ID: 1147941898

View in Genome Browser
Species Human (GRCh38)
Location 17:44054682-44054704
Sequence CCCATCACTGCTGAGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147941898 Original CRISPR CCCATCACTGCTGAGTGGCA GGG (reversed) Intronic
902264225 1:15249811-15249833 TCCATCACTGCTGGGTGGGGAGG - Intronic
903008098 1:20311668-20311690 CCCATCACTGCGGATAGGAAGGG - Intronic
903322579 1:22551877-22551899 CCCATCACTGCCTAGGGGCTGGG - Intergenic
903539646 1:24089792-24089814 CCCAGCATTGCTGAGTGACCTGG - Intronic
903743823 1:25573592-25573614 CCCAACACTGTTGGGGGGCAGGG + Intergenic
903812372 1:26041867-26041889 CCCAGCAGTGCTGGGTGGGAGGG - Intronic
906043098 1:42804699-42804721 CCCAACACTCCTGAGTAGCTAGG + Intergenic
906368538 1:45232568-45232590 AACATCACTGATGAGTGGCAAGG - Intronic
906478496 1:46185587-46185609 CCAATCACTGCTGCTTGCCAGGG - Exonic
908095537 1:60733287-60733309 CCCATGCCCTCTGAGTGGCAGGG - Intergenic
909702392 1:78541759-78541781 CCATTCACTCATGAGTGGCATGG + Intergenic
910368112 1:86487873-86487895 CCCATAACTGCTGTGTGTCATGG - Intronic
910491281 1:87774470-87774492 CCCATCACTGCTGAACTGTATGG - Intergenic
910810758 1:91233720-91233742 CCCATCAGAGTTGAGTGGAAAGG - Intergenic
914255410 1:145958073-145958095 CCCATCACTGGTGATTGGCATGG - Intergenic
915284747 1:154845609-154845631 CGCAGCATTGCTGTGTGGCATGG + Intronic
915741124 1:158119039-158119061 CCCTTGACTGCAGAGTGGGAGGG + Intergenic
916045707 1:160998656-160998678 CCTACCACTGCTGAGTGGCCTGG - Exonic
916356158 1:163910672-163910694 CCCATCTCTCCTGAGTAGCTGGG - Intergenic
917513538 1:175688167-175688189 CTCAGCTCTGCTGAGTGCCAAGG + Intronic
919774265 1:201183940-201183962 CCCATCCCTGCCCAGTGGCTTGG - Intergenic
921264122 1:213408285-213408307 CCCTTCACTGCTGATGGGCAAGG + Intergenic
924386269 1:243500736-243500758 CACATCACTTCTGAGAGGCAAGG - Exonic
1062832817 10:617327-617349 CACATCACAGCTGAGTGGGGTGG - Intronic
1063128269 10:3154434-3154456 GCCATCAATCCTGAGAGGCAGGG - Intronic
1063420784 10:5911199-5911221 GCTAACACTGCTAAGTGGCAGGG - Intronic
1063780062 10:9312316-9312338 CTCCTCACTGCTGAGTAGCAGGG + Intergenic
1064541253 10:16407126-16407148 CTCATTGCTGCTAAGTGGCAGGG - Intergenic
1064649567 10:17495082-17495104 TCTATCAATGCTGTGTGGCATGG + Intergenic
1065494078 10:26311360-26311382 CCCATCTCTCCTGAGTAGCTGGG - Intergenic
1065949645 10:30640564-30640586 TCCATCACAGCTGAGTGTCAGGG + Intergenic
1066433334 10:35373364-35373386 CCCAACACTGCTGGGTGGCAAGG - Intronic
1070948998 10:80415798-80415820 CCCATCACTGGACAGTGGGAAGG + Intronic
1071999987 10:91185507-91185529 ACCATCACTGCTGAGCCCCATGG + Intronic
1074405951 10:113180621-113180643 CCCAGCAGGGCTGAGTGGCCTGG + Intergenic
1076191089 10:128483912-128483934 CCCTTCCCAGCTGAGTGGCCTGG + Intergenic
1076381149 10:130025231-130025253 CCCATCACTGCTCTGAAGCAGGG - Intergenic
1076841841 10:133049722-133049744 CCCACCCCTGCTGTGGGGCAAGG - Intergenic
