ID: 1147950820

View in Genome Browser
Species Human (GRCh38)
Location 17:44106858-44106880
Sequence ACATAAAAGCTACTTTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147950820_1147950823 -10 Left 1147950820 17:44106858-44106880 CCGGCCAAAAGTAGCTTTTATGT 0: 1
1: 0
2: 2
3: 34
4: 293
Right 1147950823 17:44106871-44106893 GCTTTTATGTGGATTAGCAATGG 0: 1
1: 0
2: 0
3: 21
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147950820 Original CRISPR ACATAAAAGCTACTTTTGGC CGG (reversed) Intronic
900008754 1:87408-87430 CCTCAAAAGCAACTTTTGGCCGG - Intergenic
901402371 1:9023611-9023633 AAAAAAAATTTACTTTTGGCTGG + Intronic
901609493 1:10486052-10486074 ACAAAAAAGCTACTAGAGGCCGG - Intronic
901693071 1:10986554-10986576 GCATAAAAGCTACTCTTGACCGG - Intergenic
902186636 1:14730376-14730398 ATAAAAAAGATACTTTAGGCCGG - Intronic
902471937 1:16654261-16654283 TCAGAAAAGCTTCTTTTAGCTGG - Intergenic
902486866 1:16753185-16753207 TCAGAAAAGCTTCTTTTAGCTGG + Intronic
904086521 1:27913290-27913312 ATTTAAAAGCGACTTTGGGCCGG + Intronic
904153496 1:28462897-28462919 ACTTAAAGGGAACTTTTGGCTGG + Intronic
905068859 1:35207690-35207712 AAATAAAATAAACTTTTGGCCGG + Intergenic
907808855 1:57848591-57848613 ATATAACAGCTACTTCTGTCTGG - Intronic
909571771 1:77120516-77120538 ATTTAAAAGCAAATTTTGGCCGG - Intronic
910973475 1:92880893-92880915 ACAAAAAAACTACTTCTGGCGGG + Intronic
912516986 1:110222725-110222747 AGATAGAAGCTGCTCTTGGCTGG - Intronic
913326326 1:117631638-117631660 ACATAAAAACTAATATTTGCAGG - Intergenic
913334449 1:117696182-117696204 ACAGAAAAGCAACTTTTGGATGG - Intergenic
914718425 1:150269658-150269680 ACATAAAAGGAATTTATGGCGGG - Intronic
915198851 1:154211297-154211319 AAATAACATCTATTTTTGGCCGG - Intronic
916228812 1:162518690-162518712 AAAAAAAAACTACTTTTGGCTGG + Intronic
920149202 1:203890601-203890623 ACATAAAAATTATTATTGGCTGG - Intergenic
920769628 1:208869240-208869262 ACATAAAAACTAATTCAGGCTGG - Intergenic
921663174 1:217832644-217832666 AAATAAAGTTTACTTTTGGCTGG + Intronic
921674384 1:217962155-217962177 ATATAAAACATACTTTTGGCCGG - Intergenic
922248106 1:223820038-223820060 ACTTCATGGCTACTTTTGGCAGG + Intronic
922518481 1:226225469-226225491 AAATAAAAGCTGCTTTTGGTTGG - Exonic
924060898 1:240173230-240173252 ACATAAAAGCCACTTGAGGCCGG - Intronic
924715796 1:246572645-246572667 AAATAAAACATACATTTGGCTGG - Intronic
1065236362 10:23656953-23656975 ACATAGAAACTACTTTTTGTTGG + Intergenic
1066121115 10:32288645-32288667 ACTTGAAAGTTACTTTAGGCCGG - Intronic
1068320630 10:55409541-55409563 GCATGAAAGGTAATTTTGGCTGG - Intronic
1069517996 10:69095009-69095031 CCATAAAAAGTACTTTCGGCCGG + Intronic
1069932745 10:71893682-71893704 ACATAAAAGCCACTGTGGGCAGG + Intergenic
1070081715 10:73194978-73195000 ATTTAAAAACTACTTTGGGCTGG - Intronic
1071683767 10:87733965-87733987 AACTGAAAGCTACATTTGGCAGG - Intronic
1073372084 10:102999376-102999398 AAATATAAGCAATTTTTGGCCGG - Intronic
1075042807 10:119122008-119122030 ACATAAAAGATAATGTTGGCCGG + Intronic
1075107102 10:119547440-119547462 AAATAAAATTTACTTTTGCCAGG - Intergenic
1076269965 10:129143702-129143724 ACAAACAAACAACTTTTGGCTGG + Intergenic
1077067793 11:651277-651299 ATATAAAAACTTCTGTTGGCTGG + Intronic
1078809603 11:14745118-14745140 CCAAAAAAGCTACCTTCGGCTGG - Intronic
1078985948 11:16597697-16597719 TTATAAAATCTCCTTTTGGCAGG + Intronic
1081443653 11:43108118-43108140 AGATAAAAGTTACTTAAGGCCGG - Intergenic
1082740355 11:56904269-56904291 AAATAGAAACTAATTTTGGCTGG + Intergenic
1082984344 11:59154939-59154961 ATATAAAGGGTACTTTTGGGAGG + Exonic
1084287135 11:68139360-68139382 ACATAAAAGATACTTGGGGCTGG + Intergenic
1085655370 11:78309757-78309779 ACAGAAAAGCTGCTTTTCTCAGG + Intronic
1087836214 11:102877871-102877893 ACATAATAGATGCTTTTGGAAGG + Intergenic
1088337079 11:108717606-108717628 ATATAAAACTTACTTCTGGCTGG - Intronic
1088673265 11:112165163-112165185 ACATAAACACTACTTTTTGTTGG + Intronic
1090735434 11:129608837-129608859 CCAGAAAAGCCACGTTTGGCAGG + Intergenic
1092820042 12:12345017-12345039 GCAAAAAAGCTATTATTGGCCGG + Intronic
1092979995 12:13785009-13785031 ACATAAAAGCAACATTTTGTGGG - Intronic
1093132226 12:15405358-15405380 ACATAAAAGTTTCAGTTGGCTGG - Intronic
1093362092 12:18241387-18241409 ATATAAAAAGTATTTTTGGCCGG - Intronic
1094341853 12:29420810-29420832 TTTTAAAAGCTGCTTTTGGCCGG - Intronic
1094356035 12:29578662-29578684 ACAAAAAAGCTACTTTAATCAGG + Intronic
1095209547 12:39476507-39476529 AAAAAAAAGCTATATTTGGCTGG - Intergenic
1095926273 12:47582736-47582758 TCATAAGAGCTATTTTTGGCTGG - Intergenic
1096966179 12:55629826-55629848 ACACAAAAGGCACTCTTGGCGGG + Intergenic
1098066147 12:66619273-66619295 CTATAAAAGGTACTTTTGGATGG + Intronic
1098276447 12:68816651-68816673 ACTTAGAAGCTACTTTTGGCTGG - Intronic
1099500151 12:83403872-83403894 ACATAAAAGCAAAGTCTGGCCGG - Intergenic
1100105410 12:91165202-91165224 ACATATAATCAACTTGTGGCAGG + Intronic
1100307894 12:93367991-93368013 TATTAAAAGCTACTTTTGGCTGG + Intergenic
1100403108 12:94249528-94249550 ACTTAAAACTTACTATTGGCTGG - Intronic
1101221086 12:102641517-102641539 GAATAAAAGCTACTTTTTTCAGG + Intergenic
1101582429 12:106053697-106053719 AAATAAAAGCTAACTTTGGCAGG + Intergenic
1101775996 12:107794261-107794283 GTATAAAAGTTTCTTTTGGCTGG - Intergenic
1103773718 12:123349618-123349640 ACATAAAAATAACATTTGGCCGG + Intronic
1103774430 12:123355893-123355915 AACTAAGAGCTAGTTTTGGCAGG + Intronic
1105364778 13:19754734-19754756 ACTTAAGAGCTAGTTATGGCTGG - Intronic
1105839985 13:24245884-24245906 ACACAAAACCAACTGTTGGCCGG - Intronic
1107275062 13:38668664-38668686 ATTTAAAATCTACTCTTGGCTGG - Intergenic
1107463480 13:40627961-40627983 TCATAAAAGCTACCCTTGACTGG + Intronic
1107645198 13:42487305-42487327 ATATAAAATGTAATTTTGGCAGG + Intergenic
1107763226 13:43704400-43704422 ACATAAAAACAACTTTTTGAAGG + Intronic
1108665147 13:52622207-52622229 ACTTAAAAGCTACAACTGGCGGG + Intergenic
1109457261 13:62609743-62609765 ACTTAAAAGCTTAGTTTGGCTGG + Intergenic
1110834677 13:80070148-80070170 ACATTAAAAATACTTTTGCCAGG + Intergenic
1111025355 13:82513911-82513933 ACACAAAAGATATTGTTGGCAGG + Intergenic
1111404126 13:87779788-87779810 AAATAAATGCTACTTGAGGCTGG - Intergenic
1112135398 13:96573269-96573291 AAATAAAAGGTACTTTAGTCAGG - Intronic
1112585191 13:100712738-100712760 AAAAAAAAACTACTTCTGGCAGG - Intergenic
1114491222 14:23103250-23103272 TAATAAAAACTGCTTTTGGCTGG + Intergenic
1117686439 14:58258139-58258161 ACATAGAAACTACTTGAGGCTGG + Intronic
1118223939 14:63881273-63881295 ACATAAAAGTTTCCTTTGGCTGG - Intronic
1119207215 14:72803325-72803347 TCAAAAAAGCTGCTTATGGCTGG + Intronic
1119327485 14:73769485-73769507 ACAGGAAAGCTGCTGTTGGCAGG + Intronic
1119399473 14:74352533-74352555 ACAAAAAAGCTACATTTGAAAGG - Intronic
1119489209 14:75015896-75015918 ATATAAAAGCCACTTTGAGCAGG + Exonic
1119859610 14:77926688-77926710 ACAAAAAAGCTGCTTTAGCCTGG - Intronic
1120063173 14:80009213-80009235 AAAGTAGAGCTACTTTTGGCCGG - Intergenic
1120392140 14:83923139-83923161 AGAAACATGCTACTTTTGGCTGG + Intergenic
1125026644 15:35036871-35036893 AAATAAAAGATAGCTTTGGCTGG - Intergenic
1127100838 15:55563296-55563318 AAATAAAAGATACATTTGGAGGG - Intronic
1129438903 15:75564805-75564827 ACATAAAAATAAATTTTGGCTGG + Intronic
1129635310 15:77310617-77310639 GCAGAAAAGCTACTTTTAGATGG + Intronic
1129648928 15:77465688-77465710 ACATTAAAGCTACTGTGGGCTGG - Intronic
1132405394 15:101539086-101539108 TCAGAAAAGCTGCTTTTGCCTGG + Intergenic
1132944491 16:2525352-2525374 AAAAAAAAGCAACATTTGGCTGG - Intronic
1133454976 16:5934103-5934125 ACATAAAACCACCTTGTGGCAGG - Intergenic
1134478108 16:14593526-14593548 ACAAATAAGCTAATTTGGGCTGG + Intronic
1134652594 16:15922122-15922144 TCATACAAAGTACTTTTGGCCGG - Intergenic
1136103545 16:28012587-28012609 AAAAAAAAGATACTTCTGGCTGG + Intronic
1137264380 16:46856843-46856865 ACAAACATTCTACTTTTGGCCGG - Intergenic
1139536058 16:67574636-67574658 AAAAAAAAGATGCTTTTGGCTGG - Intronic
1140117243 16:72052983-72053005 ACATAAAAGATACTCAAGGCTGG - Intronic
1140382994 16:74507438-74507460 AAAAAAAAACTACTTATGGCCGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142455585 16:90219556-90219578 CCTCAAAAGCAACTTTTGGCCGG + Intergenic
1143073147 17:4315442-4315464 GAAAATAAGCTACTTTTGGCCGG + Intronic
1143230576 17:5350766-5350788 ACATAACAGCTACATTTGAGGGG + Intronic
1144211804 17:13022108-13022130 AAACAAAAGTTACTTTGGGCTGG + Intergenic
1144818407 17:18053314-18053336 AAATAAAAGGTATTTTAGGCTGG + Intronic
1145854938 17:28146000-28146022 TCAAAAAAGCTCCTTTTGGCTGG - Intronic
1146247685 17:31304376-31304398 TCATAAAATCTACTGGTGGCAGG + Exonic
1146325737 17:31884292-31884314 GAATAAAAGCTAATATTGGCCGG - Intronic
1147887630 17:43695327-43695349 AAATAAAAGCTTCCTTTGGGAGG - Intergenic
1147950820 17:44106858-44106880 ACATAAAAGCTACTTTTGGCCGG - Intronic
1148248748 17:46055143-46055165 AAATAAAACTTACTTTGGGCCGG - Intronic
1153364064 18:4233750-4233772 AGATAAAAGATACTTTTTGATGG + Intronic
1153813716 18:8775272-8775294 AAATAAAAGAAACTTCTGGCCGG + Intronic
1153841050 18:9008345-9008367 ACAGACAAGCTACTTCTAGCTGG - Intergenic
1155369705 18:25084790-25084812 CCAGAAAAGCTACTATTGGATGG - Intronic
1155905919 18:31451020-31451042 AAATAAAAGCTATATTTGGGAGG + Intronic
1156732396 18:40210143-40210165 TGATAGAAGCTACTTTTGACAGG - Intergenic
1157355794 18:46932745-46932767 ACAAAAAAACTACCTTTGCCTGG - Intronic
1157368197 18:47085800-47085822 AAATAAAAGATACTATTTGCAGG + Intronic
1157962227 18:52167997-52168019 TCATAAAAGCCAATTTGGGCTGG + Intergenic
1158152854 18:54392015-54392037 ACAAAGAAGTTTCTTTTGGCAGG + Intergenic
1158355729 18:56616943-56616965 ACATCAAACACACTTTTGGCTGG - Intronic
1163082775 19:14955636-14955658 AAAAAAAAGATATTTTTGGCCGG + Intronic
1163213786 19:15861465-15861487 AGTTAAAATCTACTCTTGGCTGG - Intergenic
1164597109 19:29537562-29537584 ATATCAAAGCTACTTTGGACAGG + Intronic
1165733484 19:38161426-38161448 AGATAAAAGATAGTTTGGGCCGG + Intronic
1165962464 19:39546790-39546812 GCTTAAAAGCTGCTTTTGCCCGG - Intergenic
925466983 2:4114870-4114892 TCATAAATGCCACTTTTGGCTGG + Intergenic
925574333 2:5345195-5345217 ACATAAAGGCTACAGTTTGCTGG - Intergenic
927704816 2:25290616-25290638 ACTTAAAAACCACTTCTGGCCGG - Intronic
927800749 2:26096923-26096945 ACAGAAAACATACTTTGGGCTGG + Intronic
929275181 2:40017450-40017472 ACACAAAAGCTAGGTTTGGCAGG - Intergenic
929508001 2:42543470-42543492 ACATAAAAAGAACTGTTGGCTGG - Intronic
931606692 2:64060018-64060040 ATAAAAAAGCAACTTTAGGCTGG + Intergenic
931858907 2:66333364-66333386 AAATAAAAAATATTTTTGGCTGG + Intergenic
935174580 2:100638570-100638592 ATATAACAGCTACTTTTAGAAGG + Intergenic
937675301 2:124583642-124583664 ACAGGAAAGATACTTTTGGGAGG + Intronic
940339948 2:152569711-152569733 AAAAAAAAGATACTTGTGGCTGG + Intronic
941436048 2:165474400-165474422 GCATAAAAATTACTTTTGCCAGG - Intronic
942486972 2:176450220-176450242 ACATGAAAGCTACATTCTGCAGG + Intergenic
942569548 2:177299860-177299882 GCACAAGAGCTACTTTTGGGTGG - Intronic
942624617 2:177886646-177886668 AAATAAAACTTACTTTTGGAGGG + Intronic
943267295 2:185749685-185749707 ACATACTAGCTATTTTTGACTGG + Intronic
943364757 2:186958415-186958437 AAAAAAAAGCTTCTCTTGGCTGG + Intergenic
943394799 2:187320987-187321009 ACATAATATCTACATTTGGAAGG + Intergenic
943411480 2:187555036-187555058 ACATAAAAAGTACTTAAGGCAGG + Intronic
943608646 2:190006349-190006371 CCATAAAAGCTAGTTATGGTTGG + Intronic
943709462 2:191074862-191074884 AAATAACAGATACTTTTGGCCGG + Intronic
944034943 2:195283299-195283321 AAATAAAAGCTTTGTTTGGCAGG - Intergenic
944133701 2:196374864-196374886 ACATGAAAACTAGTTTTGGCCGG + Intronic
944361583 2:198863176-198863198 ACATAAAAACAATTTTCGGCCGG - Intergenic
945227183 2:207543898-207543920 ACAAAAAAACAAATTTTGGCTGG - Intronic
945901369 2:215541360-215541382 GTATAAAGGATACTTTTGGCTGG - Intergenic
948426893 2:237894265-237894287 AATTAAAAACTACTTTAGGCCGG - Intronic
949087082 2:242164353-242164375 CCTCAAAAGCAACTTTTGGCCGG + Intergenic
1169223043 20:3837831-3837853 AGAAAAAAGCTCTTTTTGGCTGG - Intergenic
1169582099 20:7035097-7035119 AGATAAAACCTACTTTTGGCAGG - Intergenic
1171036693 20:21718207-21718229 AAAAAACAGCTACCTTTGGCAGG - Intronic
1174426953 20:50438623-50438645 AAATAAAACTTACTTTTGGCCGG + Intergenic
1175850713 20:62090756-62090778 ACAGAAAAGTTACAGTTGGCTGG - Intergenic
1178539944 21:33440931-33440953 ACATAAAATGGACTTCTGGCAGG + Intronic
1178688721 21:34732908-34732930 ACACAAAAGCCATTTTTGGGAGG - Intergenic
1178771192 21:35505828-35505850 AAAAAACAGCTACTCTTGGCTGG + Intronic
1179207823 21:39300097-39300119 ACTTAATGGCTACTTGTGGCCGG + Intronic
1179230313 21:39498195-39498217 ACATAAAAGCTATTTTAAGGGGG - Intronic
1181623928 22:24109505-24109527 ACATATAAACTTGTTTTGGCTGG - Intronic
1182465179 22:30511219-30511241 AAATAAAAGCTTCTCTTGGGAGG - Intergenic
1182594924 22:31411993-31412015 TCTTAAAAGCTACTTCAGGCCGG + Intronic
1183254305 22:36752380-36752402 ATATAAAACCTACTTTTAGAAGG - Intergenic
1183550544 22:38480763-38480785 ATAAAAAAGTTATTTTTGGCTGG + Intronic
1184319103 22:43725435-43725457 TTATAAAAGCTAGTTTGGGCCGG - Intronic
1184528712 22:45040812-45040834 ACATTAAAGCTGGTTTTGGAGGG + Intergenic
949173683 3:1033382-1033404 ACTTAAAAGCTTAGTTTGGCTGG + Intergenic
949303321 3:2609949-2609971 AGATAAAAGCTACTTTTATTTGG - Intronic
950488989 3:13290708-13290730 ACATAAAACTGACTTTCGGCCGG - Intergenic
951119410 3:18907497-18907519 TCAGAAAAGCTTCTTTTAGCTGG + Intergenic
951286051 3:20815330-20815352 ATGTAAAAGCTCCTTTTGTCAGG - Intergenic
951587932 3:24234407-24234429 ACACAAGAGCTATTTTTGGTTGG + Intronic
952352107 3:32550133-32550155 ACATCAAAAATACTATTGGCCGG + Intronic
952798984 3:37270511-37270533 ACAAAAAAGCTACACTGGGCTGG - Intronic
954310765 3:49765343-49765365 ACATAAAAGCCACTGTAGGCAGG + Intronic
957805062 3:85136275-85136297 AAATAAAAGCTACATTTAGGAGG - Intronic
958762015 3:98320399-98320421 CTAAAAAAGCTACTTGTGGCTGG - Intergenic
959658370 3:108836212-108836234 ACATAAAAACTAACTCTGGCCGG - Intronic
960091995 3:113650100-113650122 ATATAAATGCTACCTTTGCCTGG - Exonic
960287209 3:115843164-115843186 ACATAAAAGCTAAATTTACCTGG - Intronic
960414899 3:117372298-117372320 ACAAAAAATCAACTTTTGGCTGG - Intergenic
960803431 3:121561024-121561046 ACACAAAAGATACTTCTGGAAGG + Intergenic
960804096 3:121566340-121566362 ACATAAAAGCAAACTTAGGCTGG + Intergenic
961075758 3:123980185-123980207 ACATAAATGCTACATCTAGCTGG - Intronic
962222711 3:133577140-133577162 ATATAAAAGCTAGTCTAGGCCGG - Intronic
962920967 3:139950150-139950172 ACAGAAAATTTACTTTTTGCTGG + Intronic
964068864 3:152608148-152608170 ACATAAACATTACTTTAGGCTGG - Intergenic
965019695 3:163213018-163213040 ATTTAAAATTTACTTTTGGCCGG - Intergenic
966865076 3:184253964-184253986 ATATAAAGGATACTATTGGCTGG - Intronic
967301849 3:188021937-188021959 ACACAAAACACACTTTTGGCCGG + Intergenic
967595177 3:191319561-191319583 TCTTAAAAACTATTTTTGGCTGG + Intronic
967823640 3:193861274-193861296 AGATAAAAGTTATTTTTGGTGGG + Intergenic
968317292 3:197735884-197735906 ATATAAAAACTACTTTGGACCGG - Intronic
970789483 4:19839753-19839775 GTATAAAAGATACTCTTGGCCGG - Intergenic
972446316 4:39147517-39147539 AAATAAAGGCTATTTTAGGCTGG - Intergenic
972683735 4:41331821-41331843 TCATAAAAACTATTTGTGGCTGG + Intergenic
975053230 4:69892839-69892861 ACATTAAAGTTATTTTAGGCTGG - Intergenic
975069734 4:70119054-70119076 AAATATAACCTACTTTAGGCAGG + Intergenic
976288954 4:83397761-83397783 ACAGAAAAGCCTCTTTTGGGTGG + Intergenic
977380365 4:96265512-96265534 ACATAAAAACTACTTTTTGAGGG - Intergenic
980234970 4:130093028-130093050 AAATAAAAGCTGCCTTTGGGTGG - Intergenic
980914457 4:139021297-139021319 TCTTAAAAGCTGCTTTTGGCGGG - Intronic
981942334 4:150295491-150295513 ACAATAAAGATACTTTAGGCCGG - Intronic
981977347 4:150746804-150746826 AAAGAAAAACAACTTTTGGCCGG - Intronic
982312983 4:154004719-154004741 ACATGAAAGCTACTGCTCGCTGG - Intergenic
984259547 4:177428129-177428151 ACAGAAAGGCTTATTTTGGCCGG + Intergenic
984800496 4:183711456-183711478 TTGTAAAAGCTACATTTGGCAGG + Intronic
986828264 5:11545373-11545395 ATAGAAAAGCTACATTTGGCTGG + Intronic
987242164 5:16011284-16011306 CTATAAAAGTTACATTTGGCAGG + Intergenic
989255066 5:39357755-39357777 ACATAAACCCTACTTTTGATGGG - Intronic
990660319 5:58006988-58007010 AAAAAAAAGCTATATTTGGCAGG + Intergenic
992454737 5:76906124-76906146 ACATAAAAGATGTTTTTGGCTGG - Intronic
993260531 5:85652710-85652732 ACATAAAAGAAACATTTGGAAGG - Intergenic
993453052 5:88095969-88095991 AAAAAACAGCTACTTTTGGAAGG + Intergenic
993662129 5:90650345-90650367 TAATAAAACCTAATTTTGGCAGG - Intronic
994466042 5:100132830-100132852 AAATTAAAACTACTTTTTGCAGG - Intergenic
994837890 5:104881015-104881037 GCATAAAAACTTCTCTTGGCCGG + Intergenic
994838664 5:104892088-104892110 ACATAAATGCTATTTTTGCAAGG - Intergenic
996757672 5:126951731-126951753 ACATCTAATCTACTCTTGGCTGG - Intronic
997496843 5:134335574-134335596 ACTTAAAAGCTTAGTTTGGCTGG + Intronic
997911280 5:137876507-137876529 TAATAAAAGTTACTTCTGGCTGG + Intronic
998528365 5:142863037-142863059 ACAGAAAAGATACTTTGGGAGGG + Intronic
999681021 5:154060134-154060156 ATTTCAAAGCTCCTTTTGGCTGG + Intronic
999972882 5:156882792-156882814 ACATAGGAGATACTTATGGCTGG - Intergenic
1003045702 6:2731019-2731041 ACAGAAAAGCTAATTCAGGCTGG + Intronic
1003743573 6:8972109-8972131 ACATGAAAGACACTTTTTGCAGG - Intergenic
1004438805 6:15626229-15626251 TAATAAAAGCTACTTTTGTGGGG + Intronic
1004669171 6:17779566-17779588 AAATATATGCTACTTTAGGCCGG - Intronic
1005773270 6:29099295-29099317 TCATAAAAGCTACATTTGATAGG + Intergenic
1005779258 6:29171488-29171510 TCATAAAAGCTACATTTGATAGG + Intergenic
1006480718 6:34291476-34291498 AAAGAAAAGCTAATATTGGCAGG - Intronic
1007299497 6:40856065-40856087 AAATAATAGCAACTTTTGGAGGG + Intergenic
1008133645 6:47747071-47747093 AAATAGAAGCTACTTTTAGGAGG - Intergenic
1008478432 6:51958698-51958720 AGAGAAAAGATACTCTTGGCAGG - Intronic
1009785817 6:68337712-68337734 ATATAAAAGCAAATTTAGGCCGG - Intergenic
1011099313 6:83705144-83705166 ACTTAAAACCAACTTTTGGATGG - Intronic
1011276218 6:85633916-85633938 TTTTAAAAGATACTTTTGGCAGG - Intronic
1011498594 6:87963768-87963790 AAAAAAAATCCACTTTTGGCCGG + Intergenic
1011603971 6:89083902-89083924 AAATGAAAACAACTTTTGGCAGG + Exonic
1011956147 6:93027750-93027772 AAAAAAAAGATACTTTTGGCTGG + Intergenic
1012959860 6:105611058-105611080 ACTTAAAAGCTGGTTTCGGCCGG + Intergenic
1014260587 6:119212134-119212156 AAAAAAAACCTACTATTGGCCGG - Intronic
1014728900 6:125007763-125007785 ACATAAAAGGTACTACTGTCTGG - Intronic
1014941892 6:127450537-127450559 ACATAAAGGCTACTTTTAGTAGG + Intronic
1015015721 6:128410462-128410484 AGACAAAAACTACTTTTTGCTGG + Intronic
1015207276 6:130654355-130654377 AGATACAAGCTAATTTTGGGAGG + Intergenic
1016233749 6:141836474-141836496 ATATAAATGATACTTTTAGCAGG - Intergenic
1017314611 6:153015947-153015969 ACATAAAAGATATGCTTGGCTGG - Intronic
1018435410 6:163754364-163754386 AAAGAAAAGGTACTTTGGGCTGG - Intergenic
1020155122 7:5717055-5717077 AAATAAAAACTAAGTTTGGCCGG + Intronic
1020604071 7:10313272-10313294 CCAGAAAAGCCACTTTAGGCAGG + Intergenic
1020929696 7:14377246-14377268 TTATAAAAGGTACATTTGGCTGG - Intronic
1021832737 7:24632681-24632703 ACTTAAAAGAGACTGTTGGCTGG - Intronic
1022081765 7:27029685-27029707 ACCTAAAAGCCACTATAGGCCGG + Intergenic
1024842060 7:53598730-53598752 ACATAAAAGCGAGTTTTAGAAGG + Intergenic
1026278242 7:68899393-68899415 ACATAAGAGTCACTTTGGGCCGG + Intergenic
1026356899 7:69565747-69565769 AAATAAAAGATATATTTGGCTGG - Intergenic
1026359562 7:69591230-69591252 ACAGAGTAGCTCCTTTTGGCTGG + Intergenic
1027282171 7:76616859-76616881 AAATAAAAGCTACTTGAGGCTGG + Intronic
1028185128 7:87774697-87774719 ACATAATAGTTTTTTTTGGCGGG - Intronic
1029394046 7:100294906-100294928 ATATAAAATCCACTCTTGGCCGG - Intergenic
1030982237 7:116199975-116199997 AGATATAGGCTACTTTTGCCAGG - Intergenic
1033328141 7:140396318-140396340 ATAAAAAAGATACTTGTGGCTGG - Intronic
1034091248 7:148365315-148365337 ACAAAAAAGCTACTTTTTTCAGG - Intronic
1034480454 7:151316229-151316251 ACATAAAAGATGCTTAAGGCCGG + Intergenic
1034745386 7:153519390-153519412 ACATAAAAGTGCCTATTGGCTGG + Intergenic
1034838799 7:154376306-154376328 ACTTAAAAAATACTTTTAGCAGG + Intronic
1035142848 7:156781448-156781470 AAATAATAGCTACTTTGGGTGGG + Intronic
1035433935 7:158843689-158843711 ACATAAAAGCCAATCTTGGCTGG - Intergenic
1035497644 8:66987-67009 CCTCAAAAGCAACTTTTGGCCGG - Intergenic
1035654404 8:1294705-1294727 TTATAAAAGCTTATTTTGGCTGG + Intergenic
1036015051 8:4773897-4773919 ACAAAAATCCTACTCTTGGCTGG + Intronic
1036965202 8:13289625-13289647 ACATAAAAGGAATTTTTGTCTGG - Intronic
