ID: 1147951076

View in Genome Browser
Species Human (GRCh38)
Location 17:44108417-44108439
Sequence AGGGATAGCCTTTGCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147951076_1147951086 18 Left 1147951076 17:44108417-44108439 CCCAGAGAGCAAAGGCTATCCCT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1147951086 17:44108458-44108480 TGCTGCTGGAGGTGGCAGGCAGG 0: 1
1: 0
2: 8
3: 97
4: 706
1147951076_1147951085 14 Left 1147951076 17:44108417-44108439 CCCAGAGAGCAAAGGCTATCCCT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1147951085 17:44108454-44108476 AAGATGCTGCTGGAGGTGGCAGG 0: 1
1: 0
2: 1
3: 51
4: 418
1147951076_1147951083 7 Left 1147951076 17:44108417-44108439 CCCAGAGAGCAAAGGCTATCCCT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1147951083 17:44108447-44108469 GGTTCTAAAGATGCTGCTGGAGG 0: 1
1: 0
2: 0
3: 19
4: 196
1147951076_1147951082 4 Left 1147951076 17:44108417-44108439 CCCAGAGAGCAAAGGCTATCCCT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
1147951076_1147951084 10 Left 1147951076 17:44108417-44108439 CCCAGAGAGCAAAGGCTATCCCT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1147951084 17:44108450-44108472 TCTAAAGATGCTGCTGGAGGTGG 0: 1
1: 0
2: 1
3: 17
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147951076 Original CRISPR AGGGATAGCCTTTGCTCTCT GGG (reversed) Intronic
900200332 1:1401966-1401988 AGGGATGGCCCTGTCTCTCTGGG - Exonic
901657251 1:10776596-10776618 AGGGAGAGCCTTTGCAGGCTCGG - Intronic
902234019 1:15046427-15046449 AAGGATTGGCTTTGCTGTCTCGG + Intronic
903535077 1:24061378-24061400 AGGGATAAGCTTTGCTCCCAGGG - Intronic
903961492 1:27060599-27060621 AGGGATAGGAATTGCTCACTCGG + Intergenic
904838422 1:33354601-33354623 AGAAATAGCCTTTGCATTCTTGG + Intronic
904948610 1:34217584-34217606 AGGTAAAGTCTCTGCTCTCTTGG + Intronic
906498890 1:46325656-46325678 AGGGACAGGAATTGCTCTCTTGG - Intergenic
910731482 1:90402180-90402202 AGGGCTATCCTTTGCCCTCTGGG - Intergenic
912273880 1:108236605-108236627 AAGGATAGATTTTTCTCTCTTGG - Intronic
912287386 1:108383257-108383279 AAGGATAGATTTTTCTCTCTTGG + Intronic
912294339 1:108457718-108457740 AAGGATAGATTTTTCTCTCTTGG + Intronic
913542622 1:119836322-119836344 AAGGATAGATTTTTCTCTCTTGG - Intergenic
915049525 1:153053412-153053434 AGGGATTGCCTTGGCTATTTGGG - Intergenic
915082700 1:153362799-153362821 ACAGATGGACTTTGCTCTCTTGG - Intergenic
916491052 1:165302791-165302813 AGGGTTAGGTTTTTCTCTCTAGG + Intronic
917748558 1:178034513-178034535 AGGCATAGACTTTGCCCTCATGG + Intergenic
917802498 1:178583068-178583090 TGGGATAGACTTTGATTTCTGGG - Intergenic
919358295 1:196555678-196555700 TAGGATAACCTTTGCTATCTGGG - Intronic
920957563 1:210633284-210633306 ATGGTTAGACTTTGCTGTCTGGG + Intronic
921078736 1:211721722-211721744 AGGCATAGCCCCTGCCCTCTGGG - Intergenic
924028320 1:239861700-239861722 AGAGATAGCCTTTCACCTCTTGG - Intronic
924734783 1:246746195-246746217 AGGGACAGCAATTGCTCACTCGG - Intronic
1063902335 10:10747338-10747360 TAGGATGGCCTTTGCTTTCTTGG + Intergenic
1065965023 10:30763850-30763872 AGGGACAGCCTTTGCCTTGTGGG + Intergenic
1067718810 10:48710856-48710878 AGGGATTTCCTTTGTTATCTGGG + Intronic
1070550242 10:77485509-77485531 AGGGTCAGCCTGTGTTCTCTAGG - Intronic
1073131235 10:101190366-101190388 AGGGAGAGCCTTTCCTCTCCAGG - Intergenic
1073965669 10:108986719-108986741 AGGGAAAGCATTTGCTCTGCAGG - Intergenic
1075145895 10:119882784-119882806 AGGCACTGGCTTTGCTCTCTGGG - Intronic
1075518082 10:123125451-123125473 AGATATAGTCTCTGCTCTCTGGG - Intergenic
1075699346 10:124458970-124458992 TGGGAAAGCTTTTGCTTTCTGGG + Intergenic
1075959831 10:126558805-126558827 AGGCACAGCCCTTGCTCTCTGGG - Intronic
1079156592 11:17953731-17953753 AGAGAAGGCCCTTGCTCTCTTGG + Intronic
1079466249 11:20733852-20733874 AGGGACAGTCTTTGCCCTCATGG + Intronic
1080486675 11:32715281-32715303 GGGGATGGCCTCTGTTCTCTTGG + Intronic
1081104091 11:39043209-39043231 AGGGGTTGGTTTTGCTCTCTGGG - Intergenic
1081673161 11:44953008-44953030 GTGGATAACCTTTGCCCTCTGGG + Intergenic
1084576466 11:69991796-69991818 AGCTATAGCCCTTGCTCTCATGG + Intergenic
1084893642 11:72250030-72250052 AGGGAGGGTCTTTGTTCTCTGGG + Intergenic
1085218843 11:74855516-74855538 GGGGCTAGCCTGTTCTCTCTCGG + Intronic
1085258520 11:75190963-75190985 AGGCATAGCCTCTGCCCTCCAGG + Intronic
1085327038 11:75614154-75614176 AAGGACAGCCTTTACTCTCAGGG - Intronic
1085523426 11:77151185-77151207 GGGGACAGTCCTTGCTCTCTAGG - Intronic
1086759738 11:90613023-90613045 AGGGATAGGAATTGCTCACTTGG - Intergenic
1086899232 11:92347549-92347571 TGGGACAGCCTTGGCTCTGTAGG - Intergenic
1088026585 11:105191921-105191943 AGGGAAAGTCTTTTCTCTCCTGG + Intergenic
1088244554 11:107804487-107804509 AGGAATAGCCTTTGGTTACTAGG - Intronic
1088830284 11:113530940-113530962 AGGCATAGTCTCTGCTCTCAAGG - Intergenic
1089084362 11:115804317-115804339 AGTCATAGCCTCTGCTCTCTGGG - Intergenic
1089676498 11:120093493-120093515 AGGGATAGTCTTTGCTCTGGTGG + Intergenic
1089741790 11:120589661-120589683 AGGGTTACGCTTTGCTTTCTGGG - Intronic
1089815594 11:121171481-121171503 AGGGATTGCATTTGATCTGTGGG + Intronic
1090981828 11:131729245-131729267 AGGGTTAGCCTTAGCCCTCAGGG + Intronic
1091742504 12:2969849-2969871 ACTGATAGCCACTGCTCTCTGGG - Intronic
1092587104 12:9910874-9910896 AGGGATACCCTTTCTCCTCTGGG - Intronic
1094120549 12:26969611-26969633 AGGCATGGTCTTTGCTGTCTGGG - Intergenic
1094281340 12:28743048-28743070 AGGGAGAGACATAGCTCTCTGGG + Intergenic
1097248617 12:57620340-57620362 AGGCATGGCTTTTGCTCTCCTGG + Exonic
1098639718 12:72824408-72824430 AGGGATAGGAATTGCTCACTTGG - Intergenic
1099713199 12:86255730-86255752 AGCCAGAGCCTTTGCTCACTTGG + Intronic
1101407337 12:104440422-104440444 AGAGAAATCCTTTTCTCTCTTGG - Intergenic
1104962387 12:132494382-132494404 AAGGATGGCCTTTGCTATGTGGG - Intronic
1107649675 13:42532122-42532144 AAGGAAAGCCTTTGCTCCTTTGG - Intergenic
1108672822 13:52709114-52709136 TGGGAAAGCTTTTGCTTTCTCGG + Intronic
1109374387 13:61471110-61471132 AGGCTTAGCATTTGCTTTCTTGG + Intergenic
1112447407 13:99476732-99476754 AAGTACAGCCATTGCTCTCTTGG - Intergenic
1112888295 13:104201052-104201074 ATGCATAGCCTTTGCTCTAGGGG - Intergenic
1113108100 13:106792715-106792737 AGGGTAAGCTTTTTCTCTCTTGG - Intergenic
1115307562 14:31948123-31948145 AGGCATGGCCTTTTCTCTCAAGG + Intronic
1118691228 14:68342316-68342338 GGGGAAAGTCTTTGTTCTCTAGG + Intronic
1119744900 14:77037217-77037239 GGGGATATCCTTGTCTCTCTAGG - Intergenic
1125926209 15:43565263-43565285 AGGGATAGACTGTGCTCTTCAGG + Intronic
1125939353 15:43664814-43664836 AGGGATAGACTGTGCTCTTCAGG + Intronic
1129813755 15:78533529-78533551 TGAGATAGTCTTTGTTCTCTGGG - Exonic
1135063045 16:19287070-19287092 AGGGATAGTCTTAGCTCATTTGG + Intronic
1135711239 16:24719178-24719200 AGATATGGCCTTTGCTCTCCTGG + Intergenic
1136360431 16:29775929-29775951 CGGGACTGCCTTTGCTATCTGGG + Intergenic
1136481804 16:30546726-30546748 AGGGATAGGAATTGCTCACTCGG - Intronic
1137428361 16:48398799-48398821 AGGGTCGGCCTCTGCTCTCTGGG - Intronic
1139483171 16:67241891-67241913 AGGGACATTCTCTGCTCTCTTGG - Intronic
1140238188 16:73177770-73177792 AGGGATAGGCCTTGTTCTCAAGG + Intergenic
1141253768 16:82382253-82382275 AACTACAGCCTTTGCTCTCTTGG + Intergenic
1141547970 16:84785025-84785047 AGGTATAGCCTTGGCTTTCTTGG + Intergenic
1144090015 17:11847805-11847827 ATGGACTGCCTTTGCCCTCTAGG + Intronic
1144370277 17:14583953-14583975 AGGGATAGCTTGGCCTCTCTGGG - Intergenic
1146648908 17:34594151-34594173 AGAGATGGCCTCTGCTCTCAAGG - Intronic
1147951076 17:44108417-44108439 AGGGATAGCCTTTGCTCTCTGGG - Intronic
1149062643 17:52441429-52441451 TGGGATTGCCTTGGCTATCTGGG - Intergenic
1149410304 17:56398154-56398176 AGGCATAGTCTCTGCTCTCATGG - Intronic
1149607447 17:57935080-57935102 TTGAATAGCCTTTGCTGTCTTGG - Intronic
1152726261 17:81948133-81948155 AGGCATAGCCTTTGCTATTCAGG - Intergenic
1152758511 17:82097077-82097099 GGGGATAGCCTATGCTCTGGGGG + Intronic
1155339060 18:24795821-24795843 TGGGATACCCTCTGCTCCCTGGG + Intergenic
1156370440 18:36467748-36467770 AGGGCTGGCCTTTGCACTGTGGG + Intronic
1156908442 18:42382085-42382107 TGGGATGGCCTTTGGGCTCTAGG + Intergenic
1157126681 18:44962899-44962921 AGGGAAAGCTTTTTATCTCTGGG - Intronic
1157465627 18:47942240-47942262 TGTGTTTGCCTTTGCTCTCTTGG - Intergenic
1158692799 18:59676256-59676278 AGGAACAGTCTTTGTTCTCTTGG + Intronic
1161617851 19:5282092-5282114 AGGGACAGCCTTGGTTCCCTGGG + Intronic
1161670034 19:5601983-5602005 GGGGCTAGCCTTTGCCATCTTGG - Intronic
1164735368 19:30537088-30537110 AGACACAGCCTTTGCTCTCAAGG - Intronic
1168034359 19:53707219-53707241 AGGCATTGCCTTTTCTCTTTGGG + Intergenic
925019273 2:555796-555818 AGTCATAGCCTCTGCTCTGTGGG - Intergenic
925603528 2:5634641-5634663 AGTCATAGTCTTTGCTCTCATGG - Intergenic
925606111 2:5661840-5661862 AGGCCTAGCCTTTGCTCTCTCGG + Intergenic
927886727 2:26723367-26723389 AGGGTTTGCCTCTGATCTCTTGG + Intronic
928256852 2:29730152-29730174 AAGGACAGCCTTTGCTTTCTCGG - Intronic
928373639 2:30758652-30758674 AGGGCTAGCCTTGGCTATCTTGG - Intronic
928420737 2:31136539-31136561 AGAGATAGAATTTACTCTCTGGG - Intronic
928842137 2:35622224-35622246 AGGCATGGTCTTTGCTCTCTGGG + Intergenic
930330713 2:49979396-49979418 ACGGAGAGCCTTTGCTATCAGGG + Intronic
930340616 2:50110158-50110180 AGGGATAGCTGATGTTCTCTTGG - Intronic
931381968 2:61762069-61762091 AGGGATAGCCTCTGCCATCCTGG + Intergenic
934551815 2:95267445-95267467 AGGAAAGGCCTTTCCTCTCTGGG - Intergenic
934710552 2:96511353-96511375 AGGCTTAGCCTTGGCTCTCCTGG - Intergenic
936659312 2:114524598-114524620 AGGCATAGCCGTAGCTCTCAAGG + Intronic
937606990 2:123812484-123812506 TAGGATTGCCTTTGCTATCTGGG - Intergenic
938691979 2:133800213-133800235 AGGGGAAAACTTTGCTCTCTGGG + Intergenic
940040569 2:149355900-149355922 AGGATTGGCCTTTGCACTCTGGG + Intronic
940363859 2:152824284-152824306 AGAGCTAGGCTTTGCTCTCCTGG - Intergenic
940387428 2:153090205-153090227 AGGGATTGTTATTGCTCTCTTGG + Intergenic
946477577 2:220023417-220023439 TGGGCTAGCCTAGGCTCTCTGGG + Intergenic
947453201 2:230227218-230227240 AGCAATAGCTTTTGCTTTCTTGG - Intronic
1169677873 20:8174860-8174882 AGGGATGGAATTTGCTATCTTGG - Intronic
1184572588 22:45335556-45335578 AGGGATGGCTTTTAGTCTCTTGG - Intronic
950984780 3:17350336-17350358 AGTGATAGCCTTTCCCCACTGGG + Intronic
951235397 3:20230082-20230104 AGGGATTTCCTTTCCTTTCTTGG + Intergenic
953738055 3:45513270-45513292 AGGCCTGGCCTTGGCTCTCTGGG - Intronic
956703083 3:71976156-71976178 AGGAGTAGCCTTAGCTCTTTGGG - Intergenic
963936985 3:151064329-151064351 AGTGATGGCCCCTGCTCTCTGGG - Intergenic
966933879 3:184692938-184692960 AGGCAGAGCCTTGGGTCTCTAGG + Intergenic
966989249 3:185212058-185212080 AGAGAGAGCCTTTAGTCTCTTGG + Intronic
967104303 3:186242864-186242886 GGGGAAAGCCTTTGCCCTCTGGG + Intronic
967787382 3:193512325-193512347 AGGGATAAAATTTGCTTTCTGGG - Intronic
968383235 4:112488-112510 AGGGATAGGAATTGCTCACTTGG - Intergenic
970223736 4:13836043-13836065 AGGCACAGCCTCTGTTCTCTGGG + Intergenic
970379313 4:15490982-15491004 AGGGATAGGAATTGCTCACTCGG + Intronic
971576558 4:28281701-28281723 AGGGATAGGAATTGCTCACTTGG + Intergenic
972784255 4:42312332-42312354 AGGGACAGGAATTGCTCTCTTGG - Intergenic
975530313 4:75393447-75393469 AGGAATAGCCCTTGGGCTCTTGG - Intergenic
977131413 4:93243641-93243663 TGGACTAGTCTTTGCTCTCTTGG + Intronic
981734693 4:147936725-147936747 AGGGCTAGCCTTTGCTCTTCTGG + Intronic
984424712 4:179568648-179568670 AGGGATAGGAATTGCTCACTCGG - Intergenic
985163039 4:187063695-187063717 AGAGAAAGCGTTTGCTCACTTGG - Intergenic
986381497 5:7190871-7190893 AGGGGCTGCCTTTGCTCACTTGG - Intergenic
986515433 5:8557755-8557777 AGGGTTAGCCTTAGCTTTCATGG + Intergenic
991361025 5:65820478-65820500 ATGGAAAGACTGTGCTCTCTGGG - Intronic
993385661 5:87260538-87260560 AGGTACAGTCTTTGCTCTCATGG - Intergenic
994243181 5:97448029-97448051 AGGGGTTTCCTTTGATCTCTAGG - Intergenic
996843524 5:127874597-127874619 AGGGATGGTTTTTGCTCACTAGG - Intergenic
999058316 5:148605984-148606006 AGGCATGGCCATTGCCCTCTGGG + Intronic
999992689 5:157063850-157063872 ATGGAAAGCGTTTGCTGTCTTGG - Intergenic
1002443817 5:179277513-179277535 GGGGTCAGCCTTTGGTCTCTGGG - Intronic
1002443849 5:179277608-179277630 GGGGTCAGCCTTTGGTCTCTGGG - Intronic
1003153753 6:3574045-3574067 GGGGAGAGGCTTTCCTCTCTAGG + Intergenic
1003965061 6:11245011-11245033 AGGTATAGTCTTTGCCTTCTAGG - Intronic
1006404116 6:33834182-33834204 TGGGAAAGCTTTTGCTTTCTGGG + Intergenic
1006625268 6:35393118-35393140 AGGCATAGGCTTTGCTGTATGGG + Intronic
1007047970 6:38796760-38796782 AGGGACAGCAATTGCTCACTCGG + Intronic
1007783717 6:44268599-44268621 AGGGGTAGCCTTTTGTCTCTTGG + Intergenic
1010735231 6:79436465-79436487 AGTCATAACCTTTGCTTTCTAGG - Intergenic
1011189972 6:84718196-84718218 GGCAATAGCCTTTGCTCTCAGGG + Intronic
1011723663 6:90185802-90185824 AGACACAGCCTTTGCTCTCTGGG - Intronic
1016567541 6:145472784-145472806 AGGTATCGCCTTTGTTGTCTTGG - Intergenic
1021325531 7:19262316-19262338 AGGGATTGATTTTGCTGTCTTGG + Intergenic
1023199474 7:37680149-37680171 TGGGATTGCCTTTGCACTTTTGG + Intergenic
1023874135 7:44277767-44277789 GGGGAAGGCCATTGCTCTCTGGG + Intronic
1023874155 7:44277825-44277847 GGGGAAGGCCATTGCTCTCTGGG + Intronic
1028880629 7:95875815-95875837 AGAGATAGCCAATGCTCCCTAGG - Intronic
1030747077 7:113179519-113179541 AGGGATGGACTTTACCCTCTGGG - Intergenic
1033283757 7:140023648-140023670 AGGGATTGCCTTTGTTCATTTGG - Intergenic
1033551566 7:142452279-142452301 AGGCACAGCCTTAGCTCTCATGG - Intergenic
1033553858 7:142471124-142471146 AGGCACAGCCTTAGCTCTCATGG - Intergenic
1033556082 7:142489457-142489479 AGGCACAGCCTTAGCTCTCATGG - Intergenic
1037384249 8:18320513-18320535 AGGGACAGCAATTGCTCACTGGG - Intergenic
1039008403 8:33066687-33066709 TGGGATTGCCTTGGCTATCTGGG - Intergenic
1039806672 8:41005806-41005828 AGGTATAGCTTCTGCTTTCTTGG - Intergenic
1040036494 8:42875337-42875359 ACAGAGAGCCTTTACTCTCTGGG + Intronic
1040859979 8:51989127-51989149 AGGGAAAGCCTGTCCTCTCTTGG + Intergenic
1047375423 8:124291417-124291439 AGAAATAGCCTTTGCATTCTAGG + Intergenic
1048498651 8:134956509-134956531 AGGGAGAGCCTTTGCTGCCCTGG + Intergenic
1049503840 8:142984341-142984363 AGGGACAGCCAGTGTTCTCTAGG + Intergenic
1051062727 9:13063658-13063680 AGGGATGGCGCTTGCTCTCCTGG - Intergenic
1053489858 9:38490229-38490251 AGTGTGAGCCCTTGCTCTCTTGG - Intergenic
1055431273 9:76246745-76246767 ACGGATCGTCTTTGCTCTTTTGG - Intronic
1057976188 9:99608683-99608705 TGGGATACCCTTTGCTCTTGGGG - Intergenic
1058972914 9:110099559-110099581 AGGAAAAGCCTGTGCTGTCTGGG - Intronic
1059567098 9:115393727-115393749 AGGGCTGGGCTTAGCTCTCTGGG + Intronic
1060336958 9:122733802-122733824 TAGGATAGCCTTTGCTATTTAGG - Intergenic
1185787396 X:2902363-2902385 ATGGATTGCCTTTGGTCTGTTGG + Intergenic
1186452889 X:9687943-9687965 GGGAATGGCCTCTGCTCTCTGGG - Intronic
1190779982 X:53584552-53584574 AGGGATGGTATTTGCTCTGTTGG - Intronic
1191638914 X:63409374-63409396 AGGGACAGGAATTGCTCTCTCGG + Intergenic
1193774392 X:85623943-85623965 AGGGACAGCAATTGCTCACTCGG + Intergenic
1194268444 X:91781624-91781646 AGGGCTGGCCTTTCCTCTGTGGG + Intronic
1196656282 X:118220819-118220841 AGGCCTTGCCTTTGCTCTTTGGG - Intergenic
1197553008 X:127918052-127918074 AGGGATAGGAATTGCTCACTCGG + Intergenic
1199439142 X:147848703-147848725 AGGGATAGCATGTGCTGTCAAGG + Intergenic
1199700708 X:150373547-150373569 AGACCTAGCCTTTGCTATCTTGG - Intronic
1200585643 Y:5002537-5002559 AGGGCTGGCCTTTCCTCTGTGGG + Intronic
1200988227 Y:9325809-9325831 AGGCACAGGCTTTGCTCTGTTGG + Intergenic
1202119791 Y:21510385-21510407 AGGCACAGGCTTTGCTCTGTTGG - Intergenic
1202122242 Y:21533926-21533948 AGGCACAGGCTTTGCTCTGTTGG - Intronic
1202156763 Y:21895457-21895479 AGGCACAGGCTTTGCTCTGTTGG + Intronic
1202159211 Y:21918998-21919020 AGGCACAGGCTTTGCTCTGTTGG + Intergenic
1202171680 Y:22053031-22053053 ATGGATAGCCTTAGCACTTTGGG - Intergenic
1202185660 Y:22183913-22183935 AGGCACAGGCTTTGCTCTGTTGG + Intergenic
1202205700 Y:22402483-22402505 AGGCACAGGCTTTGCTCTGTTGG - Intronic
1202219682 Y:22533341-22533363 ATGGATAGCCTTAGCACTTTGGG + Intergenic
1202323495 Y:23662742-23662764 ATGGATAGCCTTAGCACTTTGGG - Intergenic
1202547276 Y:26007312-26007334 ATGGATAGCCTTAGCACTTTGGG + Intergenic