1076998873 11:312342-312364 CACATCACTGCGGAGTGGGGTGG - Intronic
1080573797 11:33580083-33580105 CCCATCACCTCTGGGTGACAAGG + Intronic
1084864134 11:72041816-72041838 CCCATACCTTCTGCGTGGCAAGG + Intronic
1084933690 11:72575905-72575927 CCCATCACTGCTCCATGGCCAGG + Intergenic
1086054856 11:82634778-82634800 CCCATCACTACTCATTGCCATGG + Intergenic
1089019522 11:115198353-115198375 CTCAGCACTGCTGAGAGGCAAGG - Intronic
1089786926 11:120914424-120914446 CCCATGAGTAGTGAGTGGCAGGG + Intronic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1090641321 11:128731261-128731283 CCCAGCACTGCTCAGGGGCAGGG + Intronic
1090802386 11:130181020-130181042 CTCATCCCTGCTGGGTGGGATGG + Intronic
1091014936 11:132041704-132041726 CCCAGTACTGCTGAGTTGCTGGG + Intronic
1091236978 11:134028734-134028756 CCCATCAATGCTGAGTGCCAAGG + Intergenic
1092004306 12:5056076-5056098 CCCATCACTGATGCTGGGCATGG + Intergenic
1092109298 12:5947570-5947592 GTCATAACTGCTGGGTGGCAGGG - Intergenic
1094672956 12:32588683-32588705 CCCAGCATTGCTGAGTGGCCTGG + Intronic
1097315609 12:58167877-58167899 TCCAGCACAGCTGTGTGGCAAGG - Intergenic
1097725181 12:63067038-63067060 GCCCTCACTGCTGAGGAGCAAGG + Intergenic
1097975583 12:65683161-65683183 CACATCACTGCTTAATGCCAGGG - Intergenic
1099735104 12:86557375-86557397 GGCATCACTGGTGACTGGCAGGG - Intronic
1100451345 12:94709900-94709922 CCCATCATAGCTGGGTGGCCTGG - Intergenic
1101847118 12:108371458-108371480 TCCATCATTGCTGCCTGGCAGGG - Intergenic
1102220039 12:111188067-111188089 TCGATGACAGCTGAGTGGCAGGG + Intronic
1102802663 12:115750206-115750228 GCCATCAGTGCTGAGGGACAGGG - Intergenic
1104619292 12:130298773-130298795 CTCATCTCTTCTGAGTGCCAGGG + Intergenic
1105577661 13:21669163-21669185 CCCATCACTGCTGGCTGCCTCGG + Intergenic
1108477871 13:50839212-50839234 CCCATCACTTCTTAGCTGCAGGG + Intronic
1112159796 13:96855344-96855366 CACACCACTGTTGAGTGACAAGG + Intergenic
1112852094 13:103718570-103718592 CTCATCAGTGCCCAGTGGCATGG + Intergenic
1116939271 14:50774134-50774156 CTCCTTACTGCTCAGTGGCATGG - Intronic
1117311781 14:54532950-54532972 CCCATCTCTGCTGAGTTTCTTGG + Intronic
1119755612 14:77116595-77116617 ATCCTCACTGCTGAGTGGCAGGG + Exonic
1120048626 14:79838736-79838758 CCCACCATGTCTGAGTGGCATGG - Intronic
1120215475 14:81677414-81677436 CCCATCACTGCAGAGAGCCAAGG + Intergenic
1122353860 14:101112125-101112147 CCCAGCACTCCTGGATGGCAGGG + Intergenic
1122411852 14:101529601-101529623 CCCATCACTGCCAGCTGGCATGG + Intergenic
1124705827 15:31963422-31963444 CCCATTACTGCTGAGTGGAGTGG + Intergenic
1127024547 15:54789195-54789217 CCCATAACTGCTCAATGACATGG + Intergenic
1129413483 15:75362220-75362242 CTCATCCCCGCTGTGTGGCAGGG - Intronic
1129714008 15:77836512-77836534 CTCCTCACTGCTGAGGGGCTTGG - Intergenic
1131552440 15:93369024-93369046 CCCATCACTAGTGAGTGGATTGG + Intergenic
1132225012 15:100133622-100133644 CTCATCACTCCTGGGAGGCAGGG - Intronic
1132574376 16:657801-657823 GCCATCCCTGCTGACTGCCAGGG - Exonic
