ID: 1147949558

View in Genome Browser
Species Human (GRCh38)
Location 17:44099417-44099439
Sequence CAGGCTGGGACTTCCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147949558_1147949569 -4 Left 1147949558 17:44099417-44099439 CCTCCATGGGAAGTCCCAGCCTG 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1147949569 17:44099436-44099458 CCTGGGTTGCTGAGTGGGTGGGG 0: 1
1: 0
2: 3
3: 45
4: 369
1147949558_1147949566 -6 Left 1147949558 17:44099417-44099439 CCTCCATGGGAAGTCCCAGCCTG 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1147949566 17:44099434-44099456 AGCCTGGGTTGCTGAGTGGGTGG 0: 1
1: 0
2: 2
3: 43
4: 441
1147949558_1147949562 -10 Left 1147949558 17:44099417-44099439 CCTCCATGGGAAGTCCCAGCCTG 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1147949562 17:44099430-44099452 TCCCAGCCTGGGTTGCTGAGTGG 0: 1
1: 0
2: 3
3: 33
4: 454
1147949558_1147949567 -5 Left 1147949558 17:44099417-44099439 CCTCCATGGGAAGTCCCAGCCTG 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1147949567 17:44099435-44099457 GCCTGGGTTGCTGAGTGGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 552
1147949558_1147949564 -9 Left 1147949558 17:44099417-44099439 CCTCCATGGGAAGTCCCAGCCTG 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1147949564 17:44099431-44099453 CCCAGCCTGGGTTGCTGAGTGGG 0: 1
1: 0
2: 2
3: 53
4: 1029

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147949558 Original CRISPR CAGGCTGGGACTTCCCATGG AGG (reversed) Intronic
900265884 1:1756987-1757009 CAGTCTGGTGCTTGCCATGGCGG + Intronic
902403792 1:16172358-16172380 GAGGCTGGGAGTTTCGATGGCGG - Intergenic
903154045 1:21431772-21431794 CAGCCTGGCACTTCCCATTCAGG + Intergenic
903379614 1:22887528-22887550 CAGGCTGGGAAATCCCAGTGGGG - Intronic
903643522 1:24876403-24876425 CCGGCTGAGACTTGCCCTGGGGG + Intergenic
905473101 1:38207657-38207679 CAGGCTGGAGGTTCCCAGGGAGG + Intergenic
913031935 1:114916025-114916047 CAGTCGGGCACTTCTCATGGGGG - Intronic
915289167 1:154871346-154871368 CAGGCAGGGAATGACCATGGGGG - Intergenic
915662665 1:157416850-157416872 CACCCTGGGAGTTCCCAGGGTGG - Intergenic
916738356 1:167628062-167628084 CAGACTGGGACTTCTCCTGAGGG - Intergenic
919849626 1:201663792-201663814 CAGGGTGGGATGTTCCATGGGGG + Intronic
920734307 1:208516950-208516972 CAGGCTGTGACGTCAGATGGTGG - Intergenic
921910535 1:220544483-220544505 CAGCCTGCGTCATCCCATGGTGG - Intronic
922673860 1:227538290-227538312 CAGGGTGGGGCTGCCCATGATGG + Intergenic
1063557880 10:7097703-7097725 TAGCCTGTGGCTTCCCATGGGGG - Intergenic
1064796335 10:19015922-19015944 AAGGCTGTGTCTTCACATGGGGG - Intergenic
1068585758 10:58796464-58796486 CAGGCTGGGACATGCCAGGCCGG - Exonic
1068678240 10:59790387-59790409 CAGTCGGGCACTTCTCATGGGGG - Exonic
1069548184 10:69343699-69343721 CACGCTGGCACATCGCATGGCGG - Intronic
1069661248 10:70125062-70125084 CATGCTGAGTCATCCCATGGTGG - Intronic
1069756442 10:70776779-70776801 CAGGCTGGGCCTAGCCATGCAGG + Intronic
1071925959 10:90409232-90409254 CAGGCTGTTGCTTCCCATTGTGG - Intergenic
1074776531 10:116771623-116771645 CAGGCAGGGATTTCCCATGATGG - Intergenic
1075129918 10:119728920-119728942 CACACTGGGACTTCCCACCGGGG - Intronic
1075724223 10:124603440-124603462 CTGGCTGGGACCTCCCTTGGAGG - Intronic
1076311502 10:129511048-129511070 CAGCCTGGTGCTTCCCATGATGG + Intronic
1076436107 10:130443045-130443067 CAGTCTGGGAATTCGAATGGGGG - Intergenic
1077468231 11:2743908-2743930 CAGACTGGGGCCTCCCCTGGTGG + Intronic
1077608349 11:3627333-3627355 CAGGCTGAGGATTCCCAGGGAGG - Intergenic
1079780287 11:24593907-24593929 CAGGCTGTGTCTTCCAAAGGTGG - Intronic
1081857271 11:46311876-46311898 CAGCCTGGGTCATCCCCTGGAGG - Intronic
1083701969 11:64485445-64485467 CAGGCTGGGAGTTCAGCTGGTGG - Intergenic
1084934301 11:72578863-72578885 CAGCCTGTGCCTTCCCAGGGAGG + Intronic
1085759812 11:79232371-79232393 CAGGCTGGGGCTGCCCGTGCAGG - Intronic
1089005537 11:115087728-115087750 CAGGCTGGGGCTTCTCGGGGAGG + Intergenic
1089144305 11:116313170-116313192 CAGGCTGGGACTGCCTCAGGAGG + Intergenic
1089188110 11:116634824-116634846 CTTGCTGTGACTTCACATGGTGG + Intergenic
1090459878 11:126881465-126881487 TAGGCTGGGACTTCCTATGTTGG - Intronic
1091323893 11:134669938-134669960 CAGGCTGGGGCTTCTGATGAAGG + Intergenic
1094340340 12:29404283-29404305 CAAGCTTGTACTTCCCATGCCGG + Intergenic
1096795855 12:54077167-54077189 CAGGCTGGGAGATAACATGGCGG - Intergenic
1098109593 12:67108024-67108046 CAGGATGAGAGTTGCCATGGAGG - Intergenic
1098558058 12:71841176-71841198 CAGGCTGGGACTTTTCAAGAGGG + Intronic
1098778536 12:74654107-74654129 CAGGCTGTGACTTCAGAGGGTGG - Intergenic
1101451697 12:104785691-104785713 CATGCTGTGTCATCCCATGGTGG + Intergenic
1101544824 12:105702718-105702740 CAGGTTGGGACTTCTCAGGCAGG - Intergenic
1103792066 12:123478892-123478914 CAGGCTGGCACTGCCCAGGAAGG - Intronic
1104222922 12:126803217-126803239 CCTGCTGGAACTTCCCAGGGAGG - Intergenic
1106556916 13:30817811-30817833 CAGGCTGAGACAGCCCCTGGGGG - Intergenic
1108706329 13:52991776-52991798 CTGGCTGGGACTGACCATGTGGG + Intergenic
1109596124 13:64556406-64556428 CTGGCTAGGACTTCCAATAGAGG + Intergenic
1112998607 13:105604592-105604614 CTTGCTGGGCCTTCACATGGTGG + Intergenic
1115841270 14:37473275-37473297 CAGGCTGCCTCTGCCCATGGTGG - Intronic
1116147926 14:41099563-41099585 CAGGCTGTGACTTCAGAGGGTGG + Intergenic
1117076872 14:52113983-52114005 CAGGCTGGGGCTTGCCCTGGAGG + Intergenic
1117403967 14:55383779-55383801 CCTGCTGTGACTTCTCATGGTGG - Intronic
1117569596 14:57033612-57033634 CTGGCTGTGACTTTCAATGGAGG - Intergenic
1121030380 14:90653667-90653689 CAGGCTGGGAGGTGCCATGTTGG - Intronic
1122613438 14:103001157-103001179 GAGGCTGGGGCTGCCCTTGGCGG - Intronic
1122816415 14:104316295-104316317 CAGGCTGGGACTGGCCCTGGAGG - Intergenic
1123632078 15:22268462-22268484 CCTGCTGGGACATCCCATGGTGG - Intergenic
1124187843 15:27545413-27545435 CACGGTGGCACCTCCCATGGTGG - Intergenic
1124375150 15:29125016-29125038 GAGGGTGGGAATTCCCATGAAGG - Intronic
1124649670 15:31465469-31465491 CAGGCAGGGACTGCCCAGGAAGG - Intergenic
1124695838 15:31863540-31863562 CAGGCTGTGACTTCAGAGGGTGG - Intronic
1124797596 15:32797360-32797382 GAGGCTGGGACATCCCACAGTGG - Intronic
1125481661 15:40085293-40085315 CTGGCTGGGATGTCCCGTGGAGG - Intergenic
1125840879 15:42800437-42800459 CAGACTGGGATTTCATATGGAGG - Intronic
1127338927 15:58020841-58020863 CATGCTGAAATTTCCCATGGTGG + Intronic
1128939940 15:71779745-71779767 CAGGCTGGCCATTCCCATGGAGG - Exonic
1129930316 15:79405010-79405032 CAGGTTTGGGCTTCCCATGGAGG + Intronic
1130298910 15:82665662-82665684 CTGGTTGGGACTTCCCAGGTGGG + Intronic
1131125063 15:89852939-89852961 CAGGCTGGGCATGCTCATGGAGG + Intronic
1131318104 15:91358629-91358651 TAGGCTGGGCAGTCCCATGGGGG + Intergenic
1132276782 15:100573217-100573239 CAGGCTAGGACCTCCCAGGTTGG + Intronic
1133176530 16:4019349-4019371 CAGCCTGGGACATCCCTGGGTGG - Intronic
1135382109 16:22003979-22004001 CAGGCTGAGACTTCACATCAGGG + Intergenic
1137577868 16:49615541-49615563 CAGGCTAGGCAGTCCCATGGTGG + Intronic
1138241003 16:55426951-55426973 CAGGCTGGAACTGCCCATAAAGG - Intronic
1138646451 16:58428960-58428982 CTGGCTGTGTCCTCCCATGGTGG + Intergenic
1140135732 16:72203941-72203963 CAGGCTGGATGTTCCCAGGGAGG + Intergenic
1140748582 16:78003022-78003044 TAGGCTGGGGCTTGTCATGGCGG - Intergenic
1141970917 16:87481925-87481947 CCTGCTAGGACATCCCATGGTGG + Intronic
1142203136 16:88770565-88770587 CAGGCAGGCACCGCCCATGGCGG - Intronic
1146244268 17:31265287-31265309 CAAGCTGGGACTTCCAAAGCTGG + Exonic
1147119268 17:38326267-38326289 GAGGGTGGGCCTTCCCATTGGGG + Exonic
1147606654 17:41777472-41777494 CAGGCTGGGGCTGCCCAAGGAGG + Intronic
1147949558 17:44099417-44099439 CAGGCTGGGACTTCCCATGGAGG - Intronic
1149655656 17:58308503-58308525 CAGGCAGGGGCTGCCCAGGGCGG + Intronic
1149713003 17:58759676-58759698 CTGGGTTGGACTTCCCAAGGGGG + Intronic
1150668553 17:67169375-67169397 CAGGCTGCATCATCCCATGGTGG + Intronic
1151285414 17:73107590-73107612 CAGGGTGGGCCTTCCCAGGGAGG + Intergenic
1151975320 17:77480931-77480953 CAGGCTGGAGCTGCCCTTGGTGG - Intronic
1151998626 17:77630533-77630555 CAGGCAGGGTCCTTCCATGGGGG + Intergenic
1152410127 17:80118904-80118926 GATGCTGGGACCTCCCAAGGGGG + Intergenic
1152722597 17:81930177-81930199 CAGGCAGGGCCCTCCCAGGGTGG + Intergenic
1154313164 18:13282987-13283009 CAGGCTGTGACTTCAGAGGGTGG - Intronic
1155231996 18:23783148-23783170 CAGACTGGTCCCTCCCATGGTGG + Intronic
1155325210 18:24657861-24657883 CAGTCTGTATCTTCCCATGGAGG + Intergenic
1155848691 18:30743266-30743288 CAGGCTGCTTCTTCTCATGGAGG + Intergenic
1160780688 19:876777-876799 CAGGGAGGGAGTTCCCTTGGAGG - Intronic
1163391802 19:17035756-17035778 AGGCCTGGGACTTTCCATGGAGG + Intergenic
1163420855 19:17212910-17212932 CATGCTGGAACCTTCCATGGGGG + Exonic
1164542585 19:29131971-29131993 CAGGCTGGGGCTGCACAGGGCGG + Intergenic
1164783662 19:30912789-30912811 TAGGCTGCGACTTCCCCAGGAGG + Intergenic
1165073277 19:33267773-33267795 CAGCTCGGGACTTCCCAGGGTGG - Intergenic
1166670643 19:44707753-44707775 CTGGCTGGCACTCCCCATGTAGG - Intronic
1166749790 19:45159316-45159338 CAGGCTTGGACTTCAGCTGGGGG + Intronic
925411859 2:3644123-3644145 CAGGCTGGGGCTGCCCATTGGGG + Exonic
926120826 2:10240449-10240471 GAGGATGGCACTTCCCAGGGAGG - Intergenic
926574086 2:14561235-14561257 CAGTCTGGGACTCCCAAGGGTGG + Intergenic
927520850 2:23697149-23697171 CAGGCTGGGACTCCCAGCGGAGG - Intronic
927682274 2:25147622-25147644 CAGGCTGGGAGCTCCCTTAGGGG - Intronic
928166596 2:28976904-28976926 CAGGCTGGGGCTGGCCTTGGAGG + Intronic
929071856 2:38038907-38038929 CAGGCTGGTGGTTCCCATAGAGG + Intronic
931938020 2:67219465-67219487 CAGCCTGGTAGTTCTCATGGTGG + Intergenic
934553124 2:95274353-95274375 CAGGCTGGGACCGCCCTTGGTGG - Intergenic
936456961 2:112682599-112682621 CAGGCTCAGACTTCCAGTGGGGG + Intergenic
936457003 2:112682823-112682845 CAGGCTCAGACTTCCAGTGGGGG + Intergenic
938059835 2:128244355-128244377 CAGGCTGGGTTTTGCCATGTTGG - Intronic
938062776 2:128265903-128265925 CAGCCTGGCACTTCCCATTCAGG - Exonic
939372484 2:141319533-141319555 CAGACTGGGATTTCTCATGGAGG + Intronic
940858196 2:158746170-158746192 CTGGCTGGGTCTTCCCATATGGG + Intergenic
941606627 2:167605408-167605430 CTGGCTTGGAGTGCCCATGGTGG + Intergenic
943879914 2:193130656-193130678 CAGGCTCAAACTTCACATGGTGG + Intergenic
944920622 2:204409184-204409206 CAGTGTGGGGGTTCCCATGGGGG - Intergenic
946157763 2:217818204-217818226 CAGGCTGGGACTCCCCGGGGTGG + Exonic
946157787 2:217818282-217818304 CAGGCTGGGGCTCCCCGGGGTGG + Exonic
946179418 2:217940840-217940862 CAGGTTTGGGCTTCCCATGATGG - Intronic
948141090 2:235671794-235671816 CAGACAGGGACTTTGCATGGAGG + Intronic
948696354 2:239734974-239734996 CAGACTGCGGCTACCCATGGGGG - Intergenic
1169044386 20:2524530-2524552 CAAGTTGGGACTTGCCATTGCGG - Intronic
1170405395 20:16030165-16030187 GGGGCTTGGACTTCCCATAGTGG - Intronic
1170430568 20:16272891-16272913 CAGCCTGGGACCTCCCAAAGTGG - Intronic
1170509771 20:17064744-17064766 CATGCTGTGTCATCCCATGGTGG + Intergenic
1170547911 20:17450705-17450727 AACACTGGGTCTTCCCATGGTGG + Intronic
1170610874 20:17912070-17912092 CATGCTGGCAATTCCAATGGTGG - Intergenic
1170851820 20:20011748-20011770 CAGGCTGGGACTGATCATGGTGG - Intergenic
1171108503 20:22458769-22458791 CAGTCTGTGACTTGCCATTGTGG + Intergenic
1172115951 20:32573824-32573846 CAGGCTGGGAGGCTCCATGGAGG - Intronic
1173248773 20:41353681-41353703 CAGGCTGGCACTGCCCAGGAGGG - Intronic
1173706825 20:45116049-45116071 TAAGCTGGGACTTCCCACTGTGG + Intergenic
1174000832 20:47373451-47373473 TAGGCTGGCACTGACCATGGGGG - Intergenic
1174423325 20:50415207-50415229 CAGGCAGGGATGTGCCATGGGGG - Intergenic
1174951027 20:55041634-55041656 CAGGCTGTGACTTCAGAGGGTGG + Intergenic
1175834187 20:61982859-61982881 CAGGCTGGGAGGAGCCATGGAGG - Intronic
1175899263 20:62353608-62353630 CAGGCAGGGACTGGCCAGGGTGG + Intronic
1176086483 20:63297611-63297633 CAGGCTGGGGCCTCCCTGGGTGG + Intronic
1176108812 20:63401841-63401863 AAGGCTTGGACCTGCCATGGAGG - Intergenic
1180750190 22:18119167-18119189 GTGGCTGTGACTTCCCAGGGAGG - Intronic
1180841964 22:18963299-18963321 CAGGCTGGGGGTTCCCTAGGGGG - Intergenic
1181059534 22:20275582-20275604 CAGGCTGGGGGTTCCCTAGGGGG + Intronic
1182165914 22:28172696-28172718 CAGGCTGGGACTCTCCGTGATGG + Intronic
1182504824 22:30774127-30774149 AAGGCTTGGACTCCCCAGGGGGG + Intronic
1183473290 22:38021127-38021149 CAGCCTGGGCCTTCCCTTGCTGG - Intronic
1183538288 22:38415690-38415712 CACTCTGGGCCTCCCCATGGAGG + Intergenic
1183664321 22:39238677-39238699 GAGGCTGAGACGCCCCATGGTGG - Intronic
1184171947 22:42765123-42765145 CAGGCTGGGGCTTTCCAGGGTGG + Intergenic
1184475638 22:44719879-44719901 GAGGCTGGGACATCCCATCCAGG - Intronic
1184593327 22:45500104-45500126 CTGGCTGGGACTGCCCAGTGTGG - Intergenic
1184796235 22:46734986-46735008 CAGCCTGGGACATCCCAAGTGGG + Intronic
950124733 3:10504489-10504511 CAGGCTGGGCCTCTGCATGGAGG + Intronic
950854568 3:16093033-16093055 CAGGCTGGGATTTCTTATGTAGG - Intergenic
951468323 3:23027137-23027159 CAGCCTGGGGATTCCCAGGGAGG - Intergenic
951621219 3:24603889-24603911 CAAGCTGGTACATCCCATTGAGG - Intergenic
952506105 3:34008042-34008064 CAGGCTGGTGCTTCCCGAGGAGG - Intergenic
954038760 3:47868483-47868505 TAGGCTGAGACTTCCCATGCTGG + Intronic
956041168 3:65146614-65146636 CAGGCTGGAACCTCTCATGCGGG - Intergenic
959904423 3:111694716-111694738 CCAGCTCTGACTTCCCATGGAGG - Intronic
961513330 3:127417900-127417922 CAGTCTGGGACCTTCCATGTAGG - Intergenic
961746103 3:129064346-129064368 CAGGCAGGGATTTCCCAAGGTGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
964647754 3:158976800-158976822 CATCCTGGGACTTCACGTGGAGG + Intronic
966928325 3:184659845-184659867 GAGGCTGGGAGTGGCCATGGGGG - Intronic
967989731 3:195121901-195121923 CAGGCTGGGCTTTCTCTTGGAGG - Intronic
968440251 4:620024-620046 GAGGCTTTGACTTCCCATGTTGG - Intergenic
968480876 4:832581-832603 CAGGCGGTGACTTCCCAGGTGGG + Intergenic
968651596 4:1762299-1762321 CAGGCTGGGCCTGTCCATGCTGG + Intergenic
969836080 4:9842957-9842979 TAAGATGTGACTTCCCATGGTGG - Intronic
970882899 4:20952917-20952939 CTTGCTGTGTCTTCCCATGGTGG + Intronic
978233415 4:106428463-106428485 CAGGCTTGGACTGGCCTTGGTGG + Intergenic
979601365 4:122589734-122589756 CATGCTGGGACATAACATGGTGG + Intergenic
