ID: 1147946596

View in Genome Browser
Species Human (GRCh38)
Location 17:44083805-44083827
Sequence TGCTGCCTTGTGGGGGCATC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147946596_1147946604 2 Left 1147946596 17:44083805-44083827 CCCGATGCCCCCACAAGGCAGCA 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1147946604 17:44083830-44083852 GCATACATCTTCTGGCTGATGGG 0: 1
1: 0
2: 1
3: 5
4: 124
1147946596_1147946605 3 Left 1147946596 17:44083805-44083827 CCCGATGCCCCCACAAGGCAGCA 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1147946605 17:44083831-44083853 CATACATCTTCTGGCTGATGGGG 0: 1
1: 0
2: 1
3: 12
4: 127
1147946596_1147946606 12 Left 1147946596 17:44083805-44083827 CCCGATGCCCCCACAAGGCAGCA 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1147946606 17:44083840-44083862 TCTGGCTGATGGGGCCTGCATGG 0: 1
1: 0
2: 2
3: 45
4: 220
1147946596_1147946603 1 Left 1147946596 17:44083805-44083827 CCCGATGCCCCCACAAGGCAGCA 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1147946603 17:44083829-44083851 AGCATACATCTTCTGGCTGATGG 0: 1
1: 0
2: 3
3: 11
4: 140
1147946596_1147946607 18 Left 1147946596 17:44083805-44083827 CCCGATGCCCCCACAAGGCAGCA 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1147946607 17:44083846-44083868 TGATGGGGCCTGCATGGAAGAGG 0: 1
1: 0
2: 1
3: 25
4: 247
1147946596_1147946602 -6 Left 1147946596 17:44083805-44083827 CCCGATGCCCCCACAAGGCAGCA 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1147946602 17:44083822-44083844 GCAGCACAGCATACATCTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147946596 Original CRISPR TGCTGCCTTGTGGGGGCATC GGG (reversed) Exonic
900376488 1:2357171-2357193 TGCAGCCTCGTGGGGTCCTCAGG - Intronic
900652112 1:3734809-3734831 TGCACGCTTGTGGGGGCAGCAGG + Exonic
901947167 1:12713195-12713217 TGCCCCCTTGTGAGGGCCTCAGG - Intergenic
901987189 1:13085447-13085469 TGCTGCTGGGTGGGGGCACCAGG - Intergenic
901994623 1:13141320-13141342 TGCTGCTGGGTGGGGGCACCAGG + Intergenic
902705051 1:18198915-18198937 TCTTGCTTTGGGGGGGCATCTGG - Intronic
902774651 1:18666916-18666938 TGCTTGGTGGTGGGGGCATCAGG + Intronic
904295368 1:29516788-29516810 TGCAGCCTGGTGGGGGCAGGGGG + Intergenic
904905521 1:33894821-33894843 CTCTGTCTTGTTGGGGCATCCGG + Intronic
905649188 1:39645293-39645315 TGCTGCATGGTGGAGGTATCTGG + Intergenic
906949398 1:50322299-50322321 TCCTGCCTTGAGGGAGCCTCTGG - Intergenic
907914263 1:58854097-58854119 TGCTGCCATCCTGGGGCATCAGG + Intergenic
910207239 1:84760058-84760080 TGCTGCCTTCTCGGGGCTTAGGG - Intergenic
911068680 1:93814630-93814652 TTCTGCCCTGTGGGCCCATCTGG + Intronic
911090168 1:94011455-94011477 TGCTGTCCTGTGAGAGCATCTGG - Intronic
912866571 1:113263064-113263086 TGCTGCCTAGAGGGGGCTGCTGG - Intergenic
914970086 1:152301183-152301205 TGCAGCTTTGTAGGGGCATTTGG + Intergenic
915733535 1:158070618-158070640 TACTGCATTGTTGGGGCCTCTGG - Intronic
917644907 1:177020341-177020363 TGTTGCCTTCTGGAGGCACCCGG + Intronic
917918658 1:179730317-179730339 TGCTTCCTTGGGTGGGGATCGGG - Intergenic
918161754 1:181907830-181907852 TGCTGCCTGGTGGTGGTGTCAGG - Intergenic
920309610 1:205041302-205041324 TGCTGCCCTGTGGTGGGAGCTGG - Intergenic
1065152614 10:22837649-22837671 AGTTTCCTTGTGGGGTCATCTGG + Intergenic
1067411690 10:46070250-46070272 TTCTGTCATGTGGTGGCATCTGG - Intergenic
1067833533 10:49623880-49623902 TGATGTCTTGTGAGGGCAGCAGG - Intronic
1069632364 10:69904696-69904718 TGCAGCCATGTGGGGGCCGCGGG - Intronic
1069737873 10:70669478-70669500 TACTTCCTTGTGGGGGCATCTGG + Intergenic
1069807692 10:71136288-71136310 TGCTGCCGTGAGGCGGCCTCTGG - Intergenic
1070192595 10:74126171-74126193 AGCTGCCTTGTGTGGGTGTCAGG + Exonic
1071283829 10:84126089-84126111 TGCCCCCTTGTGGCGGCCTCAGG - Intergenic
1072034070 10:91548589-91548611 GGCTCTCCTGTGGGGGCATCTGG + Intergenic
1072754849 10:98012526-98012548 TGCTGGCTTGTCAGTGCATCTGG + Intronic
1073127830 10:101162963-101162985 TGCTTCCTTGAGGGGGCAGATGG - Intergenic
1073577804 10:104640464-104640486 CGCTGCCGCGTGGGGGCACCTGG - Intergenic
1075087448 10:119423002-119423024 TGCAGCCTGGAGGGGGCAGCAGG + Intronic
1075466909 10:122658499-122658521 GGCTGCCTGGTGGGGGTGTCGGG - Intergenic
1075965096 10:126604295-126604317 TGTTGCTTTGTGAGGGCTTCTGG - Intronic
1076994945 11:293291-293313 GCCTGCCTAGTGGGGGCACCGGG - Intronic
1079252747 11:18798918-18798940 TACTTCCTTGTGGTGACATCTGG - Intergenic
1083932273 11:65852583-65852605 TGCTGCCCTGTCCTGGCATCCGG - Intronic
1083938184 11:65881271-65881293 TGGGGCCTTGTGGGGGCTACAGG + Intronic
1084453441 11:69253501-69253523 TGCTGCCTTCTGAGGGAGTCAGG - Intergenic
1084462203 11:69302341-69302363 TGGTGACTTGTGTGGGCACCTGG + Intronic
1084518607 11:69649629-69649651 TGCTGCCTTTTTGGAGCTTCTGG + Intronic
1084970393 11:72768331-72768353 GCTTGCCTTGTGGGGGCCTCAGG - Intronic
1085323403 11:75588593-75588615 CCCTGGCCTGTGGGGGCATCTGG - Intronic
1085522562 11:77146948-77146970 AGCTGCCTTGTGGTGGCAGATGG - Intronic
1086529865 11:87772210-87772232 TGCTACCCTGTAAGGGCATCTGG - Intergenic
1090924088 11:131234429-131234451 AGCTGCCAGGTGGGGGCATCAGG + Intergenic
1091881495 12:3982159-3982181 TGCAGCCCTGTGTGAGCATCAGG - Intergenic
1098265582 12:68715630-68715652 TTCTGTCTTATGGGAGCATCAGG - Exonic
1100942088 12:99734631-99734653 TGGTGGTTTGTGGAGGCATCAGG - Intronic
1101675491 12:106913234-106913256 TGCGGCTCTGTGGGGGCAGCAGG - Intergenic
1101823818 12:108204846-108204868 TGCTTCCTTGTGGGGAGAGCAGG - Intronic
1101827880 12:108234624-108234646 TGCTTCCTTGTGGGAGCTGCTGG + Intronic
1102938523 12:116917631-116917653 TGCTGCCTTGGAGTGTCATCTGG + Intronic
1103303020 12:119942561-119942583 TCCTCCCTTGAGGGGGCATGTGG - Intergenic
1103359813 12:120346895-120346917 TGCAGCCTGGTGGTGGCATCAGG - Intronic
1104052122 12:125202394-125202416 TGCAGCCTTGTGAGAGCTTCTGG - Intronic
1104324829 12:127786059-127786081 TGCTGTGTTGTGAGGGCTTCTGG - Intergenic
1106688876 13:32092072-32092094 TACTGCGTTGTGGTGACATCTGG - Intronic
1107710493 13:43146023-43146045 GGCTGCCTTATGAGGCCATCAGG + Intergenic
1108437985 13:50420233-50420255 TGTTGCCTTGAGGGGGGATCTGG + Intronic
1108676062 13:52739064-52739086 TGCTGCTCTTTGGGGCCATCGGG - Exonic
1111954943 13:94746644-94746666 TGCTTCCCTGTAGAGGCATCTGG + Intergenic
1114390557 14:22303468-22303490 TCCTGCTTTGTGGTGGAATCTGG + Intergenic
1119178696 14:72588890-72588912 TGCTGGCTTGACGGGGCACCTGG - Intergenic
1119391835 14:74296107-74296129 TGCTCCTATGTGGGGGCATCTGG + Intronic
1121929997 14:97963709-97963731 AGCTGCCCTGTGGAGGCCTCAGG - Intronic
1122620682 14:103056482-103056504 CTCTGCGTTGTGGGGGCAGCTGG - Intronic
1124782853 15:32652219-32652241 TACTGCTTTGTGGGGGCTTTGGG + Intronic
1124783205 15:32655531-32655553 TGCTGACTTGGGAGGGCAACGGG + Intronic
1124898768 15:33802851-33802873 TGCTGCCTTTGAGGAGCATCAGG + Intronic
1125300201 15:38246785-38246807 AGCTGCCTTTTGTGGGCCTCAGG - Intergenic
1128536587 15:68495833-68495855 TGCTGCCTTGTGGAAGCCTGAGG - Intergenic
1129453387 15:75663148-75663170 TGCTGCTATCTGGGGGCAGCAGG - Intergenic
1131111273 15:89766663-89766685 TGCTCCCTGCTGGGGCCATCAGG - Intronic
1131258273 15:90875622-90875644 GGCTGACTGGTGGGGGCATGGGG - Exonic
1132898229 16:2238824-2238846 AGCTGCCTTCTGGGGCCAGCAGG - Intergenic
1136034719 16:27530498-27530520 TGCTGCCTTTTGGGGGGATTTGG - Intronic
1137585479 16:49661755-49661777 GGCTGCATTCCGGGGGCATCAGG + Intronic
1137727445 16:50666693-50666715 TGCTGCACTGTGAGGGCATAGGG + Intronic
1140191166 16:72818253-72818275 TGCTGTCTAGTGGGAGCATGAGG - Intronic
1140892611 16:79298103-79298125 TGCTGCCTTGCAGTGGCACCCGG - Intergenic
1141986503 16:87583833-87583855 TGCTGCAGTGTGGGGGCAGGGGG + Intergenic
1142567831 17:852205-852227 TTCTGCCATCCGGGGGCATCCGG + Intronic
1144592042 17:16532481-16532503 TGCTGCATTCTGAGGACATCTGG + Intergenic
1147458792 17:40555330-40555352 AGCTGTCCTGTGTGGGCATCTGG - Exonic
1147946596 17:44083805-44083827 TGCTGCCTTGTGGGGGCATCGGG - Exonic
1151209938 17:72537089-72537111 TGCTGCCGGGTGGCGGCAACGGG - Intergenic
1151242357 17:72768067-72768089 TGCTCCCTGGTGGGGGCCACAGG + Intronic
1152206336 17:78976538-78976560 TGCTGGCCTATGGGGGCAGCAGG + Intronic
1152688626 17:81707424-81707446 TGCTGCCTGGTGACGGCACCCGG + Exonic
1153228982 18:2919405-2919427 TGCTGCCTGGTGTGGGCCTTTGG - Exonic
1154195245 18:12260948-12260970 TCCTGCTCTGTGGGGGCATGGGG + Intronic
1156470897 18:37376696-37376718 GGCTGCATTGTGGGGGCCCCAGG - Intronic
1156474281 18:37395785-37395807 GGCTGCCATGTGGGGGCCTCAGG - Intronic
1156511197 18:37638179-37638201 TCCTGCATTGTGGGGGCTTCAGG - Intergenic
1156918561 18:42490545-42490567 TGCTGAATTGTGTGGGTATCAGG - Intergenic
1157281155 18:46347155-46347177 TGCTGCCTTGGGGAGTGATCGGG + Intronic
1157441952 18:47718398-47718420 TGGTTCCTTCTGGGGGCATGGGG + Intergenic
1157599680 18:48886247-48886269 TCCCATCTTGTGGGGGCATCTGG - Intergenic
1160714827 19:571533-571555 TGCTTCATTGTGGGGGCCTCAGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163508932 19:17724110-17724132 CGCTGGCCTGTGGGGGAATCAGG - Exonic
1163927557 19:20360497-20360519 TGCCCCCTTGTGGTGGCCTCAGG + Intergenic
1164094317 19:21992271-21992293 TGCGTCCTTCTGGGTGCATCAGG - Intronic
1164502271 19:28829978-28830000 TGCTGCCCAGTCGGGTCATCTGG + Intergenic
1164563139 19:29307941-29307963 AGGTGCCTTGAGGGGGCAGCGGG - Intergenic
1165166650 19:33861799-33861821 TGCAGTCTTTTGGGGGAATCAGG + Intergenic
1167414843 19:49364587-49364609 TGCCGCCTTGCGGGGGCAGGTGG - Exonic
1168047000 19:53801256-53801278 TGCTGCTGTGTGAGGGCCTCAGG - Exonic
925053567 2:836271-836293 TGCAGCCTTGTGTGGGAAGCAGG + Intergenic
926064775 2:9829848-9829870 GGCTGACTTGTTGGGGCATTAGG - Intergenic
927485606 2:23486517-23486539 TGGGGCCATGTGGGGGCTTCTGG + Intronic
928136194 2:28689356-28689378 TTCTGACTTGAGCGGGCATCAGG - Intergenic
929292800 2:40212642-40212664 TGCTGCCTTCTGAAGGCATTAGG + Intronic
929933636 2:46277496-46277518 TGCTGCCTGGTGCAGGCCTCCGG - Intergenic
930124206 2:47783477-47783499 CGCTACCTGGTGGGGGCAGCAGG - Exonic
930330199 2:49973684-49973706 TGCTGCTTTGTGTGAGCTTCAGG - Intronic
932584914 2:73021694-73021716 TGCTGCCTTGGGAAGGCCTCGGG - Intronic
935711558 2:105903347-105903369 TGCTGGTTGGTGGGGGCATGTGG + Intergenic
937307394 2:120880918-120880940 TGCTCCCTGGTGGGGGCAGGGGG - Intronic
938475223 2:131604341-131604363 TGGTCCCTTGTGGGGGCAAAGGG + Intergenic
940883119 2:158967587-158967609 CGCTGCCTTGTGTGGCCAGCGGG - Intergenic
947023218 2:225707244-225707266 TGCTGCCTTCTGGAGGTATTTGG + Intergenic
947556789 2:231100067-231100089 TGCCCCCTTGTGGTGGCCTCAGG - Intronic
948270279 2:236668792-236668814 TGCTGCCTTCTGGGGCCTGCTGG + Intergenic
1170809785 20:19665019-19665041 TCCCACCTTGTGGGGGCATGGGG - Intronic
1171035828 20:21712509-21712531 AGCTGTCTTGAGGGAGCATCTGG - Intronic
1171361240 20:24587724-24587746 TGCTGCCTTGTTGGGTCAAGGGG + Intronic
1171427479 20:25057874-25057896 GGCCGCCTTCTGGGGGCCTCTGG - Exonic
1172656898 20:36543027-36543049 TGCAGCCTTCTGTGGGCACCAGG + Intronic
1173285911 20:41671326-41671348 TGCTCCCTGGTGGGGGTAACTGG - Intergenic
1174171624 20:48621233-48621255 GGCTGCCTTGCGGGGGTACCAGG - Intergenic
1176302438 21:5104960-5104982 TGCTGTGTTGAGAGGGCATCTGG + Intergenic
1176958585 21:15134154-15134176 AGCTGCCTCGTGTGGGCATAGGG + Intergenic
1178807050 21:35847896-35847918 TCCTGGCTTCTGGGGGCAGCTGG + Intronic
1179713235 21:43274870-43274892 GGCGGCCTTGTGGGGGCAACGGG + Intergenic
1179809532 21:43861615-43861637 TGCTGCGCTGTGGCTGCATCAGG + Intergenic
1179854589 21:44156963-44156985 TGCTGTGTTGAGAGGGCATCTGG - Intergenic
1180592362 22:16951851-16951873 TGCTGCCATGTGGATGCAGCTGG + Intergenic
1182194815 22:28505699-28505721 TTCTGCCTTGCGGGGGATTCTGG - Intronic
1182692100 22:32171366-32171388 TGCTGCCTTCTGAGGTCACCTGG - Intergenic
1182972507 22:34591039-34591061 TCCTGGCTGGTGGGGTCATCCGG + Intergenic
