ID: 1147951074

View in Genome Browser
Species Human (GRCh38)
Location 17:44108408-44108430
Sequence CTTTGCTCTCTGGGCTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 405}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147951074_1147951082 13 Left 1147951074 17:44108408-44108430 CCAAGACAGCCCAGAGAGCAAAG 0: 1
1: 0
2: 7
3: 40
4: 405
Right 1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
1147951074_1147951078 -6 Left 1147951074 17:44108408-44108430 CCAAGACAGCCCAGAGAGCAAAG 0: 1
1: 0
2: 7
3: 40
4: 405
Right 1147951078 17:44108425-44108447 GCAAAGGCTATCCCTAAAATAGG 0: 1
1: 0
2: 1
3: 10
4: 107
1147951074_1147951083 16 Left 1147951074 17:44108408-44108430 CCAAGACAGCCCAGAGAGCAAAG 0: 1
1: 0
2: 7
3: 40
4: 405
Right 1147951083 17:44108447-44108469 GGTTCTAAAGATGCTGCTGGAGG 0: 1
1: 0
2: 0
3: 19
4: 196
1147951074_1147951085 23 Left 1147951074 17:44108408-44108430 CCAAGACAGCCCAGAGAGCAAAG 0: 1
1: 0
2: 7
3: 40
4: 405
Right 1147951085 17:44108454-44108476 AAGATGCTGCTGGAGGTGGCAGG 0: 1
1: 0
2: 1
3: 51
4: 418
1147951074_1147951079 -5 Left 1147951074 17:44108408-44108430 CCAAGACAGCCCAGAGAGCAAAG 0: 1
1: 0
2: 7
3: 40
4: 405
Right 1147951079 17:44108426-44108448 CAAAGGCTATCCCTAAAATAGGG 0: 1
1: 0
2: 0
3: 9
4: 122
1147951074_1147951084 19 Left 1147951074 17:44108408-44108430 CCAAGACAGCCCAGAGAGCAAAG 0: 1
1: 0
2: 7
3: 40
4: 405
Right 1147951084 17:44108450-44108472 TCTAAAGATGCTGCTGGAGGTGG 0: 1
1: 0
2: 1
3: 17
4: 242
1147951074_1147951086 27 Left 1147951074 17:44108408-44108430 CCAAGACAGCCCAGAGAGCAAAG 0: 1
1: 0
2: 7
3: 40
4: 405
Right 1147951086 17:44108458-44108480 TGCTGCTGGAGGTGGCAGGCAGG 0: 1
1: 0
2: 8
3: 97
4: 706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147951074 Original CRISPR CTTTGCTCTCTGGGCTGTCT TGG (reversed) Intronic
900500949 1:3004313-3004335 CTTTGCTCTCTGGGCCGGGCAGG - Intergenic
900602670 1:3509738-3509760 CTTTGCCCCCTGGCCTCTCTGGG - Intronic
901540246 1:9910594-9910616 CTTTGCTCTCAGCGCGGACTCGG - Intergenic
902284768 1:15400396-15400418 TTTTCCTGTCTGGACTGTCTTGG + Intergenic
903183611 1:21617664-21617686 CTTGGGTCTCGGCGCTGTCTGGG - Intronic
904862787 1:33551485-33551507 CTATGCCCTGTGGGCTTTCTGGG - Intronic
905508590 1:38500694-38500716 CTTTGGGCTCTGGGCTCTGTAGG + Intergenic
905972698 1:42153667-42153689 CCTTGGTCTCTGGGCTGTGATGG - Intronic
906247849 1:44289689-44289711 GTTTGCCATCAGGGCTGTCTCGG - Intronic
909239917 1:73199372-73199394 TGTTGCTATCTGGCCTGTCTTGG + Intergenic
909336010 1:74474797-74474819 CTTTGCTTGCTGAGCTGTCAGGG - Intronic
910550926 1:88473831-88473853 CTGTGCTCACTGGGCAATCTGGG - Intergenic
910604840 1:89072093-89072115 CTTAGCTTGCTGGGCTGTGTGGG - Intergenic
910610358 1:89134497-89134519 CTTTGTTCTCTGGCCCCTCTAGG - Intronic
910986900 1:93014037-93014059 CTTTGCTTTGGGGGCTGTCCTGG + Intergenic
912257506 1:108075826-108075848 CTTTGCTCTGTGAGCTGACAAGG - Intergenic
912517973 1:110227748-110227770 CTTTCCTCCCTGGGCTGTGAGGG + Intronic
913098967 1:115545650-115545672 CTGGGCTCTCTGGGCTCTCTGGG + Intergenic
913595322 1:120370430-120370452 TTGTGGTTTCTGGGCTGTCTTGG - Intergenic
914047020 1:144101841-144101863 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
914047027 1:144101876-144101898 CTTGGCTGTCTTGGCTGGCTGGG + Intergenic
914047243 1:144102802-144102824 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
914047246 1:144102811-144102833 CTTGGCTGTCTGGGCTGGCTGGG + Intergenic
914047424 1:144103609-144103631 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
914047447 1:144103722-144103744 CTTGGCTGTCTTGGCTGGCTGGG + Intergenic
914047681 1:144104712-144104734 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
914047684 1:144104721-144104743 CTTGGCTGTCTGGGCTGGCTGGG + Intergenic
914047786 1:144105185-144105207 CTTGGCTTGCTTGGCTGTCTGGG + Intergenic
914047931 1:144105870-144105892 CTTGGCTGGCTTGGCTGTCTTGG + Intergenic
914048004 1:144106192-144106214 CTTGGGTCTCTTGGCTGGCTTGG + Intergenic
914091951 1:144508543-144508565 TTGTGGTTTCTGGGCTGTCTTGG + Intergenic
914131177 1:144859247-144859269 CTTGGGTCTCTTGGCTGGCTTGG - Intergenic
914306585 1:146425321-146425343 TTGTGGTTTCTGGGCTGTCTTGG - Intergenic
914595464 1:149147479-149147501 TTGTGGTTTCTGGGCTGTCTTGG + Intergenic
915101922 1:153507081-153507103 CTGTGCTCTCTGAGCCCTCTGGG - Intergenic
915293899 1:154906691-154906713 ATTTCCTCTGTGGGCTGGCTGGG - Intergenic
915558144 1:156671127-156671149 CTTTGGGCTCAGGGCTCTCTGGG + Exonic
916331868 1:163626466-163626488 CTTTACTCACGGGGCTTTCTGGG - Intergenic
916392172 1:164342594-164342616 CTTTGTTCTGTGGCCTGTCAAGG - Intergenic
916394037 1:164365782-164365804 CTTTGCTCTCAGGCCTGAGTAGG - Intergenic
916612806 1:166409823-166409845 CTTAGCTCGCTGGGCTCTGTGGG + Intergenic
917585962 1:176426437-176426459 CTTTGCTATTTGGGATCTCTGGG + Intergenic
918759620 1:188386469-188386491 CTTTGTTCTGTTGGCTATCTTGG - Intergenic
919713043 1:200747242-200747264 CTTTGCTGGCTCGCCTGTCTTGG - Intronic
920390581 1:205598010-205598032 CTCAGCTCTCAGGGCTGGCTTGG - Intronic
920809364 1:209267845-209267867 CTTTGCCCTCTGGGAGGCCTTGG - Intergenic
920821317 1:209384021-209384043 CTTTGCTCTGAGTTCTGTCTGGG + Intergenic
922214371 1:223508593-223508615 CCTTGCTCTCTGGAATGTGTTGG + Intergenic
922242008 1:223761652-223761674 CTCTGCTCTCTGGATTGTCCAGG - Intronic
923225462 1:231935112-231935134 GTCTGCTCTCTGGACTTTCTGGG + Intronic
923588639 1:235299051-235299073 CTTTGTTGTCTAGGCTGGCTTGG - Intronic
1063610025 10:7554078-7554100 CTGTGGTCTCTGGGCTTCCTGGG + Intergenic
1065222700 10:23512628-23512650 CTTTGGTCACTTAGCTGTCTCGG + Intergenic
1065886296 10:30080500-30080522 GATTGCTCTCTAGGCTGTGTAGG - Intronic
1065963646 10:30753884-30753906 ATTTGCTCCCTGGGCTGCCAAGG + Intergenic
1066281980 10:33926575-33926597 GTTTGGTCTCAGGGCTGACTTGG - Intergenic
1067703950 10:48593107-48593129 CTCTGCTCTCTGGGCCCTCCCGG + Intronic
1070630774 10:78082820-78082842 TCCTGCTCTTTGGGCTGTCTTGG - Intergenic
1070647735 10:78213105-78213127 CTCTGCTCTCTGGGTTGTCTGGG + Intergenic
1072551304 10:96479666-96479688 CTTTGCCCACTGGGCTGTAGGGG - Intronic
1072791597 10:98321894-98321916 TTTTGCTCTATGGGATGTCCTGG + Intergenic
1073071116 10:100793779-100793801 CCTTCCTCTCTGGCCTCTCTGGG + Intronic
1075187039 10:120271841-120271863 TTGTGCTCTCTGGGATGACTAGG + Intergenic
1075880866 10:125849598-125849620 CTCGACTCTCTGGGCTGTTTGGG + Intronic
1075997418 10:126889859-126889881 CTTTGCACTCTGAGACGTCTTGG + Intergenic
1076796909 10:132802904-132802926 CTTTGCTCTTTGGGCTGTAGGGG - Intergenic
1077034247 11:487245-487267 CCCTGCTCTCTAGGCTGTCGTGG + Intronic
1077270270 11:1674527-1674549 CTTTCCACTCTGGGTTGTCCTGG + Intergenic
1078070026 11:8102333-8102355 CCCAGCTCTCAGGGCTGTCTTGG + Exonic
1078120274 11:8500925-8500947 CTTTGCTCACTGAATTGTCTTGG - Intronic
1078431195 11:11290054-11290076 CAGTGGCCTCTGGGCTGTCTTGG - Intronic
1079005621 11:16789582-16789604 CCTTTCTCTCTGGCCTGTCAGGG - Intronic
1079264862 11:18921303-18921325 CTTTGCTTGCTGGGCTCTGTGGG - Intergenic
1079267037 11:18943450-18943472 CTTTGCTTGCTGGGCTCTGTGGG - Intergenic
1080823112 11:35825775-35825797 CTTTGCACTATTGGCTGTCTGGG - Intergenic
1080977145 11:37356790-37356812 CTTAGCTTTCTGGGCTCTGTGGG - Intergenic
1081034152 11:38120776-38120798 CTTTACTCTAAGGGATGTCTTGG + Intergenic
1083318376 11:61829788-61829810 TTTTGCTCTCTAAGCTGTGTAGG + Intronic
1083855753 11:65392287-65392309 CTCTGCTCTTTGGGCCATCTGGG - Intronic
1084456951 11:69273424-69273446 CTTGCCTGCCTGGGCTGTCTGGG - Intergenic
1085679131 11:78554218-78554240 CTTGGCTATCTGGGCTATCTTGG + Intronic
1085717865 11:78889181-78889203 CTCTGCTCTCTGTGCTGGCTGGG + Intronic
1086137458 11:83456347-83456369 CTTTACTTTCTGGGCTGAGTAGG + Intronic
1089222443 11:116885303-116885325 CTTTTCTTTGTGGTCTGTCTCGG - Intronic
1089318038 11:117605448-117605470 CTTTGCATTCTGGGCTGTGCTGG - Intronic
1092703240 12:11256564-11256586 CTTAGCTTTCTGGGCTCTGTGGG - Intergenic
1093912160 12:24760339-24760361 CTTTGTTCTCAGTGCTGTTTTGG + Intergenic
1096157534 12:49348896-49348918 CTATGCCCTCTGGGCTGTGGGGG + Exonic
1096757214 12:53809770-53809792 CTTTGATCTGTAGTCTGTCTTGG + Intergenic
1096870652 12:54590125-54590147 CTTTGCTCTCTGGTGTGGCAGGG + Intergenic
1096877837 12:54644432-54644454 CTGTGCTCTCTGGGAAGGCTGGG + Intergenic
1101316760 12:103635846-103635868 ATCTGCTCTCTGGGGTGGCTGGG - Intronic
1101395490 12:104343281-104343303 CTTTGGGGTCTGGGCTGCCTGGG - Intronic
1104139862 12:125977247-125977269 CTTGGTTCTGCGGGCTGTCTGGG + Intergenic
1104980643 12:132571817-132571839 CTGTGCCCTCAGGCCTGTCTGGG - Intronic
1105964551 13:25372395-25372417 CTGGGCTCCCTGGGCTCTCTGGG + Intronic
1108438382 13:50424086-50424108 CTTGGCTCTCTGGGATGTGGGGG + Intronic