982243093 4:153320349-153320371 CAGGATGGGACTTTGCATGATGG - Intronic
982397168 4:154925336-154925358 CAGGGTGAGACCTTCCATGGGGG - Intergenic
982657407 4:158167438-158167460 CAGGCTGGGCTTTCTCCTGGAGG - Intronic
983685622 4:170404981-170405003 AATGCTGTGTCTTCCCATGGTGG - Intergenic
988529976 5:32018711-32018733 CAGCCCGGGACTTCCCAAGTAGG + Intronic
990075757 5:51843991-51844013 CAGGCTGTGGCTTCCGAGGGTGG - Intergenic
991041654 5:62182523-62182545 CATGATGGGCCTGCCCATGGGGG - Intergenic
993211817 5:84961845-84961867 CAGAAAGGAACTTCCCATGGTGG - Intergenic
996103535 5:119470582-119470604 CTGACAGGGACTTCCCATTGTGG - Intronic
996801623 5:127409754-127409776 CTGGCAGGCACTTCCCATGTTGG + Intronic
997225003 5:132203281-132203303 CAGCAGGGGACTTCCCATGAGGG - Intronic
997372530 5:133371028-133371050 CAGGCTGGTACTGGCCAGGGAGG - Intronic
998169360 5:139863561-139863583 CAGGCTGGGACTCGCCATCCAGG + Intronic
998190003 5:140015620-140015642 CAGGCTGGGAGTGGCCATGCAGG - Intronic
998446462 5:142202458-142202480 CAGTCTGGGAATTCCTATGTTGG + Intergenic
998576675 5:143324377-143324399 CAGGCTGTGACTTCAGAGGGTGG - Intronic
1001081467 5:168670869-168670891 CAGGCTGAGTCTGCCCATGTGGG + Intronic
1002319655 5:178367486-178367508 TAGACTGGGGCTTCCCTTGGTGG + Intronic
1005810204 6:29509480-29509502 CAGGCGGAGACTCTCCATGGAGG + Intergenic
1006093878 6:31644107-31644129 CAGGCTCGGCCTTCCCATCCTGG - Exonic
1006531926 6:34662939-34662961 CAGGCTGGGACTACACAGGGTGG + Intronic
1006948039 6:37798526-37798548 GAGGCTGGGACAACCCAGGGAGG + Intergenic
1013016946 6:106168508-106168530 CAGGCTGGCACTTCTCTTGGTGG - Intergenic
1018519825 6:164635532-164635554 AAGGCTGTGAGTGCCCATGGTGG + Intergenic
1019422121 7:955235-955257 CCCGCCGGGACTTCACATGGGGG + Intronic
1019524333 7:1474003-1474025 CAGGCAGGGGCTTCCCAGGGTGG + Intronic
1019533759 7:1516956-1516978 CAGGCTGGGACCTGACAAGGAGG + Intergenic
1022315125 7:29238705-29238727 CAGGGAGGGCCTTCCCAAGGTGG + Intronic
1022465379 7:30649814-30649836 CCTGCTGGGAGTGCCCATGGTGG - Intergenic
1022658144 7:32340105-32340127 CAGGCTGGGACTTACCAGAGTGG + Intergenic
1024489157 7:49957686-49957708 CAGGCAGAGACTTACCATAGGGG + Intronic
1025247662 7:57329168-57329190 CAGGCAGGGATGTGCCATGGGGG + Intergenic
1027188985 7:75987151-75987173 GAGGCTGGGCCTTCCCCTGCCGG - Exonic
1027202407 7:76072242-76072264 CAGGCTGGGGCTGGGCATGGAGG + Intergenic
1027218305 7:76198252-76198274 CTGGCTGGGACTTCCCAGGCAGG - Intergenic
1027781118 7:82521528-82521550 CAGAATGAGAATTCCCATGGAGG + Intergenic
1028285852 7:88998062-88998084 CAGGCAGTGACATCACATGGAGG - Intronic
1032089937 7:128906441-128906463 CAGGCTGGGACATGTCATAGGGG + Intronic
1032510886 7:132471487-132471509 CTGGCTGAGTCCTCCCATGGGGG + Intronic
1034488863 7:151382266-151382288 CAGGCAGGGGCTTCCCAAGCAGG - Intronic
1035027177 7:155833762-155833784 CTGCCTGGGAATTCCGATGGGGG - Intergenic
