ID: 1147945225

View in Genome Browser
Species Human (GRCh38)
Location 17:44076995-44077017
Sequence CACTATGAACCGATGGTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147945210_1147945225 27 Left 1147945210 17:44076945-44076967 CCTGGCCCCATCCCCATCCCCCA 0: 1
1: 0
2: 24
3: 260
4: 2031
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945220_1147945225 9 Left 1147945220 17:44076963-44076985 CCCCAGGAGGATCTAAAACAAAC 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945212_1147945225 22 Left 1147945212 17:44076950-44076972 CCCCATCCCCATCCCCCAGGAGG 0: 1
1: 1
2: 8
3: 100
4: 847
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945218_1147945225 14 Left 1147945218 17:44076958-44076980 CCATCCCCCAGGAGGATCTAAAA 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945216_1147945225 16 Left 1147945216 17:44076956-44076978 CCCCATCCCCCAGGAGGATCTAA 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945217_1147945225 15 Left 1147945217 17:44076957-44076979 CCCATCCCCCAGGAGGATCTAAA 0: 1
1: 0
2: 0
3: 9
4: 179
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945222_1147945225 7 Left 1147945222 17:44076965-44076987 CCAGGAGGATCTAAAACAAACAC 0: 1
1: 0
2: 2
3: 16
4: 155
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945215_1147945225 20 Left 1147945215 17:44076952-44076974 CCATCCCCATCCCCCAGGAGGAT 0: 1
1: 0
2: 5
3: 60
4: 501
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945221_1147945225 8 Left 1147945221 17:44076964-44076986 CCCAGGAGGATCTAAAACAAACA 0: 1
1: 1
2: 1
3: 18
4: 252
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945214_1147945225 21 Left 1147945214 17:44076951-44076973 CCCATCCCCATCCCCCAGGAGGA 0: 1
1: 3
2: 4
3: 66
4: 515
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1147945219_1147945225 10 Left 1147945219 17:44076962-44076984 CCCCCAGGAGGATCTAAAACAAA 0: 1
1: 0
2: 1
3: 12
4: 198
Right 1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147945225 Original CRISPR CACTATGAACCGATGGTGCT GGG Exonic
903545340 1:24120459-24120481 CACTTTGAATCCATGGTGTTAGG + Exonic
915835843 1:159173749-159173771 CAATGGGAACTGATGGTGCTAGG + Intronic
918162395 1:181913719-181913741 CACTGTTAAAAGATGGTGCTGGG + Intergenic
923627873 1:235628753-235628775 CACTTTGATCCGCAGGTGCTAGG + Intronic
1069302823 10:66928988-66929010 AACTATCAAAAGATGGTGCTAGG + Intronic
1074001506 10:109378290-109378312 CACTATGCACAGAGAGTGCTAGG + Intergenic
1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG + Intronic
1098520890 12:71434381-71434403 CTCTATTAACAAATGGTGCTGGG + Intronic
1102255185 12:111410879-111410901 CTCTATGAACAGTTGGTGCTAGG + Intronic
1114771340 14:25430983-25431005 CGGTATGAACGGATGCTGCTGGG - Intergenic
1116327283 14:43546435-43546457 CATTCTGAACCGATAATGCTTGG - Intergenic
1126084148 15:44995285-44995307 CCCTATGAATAAATGGTGCTGGG + Intergenic
1131042329 15:89281909-89281931 CACTGTGAACAGGTGGTACTAGG - Intronic
1147930230 17:43975187-43975209 CATTAAGAACAGATGGTTCTGGG - Intronic
1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG + Exonic
1155416523 18:25605127-25605149 CACCATGAACAGAAGGGGCTGGG + Intergenic
1156140325 18:34100762-34100784 CACTATCTGCCGATGATGCTTGG + Intronic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1161243618 19:3236612-3236634 TACGATGCACCGATGGTGGTGGG - Intronic
1165731214 19:38146388-38146410 CACTTTGAATCTATGCTGCTGGG + Intronic
936011428 2:108927663-108927685 CACTATGCACTCAGGGTGCTGGG - Intronic
937200898 2:120204006-120204028 CACTGGGAAACGAAGGTGCTCGG + Intergenic
941573817 2:167204997-167205019 CACTATCAACAAATTGTGCTGGG - Intronic
941852626 2:170199230-170199252 CACTATAATCCTATGATGCTTGG + Exonic
1171948062 20:31396170-31396192 CACTAGGACCCCATGGTTCTGGG + Intergenic
1173859067 20:46270226-46270248 CATTCTGACCTGATGGTGCTGGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
955956227 3:64292931-64292953 CACTATGAACCTTTGGGGCCAGG + Intronic
957986646 3:87580560-87580582 CACGAAGAGCCCATGGTGCTGGG + Intergenic
960332049 3:116372325-116372347 CAGTATTAACAAATGGTGCTGGG + Intronic
961929860 3:130521880-130521902 CACTATGAGCAGCTGGAGCTCGG - Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
968077752 3:195825589-195825611 GACTGTGAAACGATGGTGTTCGG - Intergenic
969424655 4:7117071-7117093 CACTCTGATCGGTTGGTGCTGGG + Intergenic
973255949 4:48113728-48113750 CACTATGAAATGGTGGAGCTGGG - Intronic
975192463 4:71481172-71481194 CACTATGCTCAGAAGGTGCTGGG + Intronic
980048587 4:128015904-128015926 CACTATATACGGATGGTTCTAGG + Intronic
980224151 4:129959513-129959535 CATTTTGAACAAATGGTGCTGGG - Intergenic
984854576 4:184183772-184183794 CACTGTGAACAGATGTTGCTGGG + Intronic
994860334 5:105184765-105184787 CCCTATGTAAAGATGGTGCTGGG - Intergenic
995814129 5:116147111-116147133 AACACAGAACCGATGGTGCTGGG - Intronic
1011898670 6:92264166-92264188 CACTGTGAACCAATGGTGTTTGG + Intergenic
1013392031 6:109695214-109695236 CACAAAGAACCGAGGGTCCTGGG + Intronic
1016322080 6:142857431-142857453 CATTATGGCCGGATGGTGCTTGG - Intronic
1018625342 6:165772402-165772424 CACTAGGAAACAATGGGGCTTGG - Intronic
1028283440 7:88963425-88963447 TACTTTCAACAGATGGTGCTAGG + Intronic
1033470961 7:141648353-141648375 CACCATGAACCCACGGAGCTTGG - Intronic
1042103319 8:65297599-65297621 AACTATGAGCCGCTGGTGCCCGG + Intergenic
1051957098 9:22709511-22709533 CACTTTCAACAAATGGTGCTGGG - Intergenic
1056051842 9:82777236-82777258 CACTGTGAGCTCATGGTGCTAGG - Intergenic
1193710083 X:84869173-84869195 CCCTATGAATAAATGGTGCTGGG + Intergenic
1199587226 X:149428347-149428369 CCCTATTAAGCAATGGTGCTGGG + Intergenic