1110809154 13:79792022-79792044 CTTTCCACACTGGGCTGCCTGGG + Intergenic
1113749580 13:112767988-112768010 CACTGCTCTCTGGCCTGGCTTGG + Intronic
1116371747 14:44143463-44143485 CTTTGCTCTCTTTGCTTTCTTGG + Intergenic
1117035831 14:51727596-51727618 CTGTGGTTTCTGGGCTGTATGGG - Intronic
1117325153 14:54662206-54662228 CATTGATCTCTGGGCTGACTAGG - Intronic
1118332393 14:64824561-64824583 CTTTGCTCTCTTGGTTGTGAAGG - Intronic
1122783848 14:104154987-104155009 CTTTGAACTCAGGGCTGTCCAGG + Intronic
1123416929 15:20101559-20101581 CTTGGCTTGCTTGGCTGTCTGGG + Intergenic
1123417263 15:20102957-20102979 CTTTGCTCTCTTGGCTGGCTTGG + Intergenic
1123417296 15:20103082-20103104 CTTGGCTGGCTGGGCTGGCTGGG + Intergenic
1123417467 15:20103836-20103858 CTTTGCTCTCTTGGCTGGCTTGG + Intergenic
1123417660 15:20104625-20104647 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
1123417764 15:20105051-20105073 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
1123447518 15:20341524-20341546 CTTTGCTGGCTTGGCTGTTTGGG - Intergenic
1123447565 15:20341717-20341739 CTTGGCTGGCTTGGCTGTCTTGG - Intergenic
1123447782 15:20342701-20342723 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
1123447809 15:20342840-20342862 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
1123447947 15:20343478-20343500 CTTGGCTGGCTGGGCTGGCTTGG - Intergenic
1123526268 15:21108665-21108687 CTTGGCTTGCTTGGCTGTCTGGG + Intergenic
1123526539 15:21109811-21109833 CTTTGCTCTCTTGGCTGGCTTGG + Intergenic
1123526571 15:21109936-21109958 CTTGGCTGGCTGGGCTGGCTGGG + Intergenic
1123526842 15:21111114-21111136 CTTTGCTCTCTTGGCTGGCTTGG + Intergenic
1123527034 15:21111903-21111925 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
1123527056 15:21112000-21112022 CTTCGCTGGCTTGGCTGTCTGGG + Intergenic
1123527062 15:21112026-21112048 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
1124514527 15:30355193-30355215 CTTTGCTCACTGGCCTGGCTGGG - Intergenic
1124728393 15:32175572-32175594 CTTTGCTCACTGGCCTGGCTGGG + Intergenic
1127024480 15:54788417-54788439 CTTTGCTCTTTGGGAAGACTGGG - Intergenic
1127626074 15:60781483-60781505 CTTAACTCTGTGGGCTGGCTGGG - Intronic
1129820405 15:78597734-78597756 CTTTGCTTTCTGAATTGTCTAGG - Intronic
1130892111 15:88142057-88142079 ATTTGCTCAGTGGGCTGTCTAGG - Intronic
1132042385 15:98536189-98536211 CTTTGTTCTCTGGCCTCTCAAGG - Intergenic
1132303146 15:100788787-100788809 CTTTACTGTGTGGGCTTTCTGGG + Intergenic
1133291837 16:4727567-4727589 CTTTGCTGTGGGGGCTGTCCTGG - Intronic
1134569696 16:15280713-15280735 CTGGGCTCTCTGGGCCCTCTGGG - Intergenic
1134732683 16:16475336-16475358 CTGGGCTCTCTGGGCCCTCTGGG + Intergenic
1134934757 16:18236632-18236654 CTGGGCTCTCTGGGCCCTCTGGG - Intergenic
1135637482 16:24090976-24090998 CTTTTCCCTATGGGCTGTCTGGG + Intronic
1135637573 16:24091895-24091917 CTTCTCTCTATGGGCTGTCTGGG + Intronic
1136040566 16:27575622-27575644 CTTCCATCTCTGGGCTGTCCCGG + Intronic
1136716107 16:32285604-32285626 CTTGGCTGGCTGGGCTGCCTGGG + Intergenic
1136716136 16:32285716-32285738 CTTGGCTGGCTGGGCTGCCTGGG + Intergenic
1136716214 16:32286075-32286097 CTTGGCTGTCTTGGCTGTCTTGG + Intergenic
1136822826 16:33336415-33336437 CTTGGCTGTCTTGGCTGGCTTGG + Intergenic
1136822953 16:33336957-33336979 CTTGGCTGTCTTGGCTGGCTTGG + Intergenic
1136823071 16:33337464-33337486 CTTGGCTGTCTTGGCTGGCTTGG + Intergenic
1136823202 16:33338047-33338069 CTTGGCTGTCTTGGCTGGCTTGG + Intergenic
1136823370 16:33338759-33338781 CTTGGCTGTCTTGGCTGGCTTGG + Intergenic
1136823658 16:33339995-33340017 CTTTGCTGGCTTGGCTGGCTTGG + Intergenic
1136834524 16:33492007-33492029 CTTGGCTGGCTGGGCTGCCTGGG + Intergenic
1136834601 16:33492349-33492371 CTTGGCTGTCTTGGCTGTCTTGG + Intergenic
1136931901 16:34426130-34426152 CTTTGTTCTCTGGCCTCTCCAGG + Intergenic
1136972671 16:34985685-34985707 CTTTGTTCTCTGGCCTCTCCAGG - Intergenic
1138585891 16:57970290-57970312 CCTGGCTCTCGGGGCTGCCTGGG - Intronic
1140056064 16:71526722-71526744 ATCTGCTCTCTGGGCTCTTTTGG - Intronic
1140069228 16:71634716-71634738 CTTTGCCCTGGGGGCTGTCCTGG + Intronic
1140296201 16:73711956-73711978 CTTTCCTGCCTGGGCTGTTTGGG - Intergenic
1140527020 16:75631524-75631546 CTTGGCCCTCTGGGCCATCTGGG + Exonic
1140984697 16:80147003-80147025 CCTTTCTATCTGTGCTGTCTGGG + Intergenic
1141203177 16:81913073-81913095 CTGGGCTGCCTGGGCTGTCTGGG - Intronic
1141297510 16:82783590-82783612 TTTTCCTCCCTGAGCTGTCTTGG + Intronic
1203010202 16_KI270728v1_random:231683-231705 CTTGGCTGTCTTGGCTGTCTTGG - Intergenic
1203010277 16_KI270728v1_random:232025-232047 CTTGGCTGGCTGGGCTGCCTGGG - Intergenic
1203010467 16_KI270728v1_random:232833-232855 CTTGGCTGGCTGGGCTGCCTGGG - Intergenic
1203138936 16_KI270728v1_random:1747516-1747538 CTTGGCTTGCTTGGCTGTCTCGG - Intergenic
1203138994 16_KI270728v1_random:1747793-1747815 CTTGGCTGGCTTGGCTGTCTTGG - Intergenic
1203139146 16_KI270728v1_random:1748438-1748460 CTTTGCTGGCTTGGCTGGCTGGG - Intergenic
1203144758 16_KI270728v1_random:1792620-1792642 CTTGGCTGTCTTGGCTGGCTTGG + Intergenic
1143987174 17:10924740-10924762 CCTTGCTGTCTGGGGTGACTGGG + Intergenic
1144689659 17:17252342-17252364 CTTTGGTGTGTGGGCTGTCCAGG + Intronic
1144689665 17:17252377-17252399 CTTTGGTGTGTGGGCTGTCCTGG + Intronic
1144689671 17:17252412-17252434 CTTTGGTGTGTGGGCTGTCCTGG + Intronic
1144689677 17:17252447-17252469 CTTTGGTGTGTGGGCTGTCCTGG + Intronic
1145373110 17:22323524-22323546 CACTGGTCTGTGGGCTGTCTTGG - Intergenic
1145959953 17:28881461-28881483 CTCTGCTCTGGGGGCTGTCGGGG + Intronic
1146937233 17:36819502-36819524 CTTTGCTCTCTGGGAGGGCAGGG - Intergenic
1147702393 17:42404251-42404273 CTTTCCTCTTTGGGCAGTTTTGG + Exonic
1147951074 17:44108408-44108430 CTTTGCTCTCTGGGCTGTCTTGG - Intronic
1148482325 17:47968106-47968128 CTATGTGCTCGGGGCTGTCTGGG - Intronic
1148483156 17:47973601-47973623 CTTCGCTCTCTGGCATGTCCTGG - Exonic
1148796406 17:50199390-50199412 CGTTGCACTCTGGGCTGTGGGGG - Intronic
1149583385 17:57767514-57767536 CTGTGCTTTCTCTGCTGTCTTGG - Intergenic
1149718852 17:58822092-58822114 CATCACTCTCTGGGCTATCTTGG - Intronic
1150335593 17:64328276-64328298 CTTTGCTCCCTGGGCAGTGCGGG - Intronic
1150457589 17:65319945-65319967 CTTTTCTCTCTGGGGTGACATGG + Intergenic
1150610336 17:66728220-66728242 CTCTGATCTCAGGGCTGGCTTGG + Intronic
1150655034 17:67033718-67033740 CCTTGCTCTCTTGGCTGCCCAGG - Intergenic
1153085328 18:1279026-1279048 CTTTGTTCTCTGGCCCCTCTAGG - Intergenic
1153141117 18:1973511-1973533 CTTTGTTCTCTGGGATGCTTTGG + Intergenic
1153522078 18:5962860-5962882 CTTTGCTGTGAGGGCTGTCCTGG + Intronic
1153810410 18:8747339-8747361 CTTTGCTCCCTGGCCTGTGGTGG + Intronic
1154001787 18:10487837-10487859 CTCTCTTCTCTGGCCTGTCTGGG - Exonic
1154392753 18:13955034-13955056 CTTTGCTCTCTGGCCTCTCAAGG - Intergenic
1155001611 18:21693061-21693083 CTGTTGTCTCTGGGCTCTCTTGG + Intronic
1155669015 18:28346936-28346958 CTTTTCCCTCTGGGATTTCTGGG - Intergenic
1160480511 18:79235901-79235923 CTTTGATCTCTGGGTTCTTTGGG + Intronic
1160985778 19:1837862-1837884 CTCTGCTCTCTGGGGCGTCCTGG + Intronic
1161563553 19:4986884-4986906 CTTTGCCCTCACGGCTGACTAGG - Intronic
1163723693 19:18910626-18910648 CGCTGCGCCCTGGGCTGTCTTGG + Intronic
1165376287 19:35444904-35444926 CTTCTCTCTCTTTGCTGTCTGGG - Intronic
1165903644 19:39180267-39180289 CTGTGCTCTCTGCGATGTATTGG + Intronic
1165938978 19:39405785-39405807 CTTATCTGTCTGGGCTGTTTAGG + Intergenic
1168075264 19:53978028-53978050 CTTCTCTCTCTGGGCTGCTTGGG - Intronic
1202686615 1_KI270712v1_random:55459-55481 CTTGGCTGGCTTGGCTGTCTTGG + Intergenic
1202686688 1_KI270712v1_random:55781-55803 CTTGGGTCTCTTGGCTGGCTTGG + Intergenic
1202686861 1_KI270712v1_random:56545-56567 CTTGGCTGTCTGGGTTGGCTGGG + Intergenic
1202687203 1_KI270712v1_random:58040-58062 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
1202687206 1_KI270712v1_random:58049-58071 CTTGGCTGTCTGGGCTGGCTGGG + Intergenic
1202687394 1_KI270712v1_random:58794-58816 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
1202687416 1_KI270712v1_random:58907-58929 CTTGGCTGTCTTGGCTGGCTGGG + Intergenic
1202687427 1_KI270712v1_random:58959-58981 CTTGGCTGGCTTGGCTGTCTTGG + Intergenic
1202687430 1_KI270712v1_random:58968-58990 CTTGGCTGTCTTGGCTGGCTGGG + Intergenic
1202687450 1_KI270712v1_random:59055-59077 CTTGGCTGTCTTGGCTGGCTGGG + Intergenic
925604009 2:5639790-5639812 TTGTGGTTTCTGGGCTGTCTTGG - Intergenic
925808129 2:7672592-7672614 CTTTCCTCCCTGGGCTGCGTAGG - Intergenic
926180034 2:10634373-10634395 TGTTGCTCACTCGGCTGTCTAGG - Intronic
926332480 2:11836982-11837004 CTTTCCTCTCTGGGGTGGTTTGG + Intergenic
926533537 2:14082337-14082359 CTTTGCTTGCTGGGCTCTGTGGG - Intergenic
926586763 2:14695136-14695158 TTTTGCTCTCTGAGCTGATTGGG + Intergenic
927355425 2:22167543-22167565 TTTTGCACTTTGGGCTCTCTGGG + Intergenic
928051384 2:28000019-28000041 CTCTGCTCTCTGTACTGTCTTGG - Intronic
929158071 2:38805694-38805716 CTTCTCTTTCTGTGCTGTCTTGG - Intronic
930264739 2:49186407-49186429 CTTAGCTTGCTGGGCTCTCTGGG + Intergenic
931669098 2:64630780-64630802 CCTTGGCCACTGGGCTGTCTTGG - Intergenic
932003415 2:67905485-67905507 CTTTGTTCTTTGGGATGTCCTGG - Intergenic
932431636 2:71679087-71679109 CTTGGCTGTCTTGGCTGGCTTGG - Exonic
932497872 2:72155728-72155750 CTCTGCTCTCTGAGGTCTCTGGG - Intergenic
933750721 2:85600955-85600977 CTTTGCTTGAGGGGCTGTCTGGG + Intronic
933958893 2:87396486-87396508 CTTGGGTCTCTTGGCTGCCTGGG - Intergenic
933958983 2:87396879-87396901 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
933959079 2:87397313-87397335 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
933959176 2:87397742-87397764 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
933959525 2:87399209-87399231 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
933959536 2:87399261-87399283 CTTGGCTGGCTTGGCTGTCTTGG - Intergenic
933960740 2:87406719-87406741 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
933960952 2:87407671-87407693 CTTGGGTCTCTTGGCTGCCTGGG - Intergenic
933961438 2:87409875-87409897 CTTGGGTCTCTTGGCTGCCTGGG - Intergenic
933962174 2:87413344-87413366 CTTGGGTCTCTTGGCTGCCTGGG - Intergenic
933962613 2:87415262-87415284 CTTGGCTGTCTGGGCTGGCTGGG - Intergenic
933962971 2:87416927-87416949 CTTGGCTGGCTGGGCTGGCTGGG - Intergenic
933963128 2:87417573-87417595 CTTGGCTGTCTGGGCTGGCTGGG - Intergenic
933963239 2:87418063-87418085 CTTAGCTGGCTGGGCTGGCTGGG - Intergenic
933963696 2:87420003-87420025 CTTGGGTCTCTTGGCTGCCTGGG - Intergenic
933963972 2:87421275-87421297 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
933964173 2:87422183-87422205 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
933964687 2:87424648-87424670 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
933964958 2:87425866-87425888 CTTGGCTGTCTTGGCTGGCTTGG - Intergenic
933965009 2:87426095-87426117 CTTGGGTCTCTTGGCTGCCTGGG - Intergenic
933965484 2:87428293-87428315 CTTGGCTCTCTTGGCTGGCTGGG - Intergenic
933965588 2:87428738-87428760 CTTGGCTGACTTGGCTGTCTGGG - Intergenic
933965727 2:87429314-87429336 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
933966101 2:87430952-87430974 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
934243264 2:90289576-90289598 CTTGGGTCTCTTGGCTGCCTGGG - Intergenic
934243434 2:90290369-90290391 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
934243767 2:90291849-90291871 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
934243901 2:90292433-90292455 CTTGGCTGGCTTGGCTGTCTGGG - Intergenic
934244092 2:90293253-90293275 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
934244103 2:90293305-90293327 CTTGGCTGGCTTGGCTGTCTTGG - Intergenic
934244795 2:90297325-90297347 CTTGGCTGTCTGGGCTGTCTGGG - Intergenic
934264052 2:91500099-91500121 CTTGGCTGTCTGGGCTGGCTGGG + Intergenic
934264748 2:91504126-91504148 CTTGGCTGGCTTGGCTGTCTTGG + Intergenic
934264759 2:91504178-91504200 CTTGGCTGTCTTGGCTGGCTGGG + Intergenic
934265009 2:91505251-91505273 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934265297 2:91506528-91506550 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934265449 2:91507201-91507223 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934265535 2:91507580-91507602 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934265686 2:91508249-91508271 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934265952 2:91509411-91509433 CTTCGCTGGCTTGGCTGTCTGGG + Intergenic
934266047 2:91509851-91509873 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934266226 2:91510700-91510722 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934266377 2:91511361-91511383 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934266720 2:91512894-91512916 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934266872 2:91513567-91513589 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934266958 2:91513945-91513967 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934267109 2:91514614-91514636 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934267309 2:91515504-91515526 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934267543 2:91516572-91516594 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934267726 2:91517412-91517434 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934268045 2:91518804-91518826 CTTTGCTGCCTTGGCTGGCTTGG + Intergenic
