6:111327012-111327034 AAGACCAGGGTCAAGGAAGCAGG + Intronic
1014365023 6:120529076-120529098 CAGAGCAAGGTTTAGACACCAGG + Intergenic
1014682388 6:124447863-124447885 CAGAGAAAGGTGAAGACAGAGGG - Intronic
1015434053 6:133165569-133165591 CAGAATAAGGCCAAGGCAGGAGG + Intergenic
1015688633 6:135895436-135895458 CAGAGAGAGGTCAGGGCACCAGG - Intronic
1016125526 6:140397822-140397844 CAGTGAAAGGGCAAGGCTGCAGG + Intergenic
1016696279 6:147000008-147000030 CGGATCAAGGTAAAGGCACCAGG + Intergenic
1016964697 6:149707952-149707974 AAGAGAAAGGCCAAGGCAGTAGG - Intronic
1017052327 6:150405236-150405258 CAGGGCAAGGTCAAGGCTGAAGG - Intronic
1017656070 6:156631075-156631097 GAGAGCAAGGTCCAGGCACAGGG + Intergenic
1021808849 7:24382998-24383020 CAGGGCAAGTACAAGGAAGCAGG + Intergenic
1021850458 7:24803400-24803422 AAGAGAAAGCTCAAGGCAGGTGG - Intronic
1022510907 7:30934281-30934303 CAGAGCAAGGACAGGTGAGCTGG - Intergenic
1023867931 7:44247599-44247621 CAGGGAAGGGTCAAGGCGGCTGG + Intronic
1026871091 7:73852266-73852288 CAGAACAAGATCCAGGCAGGAGG - Intergenic
1027290946 7:76709998-76710020 CAGAGCAAGGTCTGCTCAGCAGG + Intergenic
1027408205 7:77885338-77885360 CAAGGCAAGGCCAAGGCAGGAGG - Intronic
1027753968 7:82186475-82186497 CAGAGCAAAGTTAAGGTTGCAGG + Intronic
1028887716 7:95952780-95952802 CAGAGGAAGGACGAGGCAGAGGG - Intronic
1030107271 7:105997607-105997629 CAGAGGAAGGTGATGGCTGCAGG + Intronic
1030265836 7:107621041-107621063 CAGAGGTAGGGCAAGGCAACAGG - Exonic
1032086289 7:128885498-128885520 AAGACCAAGCTCCAGGCAGCAGG + Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1033834789 7:145296790-145296812 TTGAGCAAGGTCAAGGCACATGG - Intergenic
1034860078 7:154587355-154587377 CAGATCAAGGCAAAGGCAGTGGG - Intronic
1035154123 7:156898325-156898347 CAGTGCAAGGTGAAGTGAGCCGG - Intergenic
1035469843 7:159102725-159102747 CGGAGCAGGGTCAGGGCAGGAGG + Intronic
1036180290 8:6578766-6578788 CAGATCAATGTAAAGGCAGGTGG + Intronic
1039032315 8:33323984-33324006 CAGAGCAATTTCAAGGAATCAGG + Intergenic
1041803589 8:61825619-61825641 CAGAGAAAGGACAAGGCATGGGG - Intergenic
1042876923 8:73448756-73448778 CAGAGCAACGACAATCCAGCTGG + Intronic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045359138 8:101415613-101415635 CACTGCCAGGTCAAGGGAGCAGG + Intergenic
1046082557 8:109389429-109389451 CAGAGCAAAATTAAGGCAACAGG - Intronic
1046747355 8:117890740-117890762 GTGAGCAAGTTCAAGGTAGCAGG + Intronic
1047421046 8:124708509-124708531 CAGACCAAGGCAAAGGCAGCTGG + Intronic
1048494489 8:134923775-134923797 CAAAGCAAAGGCAAGGCAACTGG - Intergenic
1048942938 8:139418288-139418310 CAGAGCAAGGTCCAGGAAAGGGG - Intergenic
1049171185 8:141161743-141161765 CAGAGTACGATCAAGCCAGCAGG - Intronic
1049204476 8:141357324-141357346 CAGCGCAAAGACACGGCAGCAGG + Exonic
1049383878 8:142331235-142331257 CAGAGCCAGGGCAAGACTGCTGG - Intronic
1049521211 8:143092329-143092351 CAGAGAAAGGTGAAGACACCAGG + Intergenic
1049566233 8:143340552-143340574 AAGAGAAAGCTCAGGGCAGCCGG - Intronic
1049815482 8:144597190-144597212 AACAGCAAGGTGAAGCCAGCAGG + Intronic
1053642161 9:40095038-40095060 CTTTGGAAGGTCAAGGCAGCAGG + Intergenic
1053763977 9:41370419-41370441 CTTTGGAAGGTCAAGGCAGCAGG - Intergenic
1054323055 9:63692430-63692452 CTTTGGAAGGTCAAGGCAGCAGG + Intergenic
1054542589 9:66281609-66281631 CTTTGGAAGGTCAAGGCAGCAGG - Intergenic
1057165884 9:92925151-92925173 CAGAGCAGAATCCAGGCAGCTGG - Intergenic
1057191465 9:93090289-93090311 CTGTGCAAGGTCAAAGCAGGAGG - Intergenic
1057518608 9:95742245-95742267 CAGAGCAAGGACATGTCACCAGG + Intergenic
1057730919 9:97607469-97607491 CAGAGCCAGGCCAAGGAATCTGG + Intronic
1058355025 9:104074244-104074266 CAGAGCAACCTCAGGGTAGCTGG - Intergenic
1059409820 9:114124838-114124860 CAGACCATGGGCAAGGAAGCAGG + Intergenic
1059644459 9:116250961-116250983 CATAGTAACGTCATGGCAGCTGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061866459 9:133494021-133494043 GAGAGCCAGGTCAGGGCAGAGGG + Intergenic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062537338 9:137026818-137026840 CAGAGCAGGGCCAAGGGAACAGG - Intronic
1202789927 9_KI270719v1_random:78057-78079 CTTTGGAAGGTCAAGGCAGCAGG + Intergenic
1185481021 X:446367-446389 CACAGCATGGCCGAGGCAGCAGG + Intergenic
1189254299 X:39625629-39625651 AATACCAAGGACAAGGCAGCAGG + Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190304025 X:49072372-49072394 CAGAGCATGCTTAAGGCACCAGG - Intronic
1190375572 X:49785340-49785362 CAGGGCAGGGTCCAGGCAGGGGG - Intergenic
1191803097 X:65102971-65102993 CAGAGCAAGATCACAGGAGCGGG + Intergenic
1192268699 X:69558112-69558134 CATAGAAGGGTCAAGACAGCTGG + Intergenic
1193525380 X:82581730-82581752 CCCAGCAAGGTCAAGGCAGAAGG - Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1198520359 X:137446245-137446267 CAAAGCAGGGTCAGGCCAGCTGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic