ID: 1147945372

View in Genome Browser
Species Human (GRCh38)
Location 17:44077560-44077582
Sequence CTGCTGGCACAGCCTGGGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 2, 2: 9, 3: 54, 4: 500}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147945372_1147945388 20 Left 1147945372 17:44077560-44077582 CCTTGCCCAGGCTGTGCCAGCAG 0: 1
1: 2
2: 9
3: 54
4: 500
Right 1147945388 17:44077603-44077625 AGTAAGGTGGGGAGCAGACCTGG 0: 1
1: 0
2: 1
3: 25
4: 273
1147945372_1147945380 -10 Left 1147945372 17:44077560-44077582 CCTTGCCCAGGCTGTGCCAGCAG 0: 1
1: 2
2: 9
3: 54
4: 500
Right 1147945380 17:44077573-44077595 GTGCCAGCAGAGGGGCAGGGAGG 0: 1
1: 0
2: 4
3: 72
4: 724
1147945372_1147945383 7 Left 1147945372 17:44077560-44077582 CCTTGCCCAGGCTGTGCCAGCAG 0: 1
1: 2
2: 9
3: 54
4: 500
Right 1147945383 17:44077590-44077612 GGGAGGCCATCCGAGTAAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 107
1147945372_1147945385 9 Left 1147945372 17:44077560-44077582 CCTTGCCCAGGCTGTGCCAGCAG 0: 1
1: 2
2: 9
3: 54
4: 500
Right 1147945385 17:44077592-44077614 GAGGCCATCCGAGTAAGGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1147945372_1147945384 8 Left 1147945372 17:44077560-44077582 CCTTGCCCAGGCTGTGCCAGCAG 0: 1
1: 2
2: 9
3: 54
4: 500
Right 1147945384 17:44077591-44077613 GGAGGCCATCCGAGTAAGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1147945372_1147945382 4 Left 1147945372 17:44077560-44077582 CCTTGCCCAGGCTGTGCCAGCAG 0: 1
1: 2
2: 9
3: 54
4: 500
Right 1147945382 17:44077587-44077609 GCAGGGAGGCCATCCGAGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147945372 Original CRISPR CTGCTGGCACAGCCTGGGCA AGG (reversed) Exonic
900002541 1:22665-22687 CTGCTGGCACAGCGCAGGGAGGG - Intergenic
900022260 1:193190-193212 CTGCTGGCACAGCGCAGGGAGGG - Intergenic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900396481 1:2455180-2455202 CTGCAGGCTTAGCCCGGGCATGG + Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900582895 1:3418016-3418038 CTGCTGGGACAGCCCTGGCGGGG + Intronic
900623819 1:3599152-3599174 CTGCGGGGCCAGCCTGGGGAGGG + Intronic
901954979 1:12777510-12777532 CTGATGCCACAGCGAGGGCAGGG - Exonic
901972698 1:12920351-12920373 CTGATGCCACAGCGAGGGCAGGG - Exonic
901974440 1:12932983-12933005 CTGTTGGCAGAGCCTGGGACAGG - Intronic
902010732 1:13268784-13268806 CTGTTGGCAGAGCCTGGGACAGG + Intergenic
902012482 1:13281411-13281433 CTGATGCCACAGCGAGGGCAGGG + Exonic
903333701 1:22611159-22611181 TTGCAGGAACAGCCTGGACATGG + Intergenic
903741482 1:25560925-25560947 CTGCAAGCCCAGGCTGGGCAGGG - Intronic
903952840 1:27006080-27006102 CTGCAGGCACTGGCTGAGCAGGG - Exonic
904119943 1:28191313-28191335 CCGCTGGCTTTGCCTGGGCAGGG + Intronic
904191518 1:28747833-28747855 CTGCTGGCACTGGCCGGGCGCGG + Intronic
904773414 1:32893412-32893434 TTGCTGCCCCCGCCTGGGCAAGG - Intronic
904774880 1:32900724-32900746 CTCCTTCCACTGCCTGGGCACGG - Intronic
904798025 1:33072099-33072121 CTGCTGGCACGGGCTGGGCACGG - Intronic
905481406 1:38264508-38264530 CTGAAGCAACAGCCTGGGCATGG + Intergenic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906412548 1:45590437-45590459 CTCCTGCCTCAGCCTGGGCCTGG - Intronic
906535355 1:46548282-46548304 CTGGTGGCAGAGACTGGGCTGGG + Intronic
906541801 1:46592581-46592603 CTGCTGGAACAGCCCGGGGCAGG + Intronic
907456264 1:54578023-54578045 CTCCCTGCACAGCCTGGGTAGGG - Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
908339359 1:63160813-63160835 CTGCTGGCACAGCTTGATCTGGG + Intergenic
908838739 1:68256661-68256683 CTGGTGCCACACCCTGGGCCTGG + Intergenic
909342957 1:74552117-74552139 CTGCTGGATTAGTCTGGGCACGG + Intergenic
910145664 1:84077889-84077911 CAGCTGGCAGAGCCTGGGGCGGG - Intergenic
910394900 1:86782448-86782470 GTGCTGAAACAGGCTGGGCATGG + Intergenic
910852527 1:91662784-91662806 CTGGTGCCACACCCTGGGCCTGG - Intergenic
912511787 1:110194789-110194811 CAGCCTGCAGAGCCTGGGCATGG - Intronic
913409233 1:118532718-118532740 ATACTGGCACAGGCCGGGCATGG - Intergenic
915185813 1:154104476-154104498 CTGCTGCCACTGCCTGGGAAAGG - Intronic
915473059 1:156137187-156137209 CTGCGGGAACAGCCTGCGTACGG + Exonic
915542380 1:156576022-156576044 GTGCTACCACAGCCTGGTCAGGG - Intergenic
915602449 1:156930713-156930735 CTGCTGCCACAGCATGGGGCTGG - Intronic
915660199 1:157399282-157399304 CTGGTGCCACACCCTGGGCCTGG - Intergenic
916942174 1:169687729-169687751 CTGATGCCACACCCTGGGCCTGG + Intronic
917789139 1:178488296-178488318 CTGCTGGTCCAGCCAGGGCTGGG - Intergenic
920377503 1:205517050-205517072 CTGCTGGGACAACCTGTGCCAGG - Intronic
921893986 1:220380016-220380038 CTGTGGGCACAGCCTGGGGGTGG + Intergenic
922073104 1:222215844-222215866 CTTTTGGCACAGCCAGGGCCTGG - Intergenic
922406402 1:225318192-225318214 CTGCTTGCACAGCCTTGGAAGGG + Intronic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
922753300 1:228081249-228081271 CTGCTGGCAGAGCGTGGCCAGGG - Intergenic
922764920 1:228151720-228151742 CTGCTGGGGCAGAGTGGGCATGG + Intronic
923265225 1:232307372-232307394 CTGCCAGCCAAGCCTGGGCATGG - Intergenic
923326401 1:232884148-232884170 CTGCTGGCTCATGCTGGGCTGGG - Intergenic
923970674 1:239199997-239200019 CTGGTGCCACACCCTGGGCCTGG + Intergenic
924055052 1:240116807-240116829 CTTCTGGCACATCATGGGCATGG + Intronic
924643633 1:245857214-245857236 CTGGTGGCACTGGCTGGCCAGGG + Intronic
1063568892 10:7196397-7196419 CTGATTGCACAGCGTGGGCATGG - Intronic
1063583013 10:7326384-7326406 CCGCTGGCATTTCCTGGGCAGGG - Intronic
1065125151 10:22566783-22566805 CGCCTGGCTCAGGCTGGGCAGGG - Intronic
1067370886 10:45680592-45680614 CTGCTGGCAGAGGCAGGGGATGG + Intergenic
1067388891 10:45845553-45845575 CTGCTGGCAGAGGCAGGGGATGG - Intronic
1067417171 10:46111395-46111417 CTGCTGGCAGAGGCAGGGGATGG + Intergenic
1067502586 10:46818289-46818311 CTGCTGGCAGAGGCAGGGGATGG + Intergenic
1067551402 10:47238832-47238854 ATGCTGGCAAAGCCTGGGACAGG + Intergenic
1068971627 10:62964075-62964097 CTGCTGACAGAGCTTGGCCAAGG - Intergenic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1069726343 10:70582755-70582777 GTCCTGGGACTGCCTGGGCATGG + Intergenic
1069861695 10:71475660-71475682 CTGCTGGCTTTGCCTGAGCAGGG + Intronic
1070039297 10:72759419-72759441 CTGGTGCCACACCCTGGGCCTGG - Intronic
1070136110 10:73695962-73695984 CTGCTGGCAGAGGCAGGGGATGG - Intronic
1070535910 10:77377109-77377131 ATGCTGGGACAGCCTGGACGTGG + Intronic
1070753323 10:78976620-78976642 CTGCTGGCAGACCTTGGACAGGG - Intergenic
1071611346 10:87034226-87034248 CTGGTGCCACACCCTGGGCCTGG + Intergenic
1072257294 10:93632081-93632103 CTGCTGGCTCTGCCAGGGGAAGG - Intronic
1072731173 10:97848314-97848336 CAGCTGGAAAAGCCTGGGCCAGG + Intergenic
1073456628 10:103640737-103640759 ATGCTGGGAGAGCCTGGGAAGGG + Intronic
1074947489 10:118295418-118295440 GTGCTGCCACTGCCCGGGCAGGG - Intergenic
1075219500 10:120572342-120572364 CTCCGGGCACATCCAGGGCATGG - Intronic
1075498866 10:122954015-122954037 CTGCTGGCACCGCCTGCTCCAGG - Exonic
1075674939 10:124289813-124289835 CTGCTGACCCTGCCTGGGCTGGG - Intergenic
1076074490 10:127522501-127522523 CTGGGGGCACGGCCTGGGCCAGG + Intergenic
1076156115 10:128206998-128207020 CTGCTGGCCAGGCCTGAGCAGGG + Intergenic
1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG + Intergenic
1076693534 10:132236205-132236227 CAGGTGGCAGAGCCTGCGCACGG + Intronic
1076826299 10:132971329-132971351 CGGCTGGCACAGACTTGGCTGGG - Intergenic
1077310826 11:1888387-1888409 CAGCTGTCAAAGCCTGGGCATGG + Intronic
1077368571 11:2171213-2171235 CTGCTGCTAGAGCCTGGGAAGGG + Intronic
1078743799 11:14091945-14091967 CTGCTTGCACTTCCTGGGCAAGG + Intronic
1079125303 11:17714465-17714487 CCACAGGCCCAGCCTGGGCAGGG + Intergenic
1079381361 11:19940759-19940781 CTGGTTCCACTGCCTGGGCACGG + Intronic
1080763363 11:35273739-35273761 CTTATGGCACAGGCTGGGCAGGG + Intronic
1081368567 11:42268161-42268183 CTGTTGCCACACCCTGGGCCTGG - Intergenic
1082813027 11:57490034-57490056 CTGCTAGCAGAGCCTGGCCCTGG - Intronic
1082996753 11:59261487-59261509 CTATTGGCAGGGCCTGGGCAGGG + Intergenic
1083151695 11:60795625-60795647 CAGCTGTCACAGCCTGGAGAGGG + Exonic
1083235124 11:61346226-61346248 GTGCTGGCAGAGCCAGGGCAAGG + Intronic
1083339545 11:61950191-61950213 CGGCTAGCACAGCCTGGCCATGG - Intronic
1083397071 11:62399597-62399619 CTGCAGGCAGACCCTGGCCAGGG - Intergenic
1083523332 11:63337051-63337073 CTGCGGGTACAGTCTAGGCATGG - Intronic
1083550970 11:63590029-63590051 CTGCTGACGGAGGCTGGGCATGG - Intronic
1083683446 11:64361781-64361803 CTGCAGGGCCTGCCTGGGCAGGG + Intronic
1083896650 11:65623468-65623490 CTGCAGGGACAGCCTAGTCAGGG - Intronic
1084315384 11:68342676-68342698 CTGTGGGCACAGCCAGGGTAAGG - Intronic
1084694374 11:70744917-70744939 CAGCTGCCACTGCCTGGGCTGGG - Intronic
1085324338 11:75595138-75595160 CTGCTCGCACTGCCTGGGGTGGG + Intronic
1085516564 11:77115385-77115407 CTGCTGTCACTGCCTGTGGAGGG - Exonic
1089262504 11:117232527-117232549 CAGCTGGCGCCGCCGGGGCACGG - Intergenic
1089313149 11:117573365-117573387 CTGCTGGGGCCGGCTGGGCAGGG + Intronic
1089315336 11:117587473-117587495 CTGCTTTCACAGCCTGGACCAGG - Intronic
1090258288 11:125301194-125301216 CTGCTGGGACTGCCTAGGAAAGG + Intronic
1091375959 12:24728-24750 CTGCTGGCACAGCGCAGGGAGGG - Intergenic
1091656743 12:2351644-2351666 CTGCAGACACACCCTGGGGAAGG - Intronic
1091722744 12:2825231-2825253 CAGATGGGTCAGCCTGGGCAAGG + Intronic
1092390468 12:8073100-8073122 CTGGTGCCACACCCTGGGCCTGG + Intergenic
1093160525 12:15741336-15741358 CTGCTGGCTCAGGATGGGGATGG - Intronic
1093525751 12:20102243-20102265 CTGTATGAACAGCCTGGGCATGG - Intergenic
1093873088 12:24316049-24316071 CTGCAGGCACAGCCATGCCAGGG + Intergenic
1094338835 12:29388051-29388073 CAGATGGCACAGACTGTGCATGG - Intergenic
1095479112 12:42615659-42615681 CTGATGGCAAATCCTTGGCATGG - Intergenic
1095944581 12:47746673-47746695 CTCCTGGCACGGCCTGGCCCAGG + Intronic
1095954775 12:47799729-47799751 CTGCACCCACAGCCTTGGCAGGG - Intronic
1096111754 12:49033168-49033190 CAGCTGGCACAGCAGGGTCAGGG - Exonic
1096262462 12:50101452-50101474 TAGCAGGCACAGGCTGGGCACGG - Intergenic
1096372480 12:51080690-51080712 CTGCTAACAGAGCCTGGGTAGGG - Intronic
1096519831 12:52178686-52178708 CTGATACCACAGCCTGGGCAAGG - Intronic
1096833722 12:54334561-54334583 AAGTTGGCACAGGCTGGGCACGG + Intronic
1098230201 12:68365387-68365409 CTGTGGGCCCAGCCTGGGAAAGG - Intergenic
1101029956 12:100648504-100648526 CTGGTGCCACACCCTGGGCCTGG - Intergenic
1101605862 12:106247533-106247555 CTGCTCGCGCAGGCTCGGCAGGG - Exonic
1102011034 12:109618507-109618529 CTACTGGCTGAGGCTGGGCAGGG - Intergenic
1102433765 12:112904250-112904272 CTGGTGCCACACCCTGGGCCTGG + Intergenic
1103459188 12:121090145-121090167 CTGCAGGCCCAGCCTGGGGCCGG + Intergenic
1103721126 12:122976161-122976183 CTGCTGTAAAAGCTTGGGCAAGG - Intronic
1103995743 12:124828913-124828935 CTGCTGGTCCAGAGTGGGCAGGG - Intronic
1104026070 12:125027377-125027399 TTGCTGGAGCAGGCTGGGCAGGG + Exonic
1104962279 12:132493905-132493927 CTGCAGGCACACCCTGAGCCAGG - Intronic
1104973378 12:132541392-132541414 CTGCTGGCCCCTCGTGGGCAGGG - Intronic
1105296319 13:19090443-19090465 CTGCTGGCACAGGGCAGGCAGGG - Intergenic
1107773164 13:43810320-43810342 CTGCTGCCACAGCAAGGACAAGG + Intergenic
1108321244 13:49292945-49292967 CTGCAGTCACAGCCCTGGCATGG - Exonic
1111556323 13:89885435-89885457 ATGTTGGCACAGCCTGGCCATGG + Intergenic
1112461312 13:99606131-99606153 CTGTTGGCACTCTCTGGGCAGGG - Intergenic
1113034726 13:106036884-106036906 CTGCTGGGAGAGCCTGGGAAGGG - Intergenic
1113069795 13:106409394-106409416 TTGCTGGCAAAGACAGGGCAAGG + Intergenic
1113483851 13:110640662-110640684 CTGCTCGCAGACCCTGGGCCAGG - Intergenic
1113709300 13:112453294-112453316 CTGATGCCACATCCTGGGAATGG - Intergenic
1113855100 13:113439411-113439433 CTGTAGGCCCAGGCTGGGCACGG - Intronic
1113984724 13:114304387-114304409 CTGCTGGTACATGCTAGGCAGGG + Intronic
1114065772 14:19059045-19059067 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
1114096489 14:19340955-19340977 CTGCTCCCAGAGCCTGAGCATGG - Intergenic
1114473772 14:22980852-22980874 CTGCGGGCGGAGCCTGGGCCCGG + Intronic
1114720539 14:24876458-24876480 GTGTTGTCAGAGCCTGGGCAGGG - Intronic
1116559260 14:46357571-46357593 CTTGTGGCATAGACTGGGCAAGG + Intergenic
1117205235 14:53435616-53435638 GTGGTGGCACAGCATGAGCATGG + Intergenic
1117321433 14:54627602-54627624 CGGCTGTTACTGCCTGGGCAGGG + Intronic
1119262027 14:73243506-73243528 GTGGGGGCACAGCCTCGGCAGGG + Intronic
1119444929 14:74655154-74655176 GTCCTGGGACAGCCTGGGAAAGG - Intronic
1119474680 14:74920244-74920266 CGGCTGTCACACCCTGGGAAGGG + Intronic
1120398733 14:84001517-84001539 CTGCTGGCAGAGGCAGGACAAGG + Intergenic
1120409867 14:84140915-84140937 ATGCTGGCACAGCTAAGGCAGGG + Intergenic
1120729976 14:87991579-87991601 TTACTGGCACAACCTGGGCTAGG + Intronic
1120988955 14:90358147-90358169 CTGCCTGTACAGGCTGGGCATGG - Intergenic
1121832390 14:97063502-97063524 CTGCTGCCCCAGCCTGGCCCTGG + Intergenic
1122425319 14:101602209-101602231 CTCCTGGCACTCCCAGGGCAGGG + Intergenic
1122662864 14:103309652-103309674 CTGCTGCCATTGCCTGGGGAAGG - Intergenic
1122819040 14:104332042-104332064 CTGCTGGCAGAGCCTGGTATTGG + Intergenic
1122935656 14:104954886-104954908 CTGCTGGCTGAGCCTGGGAGGGG - Intronic
1122970142 14:105149172-105149194 CTGCAGGCCCCGCCAGGGCACGG + Exonic
1123038968 14:105482714-105482736 CTGCGGTCACTGGCTGGGCAGGG - Intergenic
1123116614 14:105897695-105897717 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123118669 14:105906944-105906966 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123120894 14:105916562-105916584 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1202850944 14_GL000225v1_random:18757-18779 CTTTTGGCAGAGCCTAGGCAAGG + Intergenic
1202863723 14_GL000225v1_random:101884-101906 CTGTGGGCACAGCCTAGACAAGG - Intergenic
1202866292 14_GL000225v1_random:120532-120554 CTGTAGGCAGAGCCTGGACAAGG - Intergenic
1123403614 15:20008143-20008165 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123512950 15:21014788-21014810 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1124239443 15:28017695-28017717 CAGGTGACACAGCCTGTGCATGG + Intronic
1124881856 15:33650086-33650108 GTGCTGGCTTAGGCTGGGCACGG + Intronic
1125720990 15:41845087-41845109 CTGGGGGCAGAGCCAGGGCAAGG + Intronic
1125875111 15:43137534-43137556 CTGCTGGCACAGACTTAGCTAGG - Intronic
1126817320 15:52466602-52466624 CTGATGTCTCAGCCTGGGAAGGG - Intronic
1128289409 15:66465519-66465541 CTGGTGCCACACCCTGGGCCTGG - Intronic
1129034218 15:72639969-72639991 CTCCTGGCCCAGACAGGGCAGGG - Intergenic
1129117183 15:73370931-73370953 CTGCTGCCACAGGCCGGCCAGGG + Intergenic
1129188990 15:73926859-73926881 CAGCAGGCGCAGCCCGGGCAGGG + Exonic
1129215664 15:74097247-74097269 CTCCTGGCCCAGACAGGGCAGGG + Intergenic
1129227743 15:74179770-74179792 CTGATGGCAGAGCCAGGGTAGGG + Intronic
1129459736 15:75694535-75694557 CAGCTGGCTCAGGCTGGCCAGGG - Intronic
1129732799 15:77941576-77941598 CTCCTGGCCCAGACAGGGCAGGG + Intergenic
1129754364 15:78088022-78088044 CTGCCGGCAGAGCCTGGTGATGG - Intronic
1129889999 15:79065627-79065649 CTGGGGGCCCAGCCTGGGCCTGG + Intronic
1131153561 15:90061739-90061761 GTGCTGTCACAGCTTGGGGAAGG + Intronic
1131347684 15:91665923-91665945 CTGCTGCCAGAGCCAGGACAAGG - Intergenic
1132221170 15:100106655-100106677 ATGCTGGCAGAGGCTGGGGATGG + Intronic
1132450969 15:101968274-101968296 CTGCTGGCACAGCGCAGGGAGGG + Intergenic
1132471328 16:105129-105151 CTCCTGTCACAGACTGGGCTGGG - Intronic
1132731774 16:1366430-1366452 CAGCTGGCCCAGCCTGGGCAGGG - Intronic
1132777598 16:1604412-1604434 CAGGTGGCACAGCATGTGCAGGG + Intronic
1132801649 16:1757674-1757696 CTTCTGGGTCAGCCTGGGTAGGG - Intronic
1132806510 16:1777539-1777561 CAGCTGGCACAGCTGAGGCAAGG + Intronic
1132956909 16:2599183-2599205 CTCCAGGGACAACCTGGGCAGGG - Exonic
1134132900 16:11661740-11661762 CTACGGGTACAGGCTGGGCATGG - Intergenic
1134844166 16:17425755-17425777 CTCAGGGAACAGCCTGGGCAAGG - Intronic
1135414769 16:22260627-22260649 CTCCTGGCAGTGCCTGGGCTAGG - Intronic
1135978715 16:27129544-27129566 TGTCTGGCACAGCCAGGGCAGGG - Intergenic
1135992576 16:27226991-27227013 CCCCTGGCAGAGCCTCGGCAAGG + Intronic
1136024359 16:27460456-27460478 CTGCTGGCTGAGGCTGGGCGGGG + Intronic
1137554481 16:49461875-49461897 CAGCTTCCCCAGCCTGGGCAGGG + Intergenic
1137619620 16:49867875-49867897 CTGATGGAACTGCCTGGTCATGG + Intergenic
1138345308 16:56316732-56316754 CTGCAGGCACGGGCAGGGCAGGG + Intronic
1138657281 16:58498717-58498739 CTCCTGCCAGGGCCTGGGCAAGG - Intronic
1138694990 16:58804735-58804757 CTGGTGGTAGAGGCTGGGCACGG - Intergenic
1139439892 16:66961156-66961178 CCTCTGGCTCAGCCTGAGCATGG + Intergenic
1139505300 16:67395497-67395519 CTGCTGGCCCGGCCTGGCCAGGG + Exonic
1139515304 16:67449207-67449229 CCATTGGCAGAGCCTGGGCATGG - Intronic
1139812948 16:69637928-69637950 CTTCTGGTAGAGGCTGGGCACGG + Intronic
1140473796 16:75228747-75228769 CAGAAAGCACAGCCTGGGCATGG - Intronic
1140851246 16:78936587-78936609 TGGCTGGTACACCCTGGGCAAGG + Intronic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1141651942 16:85397469-85397491 CTGCTGGCCCAGGCTTGTCACGG + Intergenic
1142640262 17:1281334-1281356 CTGCTGGCCCAGGCTGGTCAGGG + Intronic
1142805722 17:2370129-2370151 CGGCTGGCTCAGCCTGGGCCGGG - Intronic
1143625932 17:8110116-8110138 CAGCTGGCGCAGCGTGGCCATGG + Exonic
1143731932 17:8886395-8886417 CTGCTGGCTCTCCCGGGGCAGGG + Intronic
1143976192 17:10831746-10831768 CTGATGCCCCAGACTGGGCAAGG + Intronic
1144780415 17:17805548-17805570 CTGCTGGCTTTGCCTGGACAGGG + Intronic
1144872074 17:18377849-18377871 GTGCTGGCTCAGGCTGGGCTTGG - Exonic
1145250339 17:21293800-21293822 CAGATGGCACAGCCTGGGCCTGG + Intronic
1145899532 17:28481217-28481239 CTGATATCACAGCCTGGGCCAGG - Intronic
1146751121 17:35381717-35381739 CTGATGCCACACCCTGGGCCTGG + Intergenic
1147371003 17:39993006-39993028 CTGCTGGCACTGCCACCGCAAGG + Intronic
1147450755 17:40502418-40502440 CTGATGGCAGAGCCTGGTCTGGG + Intergenic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1148238417 17:45984100-45984122 GTGCGGCCACAGCCTGAGCACGG - Intronic
1148377584 17:47162498-47162520 CTGCTGGCAAAGCAAGGGGACGG - Intronic
1149850091 17:60028995-60029017 CTGGTGGCCCACCCTGTGCAGGG - Intergenic
1150007555 17:61479212-61479234 CTCCTATCACAGCCTGGGAAGGG - Intronic
1150280986 17:63929530-63929552 CTGCTGGGCCAGGCTGGGGAGGG + Intronic
1151055053 17:71021209-71021231 CTGCCGCCACACCCTGGGCCTGG - Intergenic
1151743706 17:76000752-76000774 CTGAAGGCAGAGCCTGGCCAGGG - Intronic
1151749215 17:76027213-76027235 GTGCTGGCTCAGGCTGGGCTTGG + Exonic
1152097748 17:78281743-78281765 CTGCTGCCACAGCCTTGGCAGGG - Intergenic
1152123393 17:78432538-78432560 CTGCTGGCGAAGGCTGGGCCTGG - Intronic
1152429265 17:80238736-80238758 ACCCTGGCACAGCCTGGGCTAGG - Intronic
1152441545 17:80312904-80312926 CTGCTGGCACAGGCTGCTCAAGG - Intronic
1152685312 17:81690922-81690944 CTGATGCCACTGCCTGGGCCGGG + Intronic
1154107376 18:11534249-11534271 CTGCGGCCACAGCAAGGGCACGG + Intergenic
1156409843 18:36817230-36817252 CTGCTGGCTCAGCCCAGGGAGGG + Intronic
1156476795 18:37410542-37410564 TGGCTGGCACAGCGTGTGCAGGG - Intronic
1157685643 18:49640533-49640555 CAGGTGGCACAGCCAGGGCAGGG - Intergenic
1157710074 18:49844072-49844094 CTCCTGTCCCTGCCTGGGCAAGG + Intronic
1157908203 18:51588817-51588839 CTGGTGGCACGGGCTGTGCAAGG + Intergenic
1158135642 18:54204856-54204878 TTGCTGGGACAGGGTGGGCAGGG + Intronic
1158144720 18:54299137-54299159 CTGTTGACAGAGCCTGGGCCGGG + Intronic
1158642812 18:59218245-59218267 CTACTGACAGAGCCTGGGAACGG + Intergenic
1159643989 18:70895841-70895863 CAGCTGGCTCAGCCTTGGTATGG - Intergenic
1159671835 18:71229915-71229937 TTGCTGCCACAGCCTGAGTAGGG + Intergenic
1160117931 18:76099572-76099594 CTGCTCCCACAGCCTTAGCAAGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160613591 18:80108127-80108149 CGGAAGGCCCAGCCTGGGCACGG + Intergenic
1160634293 19:64273-64295 CTGCTGGCACAGCGCAGGGAGGG - Intergenic
1160852515 19:1199745-1199767 GTGCTGGCCCAGCCTGGCCTGGG + Intronic
1161393002 19:4031145-4031167 CTCCTGGCACAGCCAGGCCCAGG + Intronic
1161970783 19:7578778-7578800 TAGCTGAAACAGCCTGGGCACGG - Intergenic
1162421793 19:10569605-10569627 CTGCTGGCTCAGTCTGAGCCCGG - Intergenic
1162821707 19:13227021-13227043 CGCCTGCCCCAGCCTGGGCATGG + Intronic
1163268225 19:16234108-16234130 CTGCTGGGGCAGCCTGGGGCTGG - Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163517610 19:17774530-17774552 CTTCTGGGATAGCCTGGGCAGGG - Intronic
1163527784 19:17831618-17831640 CAGCTGGCACGGCCTGGGCAGGG - Intronic
1163552404 19:17972957-17972979 CAGAGGGCACAGCCTGTGCAAGG + Intronic
1163583244 19:18150660-18150682 GAGCAGGCACTGCCTGGGCATGG - Exonic
1164403386 19:27919175-27919197 CTGTAGTCACAGCCTGGTCATGG - Intergenic
1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG + Intergenic
1165309840 19:35023314-35023336 GTCCTGGCACAGCCTGGCCCTGG + Exonic
1165745660 19:38228619-38228641 CCGCTGTCACCGCCTGGGAACGG + Intronic
1165879003 19:39029807-39029829 CTGGTCACACAGCCTGGGCTTGG - Intronic
1166084413 19:40465610-40465632 CTGCTTGCACCGCCTGCGCCAGG + Exonic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166525802 19:43508852-43508874 GTCTTGGCACAGCCTGGGGAAGG + Exonic
1166749114 19:45156338-45156360 CTGCTGGCCCGGCCAGAGCATGG + Intronic
1166856795 19:45786254-45786276 CTGCGGGCACAGGCTCGGCCGGG - Exonic
1166898033 19:46036288-46036310 CTGCAGCCACAACTTGGGCAGGG - Intergenic
1167007637 19:46786424-46786446 GTCCTGGCCCAGCCTGGGCCTGG - Intronic
1167028939 19:46943859-46943881 CTGTCTGCACAGCCAGGGCACGG + Intronic
1167687121 19:50963317-50963339 CAGCTGCCACATCCTGGGCTGGG - Exonic
1168134165 19:54339107-54339129 CTGCCTGCACAGCCAGGGCCAGG - Exonic
1168187400 19:54708908-54708930 CTGCAGGCAGAGCCTGGGGCTGG - Intergenic
925008099 2:461134-461156 CTGCTTGCGCAGCCTGGACTGGG + Intergenic
925008201 2:461895-461917 CTGGAGGCAGAGCCTGGCCAGGG - Intergenic
925020292 2:563119-563141 CTGCAGGCACAGCCAGTTCATGG + Intergenic
925193693 2:1906785-1906807 ATGCTGGGGCAGGCTGGGCATGG + Intronic
925430855 2:3791734-3791756 GTGCTGGCCCAGCCTTGGCATGG - Intronic
925595898 2:5555404-5555426 CTGCCCCCACAGCCTGGGCTGGG + Intergenic
926000688 2:9329758-9329780 CTGGTGGCACAGCCTGCTCTGGG - Intronic
926177337 2:10606332-10606354 CTGCCTGCACAGACTGGGCGTGG + Intronic
926740300 2:16105044-16105066 CTCCTGGCTCAGGCTGGGCTGGG - Intergenic
927640856 2:24844428-24844450 CTCCTGACAAGGCCTGGGCAGGG + Intronic
932015635 2:68023895-68023917 CTGCTGGCACAGACTCTCCAGGG + Intergenic
932385521 2:71329065-71329087 CTCCTGCCAAAGCCTGGGCACGG + Intronic
932467539 2:71933281-71933303 CTGTTGGCCCAGCCTGGGCTCGG - Intergenic
932467844 2:71934956-71934978 CTGTGGGCCCAGCCTGGGCTTGG + Intergenic
933621570 2:84548836-84548858 CTTCTGGCCCAGCCTGGGCATGG + Intronic
934149677 2:89134477-89134499 CAGCTCCCACAGCCTTGGCATGG - Intergenic
934153835 2:89176098-89176120 CAGCTGCAACAGCCTTGGCATGG - Intergenic
934213401 2:90005837-90005859 CAGCTGCAACAGCCTTGGCATGG + Intergenic
934217620 2:90047551-90047573 CAGCTCCCACAGCCTTGGCATGG + Intergenic
934950834 2:98574260-98574282 AGGCTGTCACAGCCTGGCCAGGG - Intronic
935445272 2:103149725-103149747 CAGAAGGCACTGCCTGGGCAAGG - Intergenic
935783000 2:106524370-106524392 CTTCTGGCACAGCCCAGGCCTGG + Intergenic
936567182 2:113590754-113590776 CTGCTGGCACAGCGCAGGGAGGG + Intergenic
937127285 2:119482682-119482704 CTGCTGGCTGGGCCTGAGCAGGG + Intronic
938390467 2:130901254-130901276 CTGCTGACATAGCCTGAGCCTGG + Intronic
938483176 2:131679174-131679196 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
940162936 2:150733301-150733323 CTCCTGGCTCAGGCTAGGCAAGG - Intergenic
941308294 2:163897894-163897916 CTGCTGTGACAGCCAGGACAGGG + Intergenic
942518541 2:176778968-176778990 CTGCTGGAAATGTCTGGGCATGG - Intergenic
946402713 2:219476994-219477016 CTGCTGGCTGAGCCTGGGGGAGG + Intronic
947103471 2:226645952-226645974 CTGCTTTCAGACCCTGGGCAGGG - Intergenic
947589119 2:231374944-231374966 CTGATAGCACAGCCTGGGGCTGG + Intergenic
947729305 2:232419317-232419339 CTGCTGGCACGGCCCAGGGATGG - Intergenic
947927932 2:233937983-233938005 CTGCAGGAACAGCCTGTGGACGG - Intronic
947935467 2:233999888-233999910 CTGCTGCAACTGCCTGGGCATGG - Intronic
948194894 2:236087926-236087948 CATCTGGCACAGCCAGGGGAGGG + Intronic
948338642 2:237231338-237231360 CAGCTGAGACAGCCTGAGCAGGG - Intergenic
948348711 2:237320925-237320947 CTGCTGACACTGCCAGGCCAGGG - Intergenic
948426102 2:237887292-237887314 CTGCTGGCCCTGCCTGTGCCTGG - Intronic
948433529 2:237936287-237936309 CAGCACACACAGCCTGGGCACGG + Intergenic
948463499 2:238141431-238141453 CTGCACGCAGGGCCTGGGCACGG - Exonic
948857301 2:240736025-240736047 CTGCAGGGGCAGCCAGGGCAGGG - Intronic
948901466 2:240958725-240958747 CTGCTGCCGCAACCTGGGCAGGG + Intronic
1168980579 20:2000151-2000173 ATGCTGGTATAGGCTGGGCATGG - Intergenic
1170558491 20:17535238-17535260 CTGAGGGCTCAGGCTGGGCACGG + Intronic
1170770573 20:19328893-19328915 CTCCTCGCAGAGCCTGGGCTGGG - Intronic
1170834001 20:19868242-19868264 CTGCTGCCCCAGCCTGGGTCAGG - Intergenic
1171185300 20:23120435-23120457 CTGCTGCCACAGCCTAGGCAAGG - Intergenic
1172273578 20:33667891-33667913 CTGCTGGGCCAGGCTGAGCAGGG + Exonic
1172650351 20:36497900-36497922 CTGCAGGTCCAGCCAGGGCAGGG - Intronic
1173850242 20:46213228-46213250 CTGCTGGCAGAGGCTGGGGAAGG - Intronic
1173850722 20:46216233-46216255 CTGCTGGCACAGCGGGGGTTGGG - Intronic
1174303126 20:49596292-49596314 CTGCTGGCCTAGCCTTGGGAGGG - Intergenic
1174371296 20:50089983-50090005 CTGCTGGCACCTGCGGGGCAGGG - Intronic
1174558953 20:51416363-51416385 CTGCCGGCTCTGCCTGGGTAGGG + Intronic
1175521180 20:59603845-59603867 CTGCTTCCCCAGCCAGGGCAGGG - Intronic
1175728048 20:61332784-61332806 CTGGCGCCACAGCCGGGGCAGGG - Intronic
1175892744 20:62322693-62322715 CAGCGGGCACTGCCTGTGCAAGG - Exonic