934268310 2:91519980-91520002 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934268460 2:91520646-91520668 CTTTGCTGGCTTGGCTGGCTTGG + Intergenic
934268497 2:91520800-91520822 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934268693 2:91521691-91521713 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934268942 2:91522799-91522821 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934269192 2:91523917-91523939 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934269439 2:91525008-91525030 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934269592 2:91525677-91525699 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934269692 2:91526124-91526146 CTTGGCTGGCTTGGCTGTCTGGG + Intergenic
934269735 2:91526309-91526331 CTTGGCTGGCTGGGCTGGCTGGG + Intergenic
934269951 2:91527283-91527305 CTTGGCTTGCTTGGCTGTCTGGG + Intergenic
934270087 2:91527884-91527906 CTTTGCTGGCTTGGCTGGCTGGG + Intergenic
934270142 2:91528140-91528162 CTTGGGTCTCTTGGCTGCCTGGG + Intergenic
935064425 2:99635806-99635828 ATTTGTCCCCTGGGCTGTCTGGG + Intronic
935734682 2:106097259-106097281 CTTGGGTCTCAGGGCTGTCTAGG - Intronic
936851533 2:116904968-116904990 CTTTGCTGTCTGGCTTGTTTTGG + Intergenic
936982161 2:118275034-118275056 CGAGGCTCTCTGGGCTCTCTGGG - Intergenic
937096588 2:119239580-119239602 CCTTGCACTCTGGGCTATCTTGG + Intronic
937603898 2:123773717-123773739 GAGTGGTCTCTGGGCTGTCTTGG - Intergenic
938118719 2:128619473-128619495 CTGTGGGCTCTGGGCTGTGTGGG + Intergenic
938291680 2:130153986-130154008 CATTGCTCTTGGGGCTGCCTGGG - Intronic
938380637 2:130834587-130834609 CTTTCCTCGCTGGGCAGCCTGGG - Intergenic
938464871 2:131518977-131518999 CATTGCTCTTGGGGCTGCCTGGG + Intergenic
938568119 2:132538983-132539005 CTTAGCTCACTGGGCTCTGTGGG + Intronic
939089133 2:137758049-137758071 CTTTGTTCTCTGGCCTCTCGAGG - Intergenic
941822703 2:169858414-169858436 CTATGTTTTCTAGGCTGTCTTGG + Intronic
942329781 2:174810446-174810468 CTTTGCTCTCTGGGGTCCATAGG + Intronic
943343221 2:186706230-186706252 CTTTGGTCTCTAAGCTGTTTTGG + Intronic
944531127 2:200668869-200668891 CATTCCTCTCTTGGCTGTTTGGG + Intronic
944946023 2:204686408-204686430 CTTTGATTTATGGGCTGTCCAGG - Intronic
945044205 2:205767514-205767536 CTCTGCTCTCTCTGCTTTCTCGG - Intronic
945098332 2:206240221-206240243 CTTTGGTCTGTGGTCCGTCTTGG + Intergenic
946516123 2:220412975-220412997 CTCTGCTCTCTTCCCTGTCTGGG - Intergenic
947002117 2:225468445-225468467 CCTTTCTCACTGGCCTGTCTTGG - Intronic
1170349884 20:15427329-15427351 CTTAGCTCTCAGTTCTGTCTTGG - Intronic
1171937273 20:31286679-31286701 CTTCGCTCTCTGGCATGTCCTGG + Intergenic
1172948471 20:38706451-38706473 CTCTGCTGTGGGGGCTGTCTTGG - Intergenic
1173715395 20:45199386-45199408 CTTTGCTACTTGGGCAGTCTGGG + Intergenic
1174343601 20:49913950-49913972 CTTCTGTCGCTGGGCTGTCTCGG - Intronic
1174458944 20:50669406-50669428 CTTTCCTCTTTGGCCTTTCTGGG + Intronic
1175170068 20:57074162-57074184 ATTTAATCTCTGTGCTGTCTTGG - Intergenic
1175290481 20:57871865-57871887 TTTTGCTGTCTGGCCTCTCTGGG + Intergenic
1175491039 20:59381441-59381463 ATGTGCTCCCTGGGCTGCCTTGG + Intergenic
1175817683 20:61891897-61891919 CCTTGCTCTCAGGCCTGTCCAGG + Intronic
1175910451 20:62402806-62402828 CATTGCCCTCTGGGCTGCCATGG + Intronic
1177430434 21:20985691-20985713 CTTTGCACTCAGGGATGCCTGGG + Intergenic
1178504526 21:33152018-33152040 CTTTGCTCTCTTGGCTCTCTGGG - Intergenic
1179469883 21:41603453-41603475 CTGGGGTCTCTTGGCTGTCTTGG + Intergenic
1180553869 22:16560758-16560780 TTTGGCTCTCTTGGCTGTCTTGG - Intergenic
1180554909 22:16565626-16565648 CTTGGCTGTCTTGGCTGCCTTGG - Intergenic
1180554975 22:16565902-16565924 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
1180555125 22:16566533-16566555 CTTGGCTGTCTTGGCTGGCTTGG - Intergenic
1180555313 22:16567343-16567365 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
1180555326 22:16567404-16567426 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
1180555339 22:16567465-16567487 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
1180555473 22:16568018-16568040 CTTGGCTGTCTTGGCTGGCTGGG - Intergenic
1181288472 22:21772235-21772257 CTTGGCTCTCTGGTGTCTCTGGG - Intronic
1181899847 22:26144632-26144654 CTTGGCTCCCTGGCATGTCTTGG - Intergenic
1182737998 22:32544856-32544878 CTCTGTGCTCAGGGCTGTCTAGG - Intronic
1182950542 22:34371306-34371328 ATTTGGTCTCTGGTCTGTGTCGG - Intergenic
1183283996 22:36951446-36951468 CTTTGTTCTCTCGGCTGCCAAGG - Intergenic
1184221205 22:43101177-43101199 CTCTGCTCTCAGGGCACTCTGGG - Intergenic
1184232619 22:43166788-43166810 CTCTCCTCTCTGTGTTGTCTGGG - Exonic
952840338 3:37640721-37640743 CTTTCCTCCCTGGGCTCTCTGGG + Intronic
953847455 3:46439093-46439115 CTTTTGACTCTGGGCTTTCTGGG - Intronic
954111324 3:48434986-48435008 CTTTTCTCTCCGGGCTGGCTTGG + Exonic
954316444 3:49804114-49804136 CTCTGTTCTCTGGGCTGGCCTGG + Intronic
954433387 3:50483281-50483303 CTGTGCTAACTGGGCTGCCTTGG - Intronic
955468493 3:59261558-59261580 ATTTGCTCTCTGGTTTGTCAGGG - Intergenic
956399914 3:68866455-68866477 CTTTGCTCCCTGGCTTGTTTTGG - Intronic
956785272 3:72637247-72637269 CATTGCTCTGGGGGCTGGCTAGG - Intergenic
960378136 3:116928207-116928229 CTTAGCTTTCTGGGCTCTGTTGG + Intronic
960575242 3:119222712-119222734 CTGTGCTCTCTGGCATGTCTTGG + Intronic
961998261 3:131269189-131269211 CTTAGCTTTCTGGGCTCTGTGGG + Intronic
962471641 3:135714395-135714417 GTTTGCTGTCTGTGCTGCCTGGG - Intergenic
965452556 3:168856909-168856931 CTTTTCTGTCTGGCCTGTTTGGG + Intergenic
966493713 3:180556510-180556532 CTTTGCTTTCTGGGCTCCATGGG - Intergenic
967678428 3:192329130-192329152 CTTTGCTATCTGGGCCATCTGGG - Intronic
968130459 3:196190090-196190112 CTTTACTCTCTGGCCTGGATTGG + Intergenic
968692416 4:2000224-2000246 GTTTGCTCTCTTGCCTCTCTGGG - Intronic
972107887 4:35514329-35514351 CTTGGTTCTGTGGGCTGTATAGG - Intergenic
973817023 4:54628742-54628764 CTTTGAACCCTGGGCTGTCTGGG + Intergenic
975687951 4:76936471-76936493 CCTTGCTCTTTGCTCTGTCTTGG + Intergenic
976200580 4:82574199-82574221 CTTTCCCCTTTGGACTGTCTTGG + Intergenic
976224673 4:82786354-82786376 CTTGGCTATTTGGGCTGTGTTGG - Intronic
977005880 4:91569301-91569323 CTTGACACTCTGGGCTGCCTGGG + Intronic
977026507 4:91825343-91825365 CTTTTCTCTCTCCTCTGTCTAGG + Intergenic
977223498 4:94366867-94366889 CTTTGTTGCCTGTGCTGTCTTGG + Intergenic
979158482 4:117429022-117429044 CTTTGCTCTCTGGCTTCTCAAGG + Intergenic
981427890 4:144624777-144624799 ATTTCTTGTCTGGGCTGTCTTGG - Intergenic
988628031 5:32898786-32898808 CTTAGCTTTCTGGGCTCTGTGGG + Intergenic
990168050 5:53017416-53017438 CTTTGTTCTCTGGTCTTTCAAGG + Intronic
990339488 5:54808435-54808457 CTGCTCTCTCTGGGCTGTGTGGG + Intergenic
991629838 5:68645383-68645405 CTTTGCTCTCCTGTTTGTCTGGG + Intergenic
992090446 5:73311835-73311857 CTTTTATTTCTGGCCTGTCTTGG + Intergenic
993605980 5:89991189-89991211 CTTTCCACTCTGGGCTCTCTAGG - Intergenic
995567937 5:113451388-113451410 CTTTCCTCTCAGGGTTGTCATGG - Intronic
997395168 5:133553927-133553949 CTTAGTTCTCAGGGCTCTCTGGG - Intronic
998014997 5:138724888-138724910 CCTTGCCTTCTGGGCTTTCTGGG + Intronic
998622777 5:143812698-143812720 GTCTGGTCTCTGGGCTGCCTTGG - Intronic
999317967 5:150596336-150596358 TTTTGCTCTCTAGGCTCTCTAGG + Intergenic
999388091 5:151169632-151169654 CTTTGCTCACTGTGCTGCTTTGG + Intergenic
1000103860 5:158040346-158040368 CTTTGCTATCTTGGCTGTCAGGG + Intergenic
1000655287 5:163870849-163870871 CTTTGTTCTCTTGCTTGTCTTGG - Intergenic
1000810865 5:165859223-165859245 ATTTGCTTTCTGGCCTGTCCTGG + Intergenic
1003150372 6:3542933-3542955 CTGTGCTCTATGGTCAGTCTGGG - Intergenic
1004808990 6:19238913-19238935 CTTAGCTTGCTGGGCTCTCTGGG - Intergenic
1005831956 6:29678281-29678303 CTTTTCTCTCTGGCCTGCCCAGG + Intronic
1006423915 6:33952013-33952035 CTTAGCACTTTGGGATGTCTTGG + Intergenic
1007071094 6:39038760-39038782 CTCTGCTGTCTTGCCTGTCTGGG - Intergenic
1007630734 6:43271925-43271947 TGTTGCCCTCTGGGCTGTTTTGG + Intronic
1008551962 6:52641212-52641234 CTTTGCTCTCTGCTCTTTATTGG - Intergenic
1009332818 6:62445370-62445392 CTTTGTTCTCTGGTCTGTTTAGG + Intergenic
1009598929 6:65772448-65772470 CTTTGTTCTCTGGCCTCTCGAGG - Intergenic
1011527128 6:88277041-88277063 CTGTGCTCGCTGGGCTGACGCGG + Intergenic
1011970293 6:93213600-93213622 CTATGCTGTTTGGGCTGTGTGGG - Intergenic