1132863256 16:2081789-2081811 TCCAACACAGGTGAGTGGCATGG + Exonic
1133642888 16:7734897-7734919 CCCATCTCTACTAAGAGGCATGG + Intergenic
1135882211 16:26268813-26268835 AGCCACACTGCTGAGTGGCATGG - Intergenic
1136225386 16:28856914-28856936 CCCATCACATCAGAGTGACATGG - Intronic
1137961870 16:52889265-52889287 CCCATCTCTACTGAGTGAGAGGG + Intergenic
1138852916 16:60651625-60651647 CCCATCACTTCTAAGGGGAATGG + Intergenic
1139209253 16:65060243-65060265 ATCATCATTGCTGAGTGGGAGGG - Intronic
1139548896 16:67662664-67662686 CCCAGCAGTGTGGAGTGGCATGG - Exonic
1141006623 16:80358764-80358786 CCCATATCTGCTGAGTGCCCTGG - Intergenic
1141815583 16:86407485-86407507 CTTATCACTGCTGAGGGGCCTGG + Intergenic
1142394022 16:89821115-89821137 CCCCACACTGCTCAGTGACAAGG - Intronic
1142749012 17:1976519-1976541 CACACTGCTGCTGAGTGGCAGGG - Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145732195 17:27199206-27199228 CCTATCTCTGCTGAGGGCCATGG - Intergenic
1146966940 17:37039602-37039624 CCCAGCAGTGCTGAGGGGAAAGG + Intronic
1147941898 17:44054682-44054704 CCCATCACTGCTGAGTGGCAGGG - Intronic
1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG + Exonic
1150500277 17:65643975-65643997 CCCATTCCTGCTGTATGGCATGG - Intronic
1151363005 17:73599845-73599867 CCCATCACAGCTGAGGAGCCTGG - Intronic
1151667807 17:75555717-75555739 CCCAGCCCTCCTCAGTGGCATGG - Intronic
1152028958 17:77830079-77830101 CCCAGGAGTGCTGAGTGGCGGGG + Intergenic
1152350602 17:79782046-79782068 CGCCTCTCTGCTGGGTGGCAGGG + Intronic
1153131668 18:1860741-1860763 TTCATCACTCCTGAGAGGCAAGG - Intergenic
1153218109 18:2838667-2838689 TTCATCACTCCTGAGAGGCAAGG - Intergenic
1154177056 18:12092676-12092698 CCCAGCACTGCTGATTGGCATGG - Intergenic
1155091726 18:22518018-22518040 CCTACCACAGCTGAATGGCATGG - Intergenic
1156397152 18:36708741-36708763 CACATCACTGCTGCTTGACAGGG - Intronic
1158525916 18:58213624-58213646 CTCATCACTGGTGAGTGACTTGG - Intronic
1160427721 18:78789938-78789960 CTCCTCACTGCTCAGTGGCAGGG + Intergenic
1161299423 19:3535725-3535747 CCCATGCCTGCTGGGTGGCTGGG + Intronic
1161698532 19:5783287-5783309 CCCACCACTGCTGTCAGGCAGGG + Exonic
1163234701 19:16023616-16023638 CCCAGCACTGCCCAGTGGGAGGG + Intergenic
1164578415 19:29419347-29419369 CCCATCACTCCTGAGGGGGTGGG + Intergenic
1165881511 19:39047326-39047348 CCCATCACTGCTTACAGGCTGGG - Intergenic
925195571 2:1921923-1921945 ACAATCTATGCTGAGTGGCAAGG - Intronic
925686513 2:6479157-6479179 CCCCTCACTGCAGAGTGGCCAGG + Intergenic
925832907 2:7913687-7913709 CCTAGCACTGCAGACTGGCATGG + Intergenic
925866104 2:8227462-8227484 CCCATCATTGCAGAGTATCAAGG + Intergenic
927937761 2:27085147-27085169 CCCTCCACTCCTGAGTGGGAAGG - Exonic
928142181 2:28739392-28739414 CCCATCACTGTGGAGTAGCCTGG + Intergenic
929533250 2:42765087-42765109 CCCATCACTGCCAACTGGCTGGG + Intergenic
932468309 2:71938162-71938184 GGCAGCACTGCTGAGTGTCAGGG - Intergenic
