ID: 1147951077

View in Genome Browser
Species Human (GRCh38)
Location 17:44108418-44108440
Sequence TAGGGATAGCCTTTGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147951077_1147951084 9 Left 1147951077 17:44108418-44108440 CCAGAGAGCAAAGGCTATCCCTA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1147951084 17:44108450-44108472 TCTAAAGATGCTGCTGGAGGTGG 0: 1
1: 0
2: 1
3: 17
4: 242
1147951077_1147951085 13 Left 1147951077 17:44108418-44108440 CCAGAGAGCAAAGGCTATCCCTA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1147951085 17:44108454-44108476 AAGATGCTGCTGGAGGTGGCAGG 0: 1
1: 0
2: 1
3: 51
4: 418
1147951077_1147951082 3 Left 1147951077 17:44108418-44108440 CCAGAGAGCAAAGGCTATCCCTA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
1147951077_1147951086 17 Left 1147951077 17:44108418-44108440 CCAGAGAGCAAAGGCTATCCCTA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1147951086 17:44108458-44108480 TGCTGCTGGAGGTGGCAGGCAGG 0: 1
1: 0
2: 8
3: 97
4: 706
1147951077_1147951083 6 Left 1147951077 17:44108418-44108440 CCAGAGAGCAAAGGCTATCCCTA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1147951083 17:44108447-44108469 GGTTCTAAAGATGCTGCTGGAGG 0: 1
1: 0
2: 0
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147951077 Original CRISPR TAGGGATAGCCTTTGCTCTC TGG (reversed) Intronic
901892819 1:12282572-12282594 AAGAGATAGTCTTTGCTATCAGG + Intronic
903535078 1:24061379-24061401 CAGGGATAAGCTTTGCTCCCAGG - Intronic
906416490 1:45624057-45624079 TGGGGAGAGCCTTAGCTCCCTGG + Exonic
907158026 1:52352336-52352358 CAGGGAAAGCCTTTCCTCTTCGG - Exonic
910731483 1:90402181-90402203 GAGGGCTATCCTTTGCCCTCTGG - Intergenic
914331421 1:146674051-146674073 TAGGGCTATCCTTTGCTTTTAGG - Intergenic
915049526 1:153053413-153053435 TAGGGATTGCCTTGGCTATTTGG - Intergenic
917105995 1:171492651-171492673 GTGGGATAGCCATTGCACTCCGG + Intronic
918602008 1:186375291-186375313 CAGGGATAGCCTCTGAGCTCGGG - Exonic
919241090 1:194917617-194917639 CAGGGAGAGCCAGTGCTCTCTGG - Intergenic
919358296 1:196555679-196555701 TTAGGATAACCTTTGCTATCTGG - Intronic
919960312 1:202460988-202461010 TAGGGGTAGCCTCATCTCTCAGG - Intronic
1064525933 10:16256751-16256773 TAGGGGCAGCTTTTGCTCCCTGG - Intergenic
1069147213 10:64908917-64908939 GAGTGATAGCCTCTGCTCTTAGG + Intergenic
1075878790 10:125831340-125831362 AAGTGATAGCTTTTACTCTCAGG + Intronic
1075959832 10:126558806-126558828 AAGGCACAGCCCTTGCTCTCTGG - Intronic
1079299164 11:19262021-19262043 TAGGGCTAGCTCTTGCTCTCTGG + Intergenic
1085327039 11:75614155-75614177 AAAGGACAGCCTTTACTCTCAGG - Intronic
1087863375 11:103192612-103192634 TAAGAATAGCCATTGCTCTTAGG - Intronic
1089084363 11:115804318-115804340 TAGTCATAGCCTCTGCTCTCTGG - Intergenic
1089815593 11:121171480-121171502 TAGGGATTGCATTTGATCTGTGG + Intronic
1090764716 11:129866504-129866526 TAGGGAGAGGCCATGCTCTCCGG + Intronic
1090981827 11:131729244-131729266 AAGGGTTAGCCTTAGCCCTCAGG + Intronic
1096053508 12:48631663-48631685 TAGGGAGAGCTTTTGTTTTCGGG - Intergenic
1098598792 12:72304681-72304703 TAGGGATAGACTTAGCTATGGGG - Intronic
1104962388 12:132494383-132494405 TAAGGATGGCCTTTGCTATGTGG - Intronic
1112888296 13:104201053-104201075 CATGCATAGCCTTTGCTCTAGGG - Intergenic
1115468939 14:33747656-33747678 TAGAGATATCCATTGCTCACTGG - Intronic
1118666639 14:68077107-68077129 TAGGGATGGGCTTTTTTCTCTGG + Intronic
1121632867 14:95433571-95433593 AAGGCCTAGCCCTTGCTCTCAGG + Intronic
1125439461 15:39686570-39686592 TAGTCACAGCCTTTGCTCACAGG - Intronic
1127988335 15:64092924-64092946 TAGGCACAGCCTTTGCTTTTTGG + Intronic
1128974960 15:72145270-72145292 GAGGGTTAGCCTTAGCTCTGAGG - Intergenic
1132002503 15:98194119-98194141 TAGAGATGGTCCTTGCTCTCAGG - Intergenic
1132247228 15:100307012-100307034 TTGGGATGGCGTTTGCTCACAGG - Intronic
1137827064 16:51507519-51507541 AAGGGCATGCCTTTGCTCTCAGG + Intergenic
1138256882 16:55572782-55572804 TATGGATAGCCACTGCACTCCGG + Intronic
1140002132 16:71036849-71036871 TAGGGCTATCCTTTGCTTTTAGG + Intronic
1144370278 17:14583954-14583976 TAGGGATAGCTTGGCCTCTCTGG - Intergenic
1145890736 17:28413727-28413749 TAGGGATTCCATTTGGTCTCAGG + Intergenic
1147951077 17:44108418-44108440 TAGGGATAGCCTTTGCTCTCTGG - Intronic
1149062644 17:52441430-52441452 TTGGGATTGCCTTGGCTATCTGG - Intergenic
1149650495 17:58273341-58273363 TAGGGATCACCTTGGCTCTAGGG - Intronic
1149973239 17:61240283-61240305 TAGGGACAGGCTTTGAACTCAGG + Intronic
1152758510 17:82097076-82097098 TGGGGATAGCCTATGCTCTGGGG + Intronic
1153354750 18:4122842-4122864 AAGGGAGAACCTTTGCTCTTTGG - Intronic
1155339059 18:24795820-24795842 TTGGGATACCCTCTGCTCCCTGG + Intergenic
1156370439 18:36467747-36467769 TAGGGCTGGCCTTTGCACTGTGG + Intronic
1162847441 19:13404303-13404325 CAGGGATTGGCTCTGCTCTCAGG - Intronic
1163565605 19:18049466-18049488 TAGGGCTAGGCTTTGGGCTCAGG - Intergenic
1164915436 19:32048064-32048086 CTAGGAAAGCCTTTGCTCTCTGG - Intergenic
1168034358 19:53707218-53707240 TAGGCATTGCCTTTTCTCTTTGG + Intergenic
925642702 2:6001965-6001987 AAGTGAGAGCCTTTGCTCTAGGG - Intergenic
926314893 2:11702298-11702320 TAGGGACAGCCTGTGTACTCCGG - Intronic
928842136 2:35622223-35622245 AAGGCATGGTCTTTGCTCTCTGG + Intergenic
929150297 2:38741686-38741708 TAGGGAAAGCTTTTACTCTAGGG - Intergenic
930330712 2:49979395-49979417 CACGGAGAGCCTTTGCTATCAGG + Intronic
936601508 2:113900664-113900686 TAGGGATAGTCTATGATCACAGG + Intronic
937606991 2:123812485-123812507 TTAGGATTGCCTTTGCTATCTGG - Intergenic
937613123 2:123887577-123887599 AAGAGATAGCCTTTCCTCTTAGG - Intergenic
941864946 2:170325003-170325025 TAGTGATAGCCTTTCCACTGAGG + Intronic
942480274 2:176380128-176380150 TAGAGATAGTCTTTACTCTATGG + Intergenic
942514534 2:176737994-176738016 TAGGCATTGCCTTTGCTCAAAGG + Intergenic
944302082 2:198135054-198135076 TCTTGATAGCCTTTGCTCTGGGG + Intronic
946429008 2:219614757-219614779 TACCCAGAGCCTTTGCTCTCGGG + Intronic
1169082222 20:2804770-2804792 TCTGGATAGCTTTTCCTCTCCGG - Intergenic
1170259708 20:14390424-14390446 TTAGGATTGCCTTTGCTATCTGG - Intronic
1170458666 20:16556364-16556386 TGGGCATAGTCCTTGCTCTCTGG - Intronic