1012885042 6:104836208-104836230 CTGTGCTCTCTTGGCTGGATTGG - Intronic
1014111390 6:117621866-117621888 CTTTGTTCCTTGTGCTGTCTTGG + Intergenic
1014584592 6:123182658-123182680 CTTAGCTCACTGGGCTCTGTGGG - Intergenic
1015815851 6:137209894-137209916 CTCTGCTCTCTGGGGTGTGCAGG + Intronic
1016697585 6:147015957-147015979 CTTTGGTCTCTGGCTTGGCTGGG - Intergenic
1017537681 6:155365769-155365791 CTCTGCTTTCTGGTGTGTCTTGG + Intergenic
1018440297 6:163806231-163806253 CATTGCTCCCAGGGCTGTCCTGG + Intergenic
1018782381 6:167079972-167079994 CTGTGCTTTTTGGTCTGTCTTGG + Intergenic
1018908614 6:168089219-168089241 CTTTGCTCCCTCAGCTGTATAGG + Intergenic
1019916950 7:4139841-4139863 CTGCGCTGTCTGGGCTGTCTTGG + Intronic
1020608609 7:10367658-10367680 CTTAGCTCGCTGGGCTCTGTGGG + Intergenic
1024047165 7:45592678-45592700 CTATGCTCTCCGGGCGGCCTAGG + Intronic
1024085824 7:45890558-45890580 CCGTGCTCTCTGGGCTTTCAGGG - Exonic
1024570649 7:50720498-50720520 CTCTGCTCTCTGGGCCTTTTTGG - Intronic
1024587561 7:50854883-50854905 CTTTGCATTTTGGGGTGTCTGGG + Intergenic
1026401812 7:70021521-70021543 CTTTGCTCTATGTGTTTTCTAGG + Intronic
1028485322 7:91350996-91351018 CTCTGTTCTCAGGGGTGTCTGGG + Intergenic
1029834141 7:103291461-103291483 CTGTGCTCACTGGTCTTTCTGGG - Intergenic
1031195107 7:118603346-118603368 CTTTGCTCTCTGAGGCTTCTGGG - Intergenic
1032831567 7:135632524-135632546 TTTTTTTGTCTGGGCTGTCTCGG + Intronic
1035232240 7:157472344-157472366 CTTTGCCCTCGGGGCAGCCTGGG - Intergenic
1035275896 7:157747743-157747765 CTCTGAGCTCTGGGCTGTCCGGG + Intronic
1035378677 7:158424658-158424680 CTCTGCTCTCAGGGCTCTCAGGG - Intronic
1035415268 7:158678381-158678403 CTTAGCACTGTGGGCTGTGTAGG - Intronic
1036007717 8:4686212-4686234 CTTTTCTTTCGGAGCTGTCTTGG + Intronic
1036091237 8:5667986-5668008 ATATGCTCTCTGGGCTGTACTGG + Intergenic
1040060299 8:43097881-43097903 CTTTGCTCACTGGCCTATCAAGG - Intronic
1041454824 8:58047330-58047352 CTTTGCTCTGAGGTCTGTGTTGG + Intronic
1042373918 8:68026148-68026170 CTATGCTTTCTGAGGTGTCTGGG + Intronic
1043792809 8:84494374-84494396 CTTTGCTATGTGGGCTTTTTGGG + Intronic
1044739770 8:95314354-95314376 CTTTGCTCACTGTGATGTCTTGG + Intergenic
1045325685 8:101116168-101116190 CTTTGCTGTGGGGGCTGTCCTGG - Intergenic
1046780503 8:118209885-118209907 CTTGGCTCTCTGGGCTCTCCAGG - Intronic
1048754606 8:137723776-137723798 CTTTGATCTATTGGCTGTTTAGG - Intergenic
1051842724 9:21416443-21416465 CTTTGGTTTCTGGGCTCTTTTGG + Intronic
1052524520 9:29597075-29597097 GTTTCCTCTCTGGGCTAGCTTGG + Intergenic
1055131408 9:72779101-72779123 CTTTGTTCTCTGGCCTCTCAAGG - Intronic
1057277807 9:93685384-93685406 CTCTGCTCCCTGGGCTGGCAGGG + Intergenic
1059510460 9:114840092-114840114 CTTTGCTCTCTGGCCCCTCTAGG - Intergenic
1060001943 9:119966816-119966838 CTTTACACTCTGGCTTGTCTGGG - Intergenic
1060535560 9:124384350-124384372 CTCTGGGCTTTGGGCTGTCTAGG - Intronic
1061092928 9:128436887-128436909 CTCTGCTCTCTGGGCAGTAGTGG - Exonic
1061974212 9:134060210-134060232 GTTTCCTCTCTGGGCAGTTTCGG - Intronic
1189358131 X:40327082-40327104 TTTTGCTCTCAGAGCTGCCTGGG + Intergenic
1189729132 X:44000575-44000597 CATTGTTCTCTTGGCTTTCTTGG - Intergenic
1192266648 X:69543363-69543385 CTTTGCTCTCTGGGGCTTCCTGG + Intergenic
1192701793 X:73482246-73482268 CTTTGCTTACTGGGCTCTGTGGG + Intergenic
1193079336 X:77390423-77390445 CTTAGCTTGCTGGGCTCTCTGGG - Intergenic
1193276051 X:79589649-79589671 CTTTGCTTTCTGGTCCCTCTAGG + Intergenic
1193612125 X:83645074-83645096 ATTTAGTCTGTGGGCTGTCTTGG - Intergenic
1194517867 X:94879338-94879360 CTTTGCTATATGGGCTATTTTGG - Intergenic
1195165207 X:102213186-102213208 CTTTGCTCTCTGGTATGGCAGGG + Intergenic
1195193651 X:102473905-102473927 CTTTGCTCTCTGGTATGGCAGGG - Intergenic
1195338401 X:103879449-103879471 GTTTAGTCTGTGGGCTGTCTTGG + Intergenic
1195349470 X:103983175-103983197 CTTTTCTCTTTGAGCCGTCTGGG + Intergenic
1195357973 X:104055664-104055686 CTTTTCTCTTTGAGCCGTCTGGG - Intergenic
1195610595 X:106862949-106862971 CTTTGTTCTCTGGGCCCTCGGGG + Intronic
1196211257 X:112998223-112998245 CTTTGCCCTCTAAGCTGCCTTGG + Intergenic
1198518983 X:137433596-137433618 CTTAGCTTGCTGGGCTCTCTGGG - Intergenic
1199548523 X:149032997-149033019 CTTTTCTCTCTGACCTGTCCTGG - Intergenic
1202028236 Y:20547369-20547391 GTTTAGTCTGTGGGCTGTCTTGG + Intergenic