933726432 2:85430113-85430135 CCCAGCACTGCTGAGTCACAGGG + Intronic
935147725 2:100407535-100407557 TCCATCACTTCTGCATGGCAGGG + Intronic
935898664 2:107766292-107766314 CCTATCACTGCTTAGTAACAGGG - Intergenic
936670529 2:114651152-114651174 CCTATTACTCCTGAGTGGGAGGG - Intronic
937966627 2:127516508-127516530 CCCAGTACTGCTGAGAGGCCAGG + Intronic
938632045 2:133177915-133177937 TTCATCAATGCTGAGTGGCAAGG + Intronic
939955593 2:148525492-148525514 CACATGCCTGCTGAGTGGAAAGG + Intergenic
940071202 2:149690026-149690048 TCCATCTCTGCTCAGTGCCAAGG - Intergenic
941179971 2:162247811-162247833 CCCATAACTTTTGAGTGGTAGGG + Intergenic
941745010 2:169077965-169077987 TCCATGATTGCTGAGAGGCAGGG - Intronic
946255383 2:218438240-218438262 CCCTTCACTCCTCTGTGGCAGGG + Intronic
947070733 2:226285283-226285305 CCTGTCACTGATGAGTGGCAAGG + Intergenic
947998675 2:234549286-234549308 CCCATCACTGATAAGTCACATGG + Intergenic
948759620 2:240182680-240182702 CACAGCACTGCTGAGTGTCTGGG + Intergenic
948856195 2:240731807-240731829 CCCATCACTGCTGTGCCACAGGG + Intronic
1170607154 20:17882847-17882869 CCCATCACTGGTGGGTTGCAGGG - Intergenic
1171317962 20:24212031-24212053 ACCAACACTGCTCAGTGCCAGGG - Intergenic
1172844137 20:37919670-37919692 CCCAGCTCAGCTGGGTGGCAAGG - Intronic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1173569262 20:44066184-44066206 TATATCACTGGTGAGTGGCAGGG - Intronic
1175036461 20:56005142-56005164 CACAGCACTGGTGATTGGCAAGG + Exonic
1175952586 20:62591296-62591318 CCCAGCTTTTCTGAGTGGCAGGG - Intergenic
1176934792 21:14854084-14854106 TCCATCACTGGTCAGTGGCAGGG + Intergenic
1179803857 21:43825134-43825156 CCCCTCACTGCTCACAGGCAGGG - Intergenic
1179880221 21:44290514-44290536 CCTGTCACTGCTAAGTGCCAGGG - Intronic
1182053129 22:27328409-27328431 CACATAGCTGGTGAGTGGCAGGG + Intergenic
1182178445 22:28318230-28318252 CCCATTACTGCTGACTTGCCTGG + Intronic
1182759560 22:32711180-32711202 CCCATAACAGCTGGGTGGCCAGG + Intronic
1183224581 22:36540732-36540754 CACAGCACTGCTTGGTGGCAGGG - Intergenic
1183834137 22:40438138-40438160 CCAATTACTGCTGGGTGACATGG + Intronic
1184527749 22:45035546-45035568 CCCAATACTGCTGTGAGGCAGGG + Intergenic
1184709158 22:46238075-46238097 ACCATCGCTGCTGAGTGTCCCGG - Exonic
1184919955 22:47599123-47599145 CCCATCCCTGCAGAGTGTCCTGG - Intergenic
949810503 3:8001718-8001740 GCCATCCCTGCTGTGTGGCTTGG + Intergenic
950090380 3:10290530-10290552 CCCCTCCCTGCTGAGTGCCCTGG - Intronic
950312898 3:11974685-11974707 GCCCTCACTGCTGATAGGCAGGG + Intergenic
953719858 3:45346014-45346036 CCAATCACTGATAAGGGGCATGG - Intergenic
953849355 3:46454430-46454452 CCCATAGATGCTGAGTGCCAGGG - Intronic
956095022 3:65707169-65707191 TCCTTCAGTGCTGATTGGCAGGG + Intronic
956896581 3:73667023-73667045 CCCATCACTGTAGAGTAGCAGGG - Intergenic
961042937 3:123690082-123690104 GCCAGCCCTGCTGAGTGGCTGGG + Intronic
961571116 3:127799407-127799429 CCCATGACTGGTGAGTGGTGAGG - Intronic