1176051285 20:63120880-63120902 CAGGTGGCAGAGCCTGGGCCCGG - Intergenic
1177030116 21:15972407-15972429 CTGCTGGCAGGGGTTGGGCAGGG - Intergenic
1178488880 21:33035406-33035428 CAGCTGGCAGAGCTTGGCCAAGG - Intergenic
1179626111 21:42650444-42650466 CTGCAGGCAGAGCCAGGGGAAGG + Intergenic
1179722218 21:43322317-43322339 CGGCCGGCACAGGCTGGGCTGGG - Intergenic
1179785743 21:43728740-43728762 CTGCGGGCTGCGCCTGGGCAGGG + Intronic
1180052199 21:45336304-45336326 GGGCTGGCACAGGCTGGGGAGGG - Intergenic
1180198914 21:46213296-46213318 GGGCTGGCACAGCCTGGGGTCGG - Intronic
1180484254 22:15781637-15781659 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
1180588342 22:16914005-16914027 CAGCAGTCACAGCCTGGGGAAGG - Intergenic
1180698802 22:17770710-17770732 CTGGTGGGACAGGCTGGGCTTGG - Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1180841482 22:18960864-18960886 CTGCTGGCGCGCCCTGAGCAGGG + Intergenic
1180948410 22:19709328-19709350 CTGCCGGGACAGCCTGGGGATGG + Intergenic
1181033103 22:20157603-20157625 CAGCTGCCACACCCTGGTCAGGG - Intergenic
1181038561 22:20181471-20181493 CGGCTGGCCCAGCCTGCCCAGGG + Intergenic
1181510207 22:23385634-23385656 CGGCTGCCACACCCTGGTCAGGG + Intergenic
1181670657 22:24424176-24424198 CTGCCGGCACTGCCTGTGAAGGG + Intronic
1182123296 22:27800275-27800297 CTGCAAGCGCAGCCTGTGCACGG - Exonic
1182276110 22:29189877-29189899 CTGGGAGCTCAGCCTGGGCAGGG - Intergenic
1182685460 22:32119654-32119676 CTGCAGGGCCAGCCTGGGCTGGG - Intergenic
1182947768 22:34340823-34340845 CTGCTGGCACTGGCAGGGGAAGG - Intergenic
1183212332 22:36458598-36458620 CTGCTGGCTGAGCCCAGGCAAGG + Intergenic
1183252875 22:36742838-36742860 CAGGGGGAACAGCCTGGGCAAGG + Intergenic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1183931060 22:41236546-41236568 CAGCTGGCTGAGACTGGGCAGGG + Exonic
1184341993 22:43891265-43891287 CTGCTCCCACCTCCTGGGCATGG - Exonic
1184388341 22:44188810-44188832 CTGCAGGCACAGGCTGATCAAGG + Intronic
1184419318 22:44370367-44370389 CTGCTGGCCCATCATGGGCTGGG + Intergenic
1184432445 22:44449403-44449425 CGGCTGGAGCAGCCTGGGCCAGG + Intergenic
1184461274 22:44639551-44639573 CAGCTGGGACAGCCCGGGGAAGG + Intergenic
1184494273 22:44828396-44828418 CTGCTGGCTGAGCCTGGTCAAGG - Intronic
1184643557 22:45884554-45884576 CTGCAGGGACAGCTTGGGAAGGG + Intergenic
1185023948 22:48396943-48396965 CTGCCGGCTCTGCCTGGGCCTGG - Intergenic
1185166330 22:49264839-49264861 CTGCTGGCCTTGCCTGGGCTTGG + Intergenic
1185330537 22:50250275-50250297 CTGCTGGCACTGCCAGAGCCTGG - Intronic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
949841686 3:8327027-8327049 CTGCTTGCTAAGCCTGGTCATGG - Intergenic
949943239 3:9170924-9170946 CTGCTGGCAGAGCAAGGCCATGG + Intronic
950154571 3:10711980-10712002 GTGCTGACATAGCCTGGGAAAGG + Intergenic
950434359 3:12969657-12969679 CTGCTGGAGCACTCTGGGCACGG + Intronic
950612458 3:14135028-14135050 GTGACGGCACAGCCTGGGCACGG + Intronic
951754482 3:26074998-26075020 CTGCTAGAACAGCCTTGGCTGGG + Intergenic
953605278 3:44409723-44409745 CTGCCAGGACAGCCTGGGCAGGG - Intergenic
953880019 3:46686677-46686699 CTGCTGGCTCTACCAGGGCAGGG + Intronic
953917827 3:46931780-46931802 CTGCAGGCGCATCCTGGGCGTGG - Intronic
954617194 3:51975156-51975178 CTGCTGGTTCCGCCTGGGCGGGG + Exonic
954751817 3:52818166-52818188 GGGCTGGGACAGCCGGGGCACGG + Exonic
954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG + Intronic
955146595 3:56326090-56326112 CTGATGGCCCAGCCAGGCCAGGG - Intronic
955380587 3:58434905-58434927 CTGGTGCCACACCCTGGGCCTGG - Intergenic
956131193 3:66055378-66055400 CTGCTGGACCAAGCTGGGCAAGG + Intergenic
958634774 3:96729818-96729840 CTGCTGCCATAGGGTGGGCACGG + Intergenic
960974153 3:123159200-123159222 CTCCTGGCCCGGGCTGGGCATGG + Intronic
961212682 3:125137979-125138001 CTGCTGGCCCAGCCTGCTCTGGG + Intronic
961392034 3:126557959-126557981 CTGCAGCCACAGCCTGGGCCAGG + Intronic
961780746 3:129318878-129318900 CTGCAGCCACAGGCTGGGCCAGG + Intergenic
961782056 3:129326173-129326195 TTGCAGACACAGCCTGGGCCAGG - Intergenic
963292223 3:143503625-143503647 CTCCTGGCACTGCCAAGGCATGG - Intronic
963491924 3:146012608-146012630 CTGGTGCCACACCCTGGGCCTGG - Intergenic
963884864 3:150570770-150570792 CTGCTGACAGAGGCTGGGCACGG + Intronic
964310418 3:155386140-155386162 CCTGTGGCACAGCATGGGCATGG + Intronic
966175000 3:177128662-177128684 TTGGTGGCTCAGGCTGGGCACGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
967294787 3:187954469-187954491 CTGGTGGCCCAGACTGGGCTGGG - Intergenic
967343044 3:188422176-188422198 ATGTTGGCACAACCTGGGAAGGG - Intronic
968058583 3:195711660-195711682 CTGCTGGCTCAGGGTGGGGAAGG - Intergenic
968122382 3:196134763-196134785 CTCCTGGGACAGTCTGGGAAAGG - Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968495361 4:912310-912332 ATGCTGGGACAGCCTGAGAAGGG + Intronic
969092605 4:4706505-4706527 CTGTAGCCAAAGCCTGGGCAGGG + Intergenic
969854141 4:9985548-9985570 CTGCTGGCATTGACTTGGCAGGG - Intronic
973243050 4:47979028-47979050 ATCTTGGCACAGGCTGGGCATGG + Intronic
973621892 4:52735169-52735191 CTGCTGGTAGAGGTTGGGCATGG - Intronic
976238546 4:82928227-82928249 CTGCCTGCTCTGCCTGGGCAAGG + Exonic