1035070315 7:156139865-156139887 GAGGCTGGGCCTTTGCATGGGGG + Intergenic
1037771999 8:21807330-21807352 CATGCTGTGTCATCCCATGGAGG - Intronic
1037937304 8:22923799-22923821 CTTGCTGCGACTTCACATGGGGG - Intronic
1038340605 8:26682202-26682224 CAGGTGGGGTCTTCACATGGAGG + Intergenic
1040319536 8:46285679-46285701 CATGCTGGGACTTCCCAGGGAGG - Intergenic
1040322630 8:46326374-46326396 GGTGCTGGGTCTTCCCATGGAGG - Intergenic
1041159802 8:55028001-55028023 CATGCTGTGTCTTCCAATGGAGG - Intergenic
1042728355 8:71903209-71903231 CAGGCTGTGGCTTCACAAGGTGG - Intronic
1043237367 8:77884914-77884936 GAGGCTGGGACCTTCCCTGGAGG + Intergenic
1043361205 8:79474543-79474565 CTGGCTGGGTCCTCACATGGTGG - Intergenic
1044382876 8:91554798-91554820 CATGTTGTGACTTCCCATGAGGG + Intergenic
1044385823 8:91587281-91587303 AATGCTGTGACTTCACATGGTGG - Intergenic
1048653011 8:136501613-136501635 CAGGCTGCGTCCACCCATGGTGG - Intergenic
1049462015 8:142734652-142734674 TCTGCTGGGACTTGCCATGGGGG + Intronic
1050725873 9:8647959-8647981 CTGGCAGGGAAGTCCCATGGTGG - Intronic
1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG + Intronic
1054159553 9:61664335-61664357 CAGGCTGGGAGATAACATGGCGG + Intergenic
1056516108 9:87351904-87351926 CATGCTGTGTCTTCCCATGGTGG - Intergenic
1056639379 9:88357607-88357629 CAGGCTGTGGCTTCTCAGGGTGG + Intergenic
1057176185 9:93001928-93001950 AAGGCTGTGTCTTCACATGGTGG - Intronic
1057218744 9:93244360-93244382 CTGGCTGGGAATCCCCTTGGGGG - Intronic
1057855029 9:98595203-98595225 CTGGCTGGGTCCTCACATGGTGG + Intronic
1058478751 9:105369363-105369385 CTTGCTGTGACTTCACATGGTGG + Intronic
1059430827 9:114249397-114249419 CACGCTGGCACTACGCATGGTGG - Intronic
1059772210 9:117437832-117437854 ATGGCTGGGAGATCCCATGGAGG + Intergenic
1060109965 9:120899834-120899856 CATGCTGGGACTCACCCTGGGGG - Intergenic
1061680533 9:132240737-132240759 CAGGTGGGGACTTCCCAGGGTGG - Intronic
1062000726 9:134214472-134214494 CAGGATGGGACAGCCCCTGGCGG - Intergenic
1062504981 9:136868826-136868848 CAGGCCTGGACTCCCGATGGAGG - Intronic
1062598369 9:137309205-137309227 CAGGCTGGGGCCTTCCCTGGGGG + Intronic
1062732683 9:138118690-138118712 CAGGCTGGGGCTCCCCATCAGGG - Exonic
1186742029 X:12528660-12528682 CAGGCTGGGTCAGGCCATGGAGG - Intronic
1187329866 X:18327893-18327915 CTGGTTGGGAATTCCAATGGTGG - Intronic
1187564585 X:20435738-20435760 CTAGCTGGGCCTTACCATGGTGG + Intergenic
1189751218 X:44224956-44224978 CAGGGTGGGGCTTCCCAGTGAGG - Intronic
1190319457 X:49171771-49171793 CAGGCTGGGAGTATCCTTGGGGG + Intergenic
1195496309 X:105538667-105538689 CTGGCTAGGACTTCCCATCATGG - Intronic
1197339006 X:125243353-125243375 CAGGCAGGGGCTTGGCATGGTGG + Intergenic
1198523224 X:137473778-137473800 CAGAATGGGACTCCCCATGATGG + Intergenic
1202333331 Y:23778387-23778409 CAGACTGACACTTCACATGGTGG - Intergenic
1202537438 Y:25891676-25891698 CAGACTGACACTTCACATGGTGG + Intergenic