963045185 3:141097109-141097131 CCCATGCAGGCTGAGTGGCATGG - Intronic
963736243 3:149020457-149020479 CCCATGGCTGGTGAGTGACAAGG - Intronic
965027100 3:163316215-163316237 CCTGTCAATGCTGTGTGGCATGG - Intergenic
966353594 3:179056802-179056824 CCCATCACAACTTAGTGGCTGGG - Intronic
969264627 4:6056403-6056425 CCCATTTCTGCAGAGTGGCCTGG + Intronic
970581493 4:17477769-17477791 CCCATAACTACGGTGTGGCAGGG + Intronic
972438084 4:39054316-39054338 CCTATATCTGGTGAGTGGCAGGG - Intronic
973873367 4:55188804-55188826 CTCATTACTGCTGAGTAGTAGGG - Intergenic
975743033 4:77449149-77449171 AGCATCACTTCTGAATGGCAGGG - Intergenic
976504666 4:85832829-85832851 CCCATGACAACTCAGTGGCATGG - Intronic
978096353 4:104783793-104783815 ACCAGGACTGCTGAGTGCCATGG + Intergenic
980444296 4:132886103-132886125 CCCATCACAACTTAGTGGCTGGG - Intergenic
982112816 4:152072067-152072089 AGCAGCTCTGCTGAGTGGCATGG + Intergenic
982388771 4:154840970-154840992 CCCATCACTACTATGAGGCATGG - Intergenic
984850283 4:184146729-184146751 CCCATCCCATCTGAGAGGCAGGG - Intronic
985807858 5:2060314-2060336 CCCACCAATGCTGAGTGGAGCGG + Intergenic
987090810 5:14506585-14506607 CCCAGCACTGCCAAGTGCCAGGG - Intronic
989585784 5:43073058-43073080 CCCATCAGTCTTCAGTGGCAAGG + Intronic
994077030 5:95664742-95664764 CACTTCACTGCTGAATGGAAAGG - Intronic
996018401 5:118566474-118566496 CCAATTACTGCTGATTGGCTGGG + Intergenic
996088088 5:119324443-119324465 CCAGTCACTGCTGAGTCACAGGG + Intronic
996894622 5:128465301-128465323 CCCACCAGTGCTGTGTGACATGG - Intronic
997225513 5:132206544-132206566 CCCATCACTGATGATTGGGAGGG - Intronic
998068499 5:139178134-139178156 ACCATGTCTGCTGAGTGGCCAGG + Intronic
999267663 5:150277390-150277412 CCCATCAGTGCTGATTTCCAAGG - Intronic
999393084 5:151208511-151208533 CCCAAATCTGCTGAGTGGCTGGG + Intronic
1001304292 5:170560533-170560555 CACAACACTGCTGTGTGACAGGG - Intronic
1001432822 5:171676750-171676772 CCCAGCAGTGCTCAGTGGGAGGG + Intergenic
1001697842 5:173685637-173685659 CCCAGGACTGCTCAGTGGAAAGG - Intergenic
1003495115 6:6657021-6657043 CCCATGACTACTGAGTCCCAGGG + Intergenic
1003498001 6:6681287-6681309 CCCATCGCAGCTGTGTGACATGG - Intergenic
1003758670 6:9150516-9150538 CCCTTCACTGCTGTCTGTCAGGG - Intergenic
1005799488 6:29406105-29406127 GGCATCAATGCTGAGAGGCATGG + Intronic
1009241655 6:61193067-61193089 CTCAGGACTGCTGAATGGCAGGG - Intergenic
1009544875 6:65008938-65008960 CCCATCACAGCTTAGTGGCTGGG - Intronic
1009925830 6:70119631-70119653 CACACCACTGGTAAGTGGCAGGG - Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015455797 6:133424840-133424862 CCCATCCCTTCTGAGTGGGCGGG - Intronic
1017135997 6:151147914-151147936 CCCATGACTGCTGAGTGCCTGGG - Intergenic
1017544755 6:155438725-155438747 CGCATAGCTGCAGAGTGGCATGG - Intronic
1019023505 6:168939193-168939215 CCGTTCACTGCTGAGTGCCAGGG + Intergenic
1019359302 7:596496-596518 CCCAGCCCTGCTGAGAGCCACGG + Intronic