1183163181 22:36128390-36128412 TGCTGCCTTCTGAGGTCACCTGG + Intergenic
1183511389 22:38237185-38237207 TCCTTCCTTGTGGGGGAATGAGG - Intronic
1183571325 22:38655856-38655878 GGCTGCCTAGTGGGTGTATCAGG - Intronic
1184536916 22:45093865-45093887 TGCTGCTTTGTTAGGGCAGCCGG + Intergenic
1185346090 22:50311441-50311463 TGGTGCCTGGTGGGGGCTCCAGG + Exonic
1185415607 22:50707833-50707855 CCCAGCCTTGTGGGGGCCTCAGG - Intergenic
951092924 3:18596892-18596914 TGGTGCATTCTGGGGGCATGGGG + Intergenic
952032263 3:29157855-29157877 TGCTATCTTGTGGTGGAATCAGG + Intergenic
952705815 3:36376917-36376939 TGCTGCCTTTTCAGGACATCCGG + Intergenic
952816968 3:37454047-37454069 TGGTGCCTAGTGTGGGGATCTGG - Intronic
952846438 3:37691439-37691461 TGCTGCCCTGTGGGTGAAGCTGG - Intronic
953064464 3:39456326-39456348 TGCTGCCTGGTGCGGGGATGGGG - Intergenic
953641335 3:44711077-44711099 AGGGGCCTGGTGGGGGCATCCGG - Intergenic
958056669 3:88421316-88421338 TGCTGCCTTGTGGAGTTATGGGG - Intergenic
961504892 3:127363381-127363403 TGCTGCCTTCTGAAGGCAGCAGG - Intergenic
961626637 3:128268742-128268764 TCCTGGCTTCTGGGGGCTTCCGG - Intronic
963428924 3:145171562-145171584 TGCTGCCCTGTTTGGGCATGAGG - Intergenic
964618919 3:158700900-158700922 TGCTCCCTTTTGGGGGAAGCAGG - Intronic
966749541 3:183309069-183309091 TGCTGACTTGTGTGCGGATCTGG + Intronic
969230319 4:5826235-5826257 TGCTGCCTTGTCTGGGACTCAGG - Intronic
969515960 4:7648422-7648444 TGCTGCCTGGGGGTGACATCAGG - Intronic
971423736 4:26496448-26496470 AGCTGCCTTCTGTGGGCACCAGG - Intergenic
971897629 4:32618033-32618055 TGCTTCCATATGGGGGCCTCAGG - Intergenic
976281867 4:83334281-83334303 TATTGCATTGTGGTGGCATCTGG - Intronic
979940570 4:126757670-126757692 TTCTGTCTCTTGGGGGCATCAGG + Intergenic
983028041 4:162761284-162761306 TGCAGCCTTGTGTGGGCAGGAGG - Intergenic
984657051 4:182329346-182329368 TGTTGCCTTGTGGGAGCAGCTGG + Intronic
992626448 5:78640017-78640039 TGCTGTGTTGTCGGGGCACCTGG - Intronic
997353682 5:133248728-133248750 TGCAGCCTAGTGTGGCCATCAGG - Intronic
997530647 5:134579347-134579369 TGAGGCCTTGTGGGGGGACCAGG - Exonic
999004602 5:147961849-147961871 TGCTGGCTTGTGGGGAGGTCTGG + Intergenic
999257896 5:150220001-150220023 TGGTGCCCTGTGGTGGCACCAGG + Intronic
999391898 5:151199340-151199362 TCCTGCCTTGAGGAAGCATCAGG - Intronic
1000245657 5:159446736-159446758 AGCTGCCTTGTGGGGCCATTAGG - Intergenic
1000294149 5:159898234-159898256 TGCAGGGTTGTGGGGGCAGCAGG - Intergenic
1001682570 5:173569724-173569746 TGCTGCCTCATGGGGACATCTGG - Intergenic
1002401966 5:178995955-178995977 AGCTGGCATGTGTGGGCATCAGG + Intronic
1006312082 6:33268041-33268063 AGCGGCCTAGTGTGGGCATCTGG - Intronic
1006796831 6:36737426-36737448 TGCTGCTCTGTGGGGCCATGTGG + Intergenic
1007096129 6:39214393-39214415 TGCTGGCTTGGGGGAGAATCTGG + Intronic
1007192624 6:40032589-40032611 TCCTCCCTTGTAGGGGCATGGGG + Intergenic
1011182368 6:84635334-84635356 TCCTGCCTTGTGGGGACTACCGG - Intergenic