976928649 4:90534417-90534439 AGGCTGGCACAGCCTGGGCTCGG - Intronic
977359016 4:95980813-95980835 GTGTTGTCACAGCCTGGCCAGGG + Intergenic
980733312 4:136849223-136849245 CTGCTGGCACTTCCTGGGTGAGG + Intergenic
982159026 4:152548665-152548687 ATGGTGGCAGAGCCTGAGCAGGG - Intergenic
982187589 4:152818652-152818674 CTGCTTCCACAGACTGGGAATGG + Intronic
985665299 5:1178963-1178985 CTGCTGGCTGAGGCTGGGCTTGG + Intergenic
986192660 5:5511442-5511464 CAGAAGGCAAAGCCTGGGCAAGG + Intergenic
988280086 5:29134253-29134275 CTGCTGGAACAGGGAGGGCAAGG + Intergenic
991267982 5:64745298-64745320 CTGATGATACAGGCTGGGCATGG + Intronic
995262674 5:110123471-110123493 ATGTTGTCACAGCCGGGGCATGG + Intergenic
995282502 5:110351966-110351988 CATCTGGCACAGGATGGGCAGGG + Intronic
997110628 5:131070418-131070440 CTGCTTCCACAGCCAAGGCATGG - Intergenic
997446638 5:133945115-133945137 CTCCTGGCACAGCCAGAGGAGGG - Intergenic
997980373 5:138464749-138464771 CGGCTGGGCCCGCCTGGGCAGGG - Intergenic
999205827 5:149847269-149847291 CTGCTGGGACATCTTGGCCATGG - Intronic
999212068 5:149898255-149898277 ATGAGGGCACAGCCTGGGCATGG - Intronic
1000176192 5:158757030-158757052 CTCCTGGCTCAGCCTGTGAAGGG - Intronic
1000329791 5:160197557-160197579 CTGCCGGCAGAGCCTAGGGAGGG + Intronic
1001671204 5:173475427-173475449 CTGATGGCACAGCTTGGAAAAGG + Intergenic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1002921814 6:1578305-1578327 CTGTTGTCACAGACTGGCCACGG + Intergenic
1002998674 6:2310744-2310766 CTGGTGCCACACCCTGGGCCTGG - Intergenic
1003041965 6:2696541-2696563 CTGCTGGCAGATCCAGGGCCTGG - Intronic
1004916807 6:20340207-20340229 CTGGGGGCACAGCCTGGCCCTGG + Intergenic
1006305468 6:33215745-33215767 CTCTCAGCACAGCCTGGGCAAGG + Intergenic
1007549195 6:42716086-42716108 CCTCTGACACAGACTGGGCATGG - Intronic
1008147345 6:47907753-47907775 CTGCTGGCAAAGGTTGAGCAGGG + Intronic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1013402199 6:109809627-109809649 CTGCTGGCAAATACTGAGCAAGG - Intronic
1013602985 6:111721968-111721990 CAGCTGGCACAGGATGGGAAGGG + Intronic
1013705742 6:112832082-112832104 CTGCTGGCATAGAATGGGCCTGG + Intergenic
1016782674 6:147977203-147977225 CTTTTGGCATAGCCTGGTCAAGG + Intergenic
1017018284 6:150118711-150118733 CTGCGGGCACAGCCTGGGGAAGG + Intergenic
1017781516 6:157719077-157719099 CTGCGGGCAGGACCTGGGCATGG - Intronic
1018256871 6:161929436-161929458 GTGCTTGCACAGCATGGGAAAGG + Intronic
1019305142 7:330686-330708 CTGCTCACACAGCCAGGGCTTGG + Intergenic
1019437379 7:1028933-1028955 CTGCCTGCAGGGCCTGGGCAGGG - Intronic
1019873977 7:3792463-3792485 CTGCTGGGTCTGCCTGGGCAGGG - Intronic
1019940399 7:4284694-4284716 CTTCTGGCAGACCCTGGGGAAGG - Intergenic
1019992331 7:4701049-4701071 CTGCTGGAACAGGCTGGGGCAGG - Intronic
1019994171 7:4712792-4712814 CTGCTCAAACAGCCAGGGCAGGG + Intronic
1020044252 7:5028591-5028613 CTGGTGCCACACCCTGGGCCTGG - Intronic
1021095289 7:16528383-16528405 CTGGTGGAACAGACTGGTCAAGG - Intronic
1021838212 7:24701676-24701698 CTGGTGGCACAGTCTGGTTATGG - Intronic
1021839324 7:24709708-24709730 CTGCAGGCACATCCTGGGCATGG + Intronic
1022489755 7:30807632-30807654 CTGGTGCCACACCCTGGGCCTGG + Intronic
1022506997 7:30913646-30913668 CAGCTGGCTCAGCCTGGCCATGG + Intronic
1023745450 7:43318825-43318847 CTGGAGGGACAACCTGGGCAAGG - Intronic
1023932260 7:44713078-44713100 CTCCTGGCACAGCCCCAGCAGGG - Intergenic
1024247316 7:47480070-47480092 CCGCTGGCCGAGCCTGGGGAAGG + Intronic
1026837062 7:73646547-73646569 CTGCTGGCTGAGCCAGGCCAGGG - Intergenic
1026851417 7:73725904-73725926 CTGCTGCCACCTTCTGGGCAGGG + Intergenic
1029473041 7:100766656-100766678 CTGATGGCTCACCTTGGGCATGG - Exonic
1030609892 7:111678030-111678052 GTTGTGCCACAGCCTGGGCAAGG - Intergenic
1030626859 7:111854218-111854240 CTGGTGCCACACCCTGGGCCTGG + Intronic
1032268499 7:130384353-130384375 CTGCAGGCACAGCTTGGGATGGG - Intronic
1032650118 7:133868965-133868987 CTGCTGGGAGAGGCAGGGCAGGG - Intronic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1035566239 8:643280-643302 CTGCGAGCACAGCCTGCGCCTGG - Intronic
1037882960 8:22581756-22581778 GTGCAGTCACAGGCTGGGCAGGG + Intronic
1038041568 8:23727855-23727877 CTGCTCTCCCAGCCTGGGAAGGG + Intergenic
1038530847 8:28317104-28317126 CTGATGGCAGAGCCGGGGGAAGG + Intronic
1039873593 8:41567330-41567352 CTGCGGGCACAGCCTGAAGAGGG + Intergenic
1040513086 8:48112677-48112699 CTGAAGTCACTGCCTGGGCAAGG - Intergenic
1041287227 8:56273416-56273438 CTCCTTGCACTTCCTGGGCAAGG - Intergenic
1041547456 8:59061829-59061851 CTCCTGGCAGGGGCTGGGCATGG - Intronic
1043542810 8:81281414-81281436 CTGCTGGCACTGCCGGGCCGGGG + Intronic
1047029175 8:120857894-120857916 CTGCTGGTACAGGCTGGGCCTGG - Intergenic
1047204728 8:122793913-122793935 CTGCTGGCACACCCTGAGTGTGG + Intronic
1047296187 8:123572536-123572558 CTGCTGGCACAGGCTATGGAGGG + Intergenic
1047569431 8:126082134-126082156 CCCCTGGCTCAGCCTGGGCTAGG + Intergenic
1049254089 8:141604784-141604806 TTGCTGGCCCAGCCTGACCATGG + Intergenic
1049357412 8:142195640-142195662 CAGCTGGCACAGCATCTGCAGGG + Intergenic
1049499115 8:142952074-142952096 CTGCTGGCCCAGCCTGGAAAAGG - Intergenic