1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG + Intronic
1019873363 7:3788197-3788219 CCCATGACTGTTGAGAGGCGGGG - Intronic
1021358165 7:19679764-19679786 CTCATTACTGGTAAGTGGCAAGG - Intergenic
1024338870 7:48237217-48237239 CCCATGACTCCTGAGCAGCAAGG + Intronic
1027640446 7:80726995-80727017 CCCATCAATTCTGATTGGCTGGG - Intergenic
1028630626 7:92929722-92929744 CCCAGCACAGCTGAGTGGCTGGG + Intergenic
1034351106 7:150415279-150415301 CCCAGCTCGGCTGAGTGGCCAGG + Intergenic
1036061122 8:5321876-5321898 CGCATTACTGCTGAGTGTAAAGG + Intergenic
1036752353 8:11451277-11451299 GCCATCACAGCCCAGTGGCAAGG + Intronic
1037740805 8:21607856-21607878 CCCTTCACTGCTGAATTTCAGGG - Intergenic
1038494130 8:27989838-27989860 TCCAGCACTGCTAAGTTGCAAGG + Intronic
1038777152 8:30541508-30541530 TCCATCCCTCCTGAGAGGCAGGG - Intronic
1039480906 8:37872594-37872616 TCCATCACTGCTGAGTGAAAGGG + Exonic
1040459618 8:47634691-47634713 CCCACCATGGCTGAGTGGGAGGG + Intronic
1044552715 8:93529934-93529956 CCATTCACTGCTGCCTGGCAAGG - Intergenic
1045034847 8:98168899-98168921 CACACCACTGCTTAGTAGCAGGG + Intergenic
1047143296 8:122167118-122167140 CCCAACCCTGCTGGGTTGCATGG + Intergenic
1048843394 8:138584279-138584301 CCCATCACAGTTGTGTTGCAAGG + Intergenic
1049573718 8:143381129-143381151 CCCACCATTGCAGAGTGGCCAGG + Intronic
1052784910 9:32819412-32819434 CCCATCACAGTTACGTGGCAGGG + Intergenic
1055686587 9:78781719-78781741 CACATGACTCCTGAGTGGTAAGG - Intergenic
1055913229 9:81374608-81374630 CTCAAAACTGCTGAGTGGGAAGG - Intergenic
1056223293 9:84470642-84470664 CCCAGCACTCCTGAGGGCCAGGG + Intergenic
1059416145 9:114163692-114163714 CCAATCCCTGCCGAGTGGCCAGG - Intronic
1059446453 9:114341290-114341312 CCCTTCACTGCTGGGTCCCAGGG + Intronic
1059486950 9:114634303-114634325 CCCAACAAGGCTGAGAGGCAAGG + Intronic
1059820955 9:117971440-117971462 CCACTCACTGCTGAGAGGTAAGG - Intergenic
1060733831 9:126053855-126053877 GCCATCACTGCCAAGGGGCATGG - Intergenic
1060771660 9:126336383-126336405 CCCAGCACTGCTGACTTTCAGGG + Intronic
1061942419 9:133890922-133890944 CCCATCCCTGCAAACTGGCAAGG + Intronic
1061989423 9:134150523-134150545 CCCAACAATGCTGAGTAACATGG - Intronic
1062181255 9:135192437-135192459 CCCATCAGGGCTGAGTGGAGGGG - Intergenic
1189238450 X:39507078-39507100 CCCATGGCTGCTTAGTGGTAGGG - Intergenic
1189347855 X:40255869-40255891 CCAACCACTGCTGGGTGGGAAGG + Intergenic
1190116320 X:47628048-47628070 CCCACCAGTGCTGGGTGACAGGG + Intronic
1192218385 X:69179786-69179808 CTCACCTCTGCTGAGTGGCGTGG + Intergenic
1192795018 X:74419817-74419839 GCCTTCCCTGCTGAGTGGCGTGG + Intergenic
1192988847 X:76428670-76428692 CTCATCACGGGTGGGTGGCACGG - Exonic
1196416544 X:115477824-115477846 CTCATAACTGCTAAGTTGCATGG - Intergenic
1198523573 X:137476268-137476290 GCCATCAGTGACGAGTGGCAGGG + Intergenic
1201743330 Y:17346027-17346049 ACCATCAGTCCTCAGTGGCAAGG + Intergenic
1201969344 Y:19774481-19774503 CCCCTCTCAGTTGAGTGGCATGG - Intergenic