1012420481 6:99059180-99059202 GGCTGGCTTTTGGGGACATCTGG - Intergenic
1012447214 6:99319008-99319030 TTCTGGCATGTGGAGGCATCAGG + Intronic
1013603300 6:111725447-111725469 TGCTGCCTTCTGGGGACAGACGG + Intronic
1014138622 6:117916463-117916485 TTCCTCATTGTGGGGGCATCAGG + Intronic
1017551931 6:155518477-155518499 CACTGTCTGGTGGGGGCATCAGG - Intergenic
1017907532 6:158767330-158767352 AGCTGTCTAGTGAGGGCATCCGG - Exonic
1018191737 6:161315020-161315042 CGCCGCCTTGTGGGGGCCTCAGG - Intergenic
1023387765 7:39677196-39677218 TGGTTCCTTGAGGGGGCTTCAGG - Intronic
1024063511 7:45715648-45715670 TGTGGCCATGTGGGGGCAGCAGG + Exonic
1025263944 7:57440364-57440386 CTCTGCCATGTGGGGGCCTCAGG + Intergenic
1025635290 7:63315744-63315766 CTCTGCCATGTGGGGGCCTCAGG - Intergenic
1025647405 7:63432426-63432448 CTCTGCCATGTGGGGGCCTCAGG + Intergenic
1029066995 7:97860145-97860167 TGCTGGCTGGTGAGGGAATCTGG - Intronic
1031680231 7:124664249-124664271 TGCTGCCTTGTGGGGCAAAAGGG + Intergenic
1034131777 7:148725333-148725355 TCCTTCCTTGAAGGGGCATCTGG - Intronic
1034949199 7:155285537-155285559 TGCTGCCTTGTGGATGCCGCTGG + Intergenic
1035159114 7:156938274-156938296 TGCTGCCCTGTGGCAGCATGGGG + Intergenic
1039920749 8:41892687-41892709 GACTGTCTTTTGGGGGCATCTGG - Intronic
1047204924 8:122795375-122795397 TGCTCCCTTGTCTGGACATCTGG + Intronic
1047898047 8:129388775-129388797 GGCTGCCTTGGGGAGGCAGCTGG + Intergenic
1049035110 8:140069580-140069602 TGCTGTATTGTGGGGTCATATGG - Intronic
1049395693 8:142399219-142399241 TGCTGCATGGTGGAGCCATCTGG - Intronic
1049698061 8:143993269-143993291 TGCTGCCCTCTGGGGACATGCGG + Exonic
1052677409 9:31644887-31644909 AGTGGCCTTTTGGGGGCATCAGG + Intergenic
1057544561 9:96007846-96007868 TGCTGGCTTCTGGGGGCAGTGGG + Intronic
1059456566 9:114403561-114403583 GGCTGTCTGGTGGTGGCATCAGG + Intronic
1060983122 9:127804702-127804724 TACTGGCTTGTGGGGGGATGTGG + Intronic
1061078782 9:128357604-128357626 TGCTGCCTTGTGGGCGACTGCGG - Intronic
1061582632 9:131546753-131546775 CGCTGCCTGGCGGGGGCCTCGGG - Intergenic
1061587000 9:131575906-131575928 TGCTGCCTTTGCGGGGCATGAGG + Intergenic
1062610939 9:137373172-137373194 TGTGGCCATGTGTGGGCATCGGG + Intronic
1186671911 X:11775955-11775977 TGCTGCATTGTGGTCTCATCTGG + Intergenic
1187464586 X:19515591-19515613 CGCTGCCTGGAGGGGGCAGCAGG - Intergenic
1187955683 X:24516302-24516324 TGCTGCTTCGTGGGCGCATTTGG - Intronic
1189034125 X:37478891-37478913 TGCCGCCTTGTGGTGGCCTCAGG + Intronic
1192369438 X:70501000-70501022 TGCTGCCCTGCGGGGGGTTCTGG + Intronic
1192522437 X:71814556-71814578 TGCTGGCTTCTTGGGGCTTCCGG - Intergenic
1194185073 X:90765590-90765612 TGCTGCACTGTGGGGGCCTTTGG + Intergenic
1194412218 X:93571268-93571290 AGCGGCCTTGTGGGAGCATCTGG - Intergenic
1194920075 X:99754233-99754255 TGCTGCTGTGTGGTGGCATGGGG - Intergenic
1200696947 Y:6369315-6369337 AGCTGCCTTGTGCTGGCATCAGG + Intergenic
1201037166 Y:9795384-9795406 AGCTGCCTTGTGCTGGCATCAGG - Intergenic