1049580582 8:143408829-143408851 CTGGGGGCAGAGCCTGGACAGGG + Intergenic
1049591463 8:143464823-143464845 CTCCTGGCTCAGGCTGGGGAGGG - Intronic
1049602165 8:143513016-143513038 AGGCGGGGACAGCCTGGGCAGGG + Intronic
1049619592 8:143592062-143592084 GTGCTGCCCCAGCCTGGGGAAGG - Intronic
1049642299 8:143721187-143721209 CAGAGGTCACAGCCTGGGCATGG - Intronic
1049806909 8:144545220-144545242 CTGGTGGCAAAGCCCGTGCATGG + Intronic
1049885349 9:22778-22800 CTGCTGGCACAGCGCAGGGAGGG - Intergenic
1051696105 9:19769317-19769339 CTGCTGCCACCACCTGGGCCAGG + Intronic
1051841398 9:21402478-21402500 CTCCTGGCACACCCTGGGGCAGG + Intergenic
1055494189 9:76838352-76838374 ATGCAGGCAGAGGCTGGGCATGG + Intronic
1056656438 9:88513444-88513466 CTGGTGCCACACCCTGGGCCTGG - Intergenic
1057132066 9:92661238-92661260 CTGCTGGCCCAGCCTCAGCCTGG + Intronic
1057299580 9:93870096-93870118 CAGGTGGCATGGCCTGGGCAGGG + Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1060802040 9:126551018-126551040 TGCCTGGCACAGCCTGGGAATGG + Intergenic
1060931513 9:127492188-127492210 CTGATGGCACAGGCTGGGCCTGG - Intronic
1060998576 9:127889056-127889078 CTCCTAGAACAGGCTGGGCACGG + Intronic
1061147096 9:128806383-128806405 CTGCTGCGACAGGCTGGGCAGGG + Intronic
1061232305 9:129321911-129321933 CAGAGGCCACAGCCTGGGCAAGG - Intergenic
1061720279 9:132546979-132547001 CTGCTGGCTCACCCTGGGTTTGG - Intronic
1062048269 9:134434313-134434335 CTGCTGGCATGGGCTGGGCCTGG - Intronic
1062087970 9:134658400-134658422 CTGCTGGGACAGCCCTGGGAGGG + Intronic
1062178851 9:135179868-135179890 CTGGTGGCATGGCCTGAGCAGGG + Intergenic
1062252603 9:135605759-135605781 CTGATGGCATAGGCTGGGCATGG + Intergenic
1062422482 9:136489830-136489852 CTGCTGGTGCACGCTGGGCATGG - Intergenic
1062467743 9:136688525-136688547 AAGCTGGGACCGCCTGGGCAGGG - Intergenic
1062468128 9:136690543-136690565 CTCCTGTCACACACTGGGCACGG - Intergenic
1062474624 9:136720899-136720921 CTCCTGCCTCAGCCTGGGGAAGG + Intronic
1062575468 9:137205299-137205321 CTGCTGGCACTGCGTGTGGATGG - Exonic
1203738048 Un_GL000216v2:155694-155716 CTGTAGGCAGAGCCTGGACAAGG + Intergenic
1203740599 Un_GL000216v2:174129-174151 CTGTGGGCACAGCCTAGACAAGG + Intergenic
1185464956 X:348908-348930 AGGCTGGCACAGCCTGGACGCGG + Intronic
1185467681 X:364271-364293 CTGCTGGTACGAGCTGGGCAGGG + Intronic
1186020324 X:5247282-5247304 CTGGTGCCACACCCTGGGCCTGG + Intergenic
1186186093 X:7021011-7021033 CTGCTGGAATCGCCAGGGCAGGG + Intergenic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190798971 X:53771039-53771061 CCGGTGCCACACCCTGGGCATGG + Intergenic
1191867934 X:65720646-65720668 CTCCTGGTAGAGCCTGGGCCTGG + Intronic
1191912946 X:66170815-66170837 CTGCTACCACACCCTGGGAAAGG - Intronic
1192033834 X:67543840-67543862 GTGCTGGCGCAGCGTGGGCGAGG - Intergenic
1192557748 X:72103827-72103849 CTTCTGCCACAGGCTGGCCAGGG - Intergenic
1198392246 X:136188291-136188313 CTACTGGCACAGCCTGGGCAAGG - Intronic
1199878366 X:151953371-151953393 CTGCTGGCACACCAGTGGCAAGG - Exonic
1200686757 Y:6265360-6265382 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1200690981 Y:6306252-6306274 CAGCGGGCACAGCCTGGCCCTGG + Intergenic
1200714386 Y:6520723-6520745 CAGCGGGCACAGCCTGGCCCTGG + Intergenic
1200958529 Y:8973903-8973925 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1200988271 Y:9326005-9326027 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1200989635 Y:9336276-9336298 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1200992304 Y:9356609-9356631 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1200994955 Y:9376887-9376909 CAGCGGGCACAGCCTGGCCCTGG - Intronic
1200997620 Y:9397233-9397255 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1201000132 Y:9465769-9465791 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1201002791 Y:9486079-9486101 CAGCGGGCACAGCCTGGCCCTGG - Intronic
1201008110 Y:9526692-9526714 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1201010720 Y:9546882-9546904 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1201011075 Y:9548374-9548396 CAGCGGGCACAGCCTGGCCCTGG + Intergenic
1201019437 Y:9640433-9640455 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1201044291 Y:9868464-9868486 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1201059924 Y:10036445-10036467 CAGCAGGCACAGCCTGGCCCTGG + Intergenic
1201063474 Y:10068841-10068863 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1201259710 Y:12147029-12147051 CTGGTGCCACACCCTGGGCCTGG - Intergenic
1201367782 Y:13227661-13227683 TGGCTGGCACAACATGGGCAGGG + Intergenic
1202109530 Y:21405920-21405942 CCGCAGGCACAGCCTGGCCCTGG + Intergenic
1202115551 Y:21466953-21466975 CAGCGGGCACAGCCTGGCCCTGG - Intergenic
1202119750 Y:21510188-21510210 CTGCAGGCACAGCCTGGCCCTGG - Intergenic
1202122203 Y:21533729-21533751 CTGCAGGCACAGCCTGGCCCTGG - Intronic
1202156804 Y:21895654-21895676 CTGCAGGCACAGCCTGGCCCTGG + Intronic
1202159250 Y:21919195-21919217 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202185699 Y:22184110-22184132 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202205661 Y:22402286-22402308 CTGCAGGCACAGCCTGGCCCTGG - Intronic