1039858787 8:41438693-41438715 CAAAAAAATCTACTTTTGGCTGG + Intergenic
1042250243 8:66749215-66749237 ATAGAAAAGTTATTTTTGGCTGG + Intronic
1042669196 8:71242348-71242370 ACATAAAATCAACTTTTGTAAGG + Intronic
1043031272 8:75136301-75136323 ATATAAAAACTACTATCGGCCGG - Intergenic
1043617939 8:82150440-82150462 AAAAAAAATGTACTTTTGGCCGG - Intergenic
1043937092 8:86154917-86154939 GCTTAAAAGTTCCTTTTGGCCGG - Intergenic
1044076178 8:87824158-87824180 ACTTAAAAGGTACTCTTGGCTGG - Intergenic
1044368829 8:91384151-91384173 AGATAAAATCAAGTTTTGGCAGG + Intronic
1044990872 8:97794684-97794706 AAATAAAAGCTATTAATGGCAGG - Intronic
1045230758 8:100304255-100304277 ATATAAAACCAACTTTTGTCAGG - Intronic
1045753787 8:105517551-105517573 ACTTAAGATCTACTCTTGGCTGG + Intronic
1046931264 8:119844070-119844092 ACATAAAATGTTCTTTGGGCCGG - Intronic
1048020880 8:130537847-130537869 AAATAAAGATTACTTTTGGCCGG - Intergenic
1048212416 8:132466418-132466440 ACATTTAGGCTACTTTTGGCAGG - Intronic
1051918566 9:22236605-22236627 ACAGACAAGCTACTTTTGAAAGG + Intergenic
1052298553 9:26927417-26927439 AGATAAAAGTATCTTTTGGCTGG - Intronic
1055040404 9:71864698-71864720 AGGTAAAAGGTACTTTTGGGAGG - Intronic
1055279171 9:74654823-74654845 ACAAAACAGCAACTTTTGGGGGG + Intronic
1057375779 9:94521381-94521403 ACATAATAGTTATTATTGGCCGG + Intergenic
1058179356 9:101778365-101778387 ACTTAAAAGTTACCTTTGCCTGG - Intergenic
1058338030 9:103857366-103857388 ACATTATAGCTATTTTGGGCGGG - Intergenic
1058572368 9:106360276-106360298 ACTTAAAAACTACTCCTGGCCGG - Intergenic
1059134332 9:111790539-111790561 AAAAAAAAGCCACTTTTGGAAGG - Intronic
1060426127 9:123507550-123507572 ACATAAGAATTACTTTTTGCTGG + Intronic
1061984218 9:134120117-134120139 CTATAAAAGATACTGTTGGCCGG + Intergenic
1186819354 X:13271111-13271133 TCATAAAAGCACCTTTAGGCCGG + Intergenic
1187712688 X:22070114-22070136 ACTTAAAAACTACCTTTGGATGG - Intronic
1187951717 X:24477212-24477234 TCATAAAACCTCATTTTGGCAGG - Intronic
1188356955 X:29203440-29203462 ACAAAAAAATTATTTTTGGCAGG + Intronic
1188486089 X:30684017-30684039 TAATAAAAGCTGCTTTTGGAAGG - Intronic
1189039613 X:37529089-37529111 AGATCAAAGCTACATTTGACTGG - Intronic
1189314796 X:40047449-40047471 TTATAAAACTTACTTTTGGCCGG + Intergenic
1189389720 X:40565920-40565942 AGATACAACTTACTTTTGGCTGG + Intergenic
1192460074 X:71309575-71309597 AGATAGAATCTACATTTGGCCGG - Intergenic
1192893437 X:75414732-75414754 ATATAAAACAAACTTTTGGCTGG - Intronic
1196798238 X:119519598-119519620 ACACAAAAAATACTTCTGGCCGG - Intergenic
1196882252 X:120208955-120208977 TCATAAAAGCTGCTGCTGGCCGG + Intergenic
1198303787 X:135359406-135359428 ACATAAATGCTGCTTTTGCTAGG + Intronic
1198322531 X:135532773-135532795 ACTTAAAAATTACTTTAGGCTGG + Intronic
1198945941 X:142014119-142014141 ATAAAAAAGCAATTTTTGGCCGG + Intergenic
1201301682 Y:12510807-12510829 ATATAAAAACCATTTTTGGCTGG + Intergenic
1201366947 Y:13217543-13217565 ACATAAAAGGGAATTTTGGTTGG + Intergenic