1171381094 20:24734734-24734756 TAGGAAGGGCCCTTGCTCTCAGG + Intergenic
1172811275 20:37650004-37650026 TAGCCACAGCCTTTCCTCTCTGG - Intergenic
1173448079 20:43138160-43138182 TAGGGATTGCCCGGGCTCTCTGG + Intronic
1184963055 22:47945474-47945496 CAGGGATAGCCCTTTCTCTCTGG + Intergenic
950133503 3:10564097-10564119 TAGGTCTAGCCTTGGCTCTGAGG + Intronic
950688101 3:14633499-14633521 GAGGCAAACCCTTTGCTCTCAGG - Intergenic
951867463 3:27324098-27324120 TAGGGATAGTCTATGCTCTTTGG + Intronic
952569553 3:34698154-34698176 GAGGCATAGCTTTTGTTCTCTGG - Intergenic
953807135 3:46080296-46080318 AAATGATTGCCTTTGCTCTCTGG - Intergenic
953819627 3:46194215-46194237 TAGGGCTTGCCTTTACTCTAGGG - Intronic
955642275 3:61098409-61098431 TTGGGATTGCCTTGGCTCTTGGG + Intronic
956369403 3:68542097-68542119 TAGGCAAAGCCTTTTCTTTCAGG + Intronic
961403058 3:126660606-126660628 CAGGTATACCCTTTGCTCCCTGG + Intergenic
964080881 3:152755338-152755360 TTAGGATAGACTTTTCTCTCGGG - Intergenic
967104302 3:186242863-186242885 AGGGGAAAGCCTTTGCCCTCTGG + Intronic
968510349 4:992860-992882 TAGGCAAAGACTTTGCTCCCAGG + Exonic
968707430 4:2086682-2086704 TAGGGAAAGCCTTGGCCCTGGGG + Intronic
969166232 4:5318054-5318076 TAGAGAAAGTCTTGGCTCTCAGG + Intronic
981008428 4:139899553-139899575 TTGGCATAGACTTTGCTCTGGGG - Intronic
982501937 4:156168413-156168435 CAGGCATAACCTTTGGTCTCAGG + Intergenic
983647162 4:170003661-170003683 CAGGGATAACCTTTGCTTTAGGG + Intronic
985648069 5:1094491-1094513 TAGGGATAGCTTGTGTTCTGGGG - Intronic
987668902 5:20983189-20983211 TAGGGAAAGCCCTTGCTGACTGG + Intergenic
997720286 5:136073221-136073243 TAAGCAAAGCCTTTTCTCTCTGG + Intergenic
998708784 5:144796969-144796991 TAGAGATAGTCTTTGTTTTCAGG + Intergenic
1003016568 6:2472756-2472778 ATGGGACAGCCTTTTCTCTCTGG + Intergenic
1006404115 6:33834181-33834203 TTGGGAAAGCTTTTGCTTTCTGG + Intergenic
1008644819 6:53503255-53503277 TGGTGAGAGCTTTTGCTCTCTGG - Intronic
1011189971 6:84718195-84718217 TGGCAATAGCCTTTGCTCTCAGG + Intronic
1011723664 6:90185803-90185825 TAGACACAGCCTTTGCTCTCTGG - Intronic
1013274212 6:108568633-108568655 TATGGATAGCCTTAGTTCTGGGG + Intronic
1013475791 6:110506194-110506216 AAGGGAAGGCCTGTGCTCTCAGG - Intergenic
1013746439 6:113352076-113352098 AAGGCATGGCCCTTGCTCTCAGG + Intergenic
1024657779 7:51466590-51466612 TGGGGTTTGCCTTTGGTCTCTGG + Intergenic
1029125602 7:98293177-98293199 AAGGGATAGTCTATGCTTTCAGG - Exonic
1039008404 8:33066688-33066710 TTGGGATTGCCTTGGCTATCTGG - Intergenic
1040036493 8:42875336-42875358 TACAGAGAGCCTTTACTCTCTGG + Intronic
1046038381 8:108872803-108872825 AAGGGATTACCTTTGCACTCTGG + Intergenic
1046869574 8:119190326-119190348 AAGGGATAGCCATTACACTCTGG + Intronic
1048013838 8:130480457-130480479 CAGGGAAGGCCTTGGCTCTCAGG + Intergenic
1049469756 8:142770048-142770070 TAGGGATAGCCCTGGCTGACAGG + Intronic
1050974777 9:11924199-11924221 TAAGGATTGCCTTGGCTATCCGG + Intergenic
1053119237 9:35533320-35533342 CAGTGATAGCCTCTGCTTTCTGG + Intronic
1055146651 9:72943759-72943781 TAGCCATGGCCTCTGCTCTCAGG + Intronic
1057976189 9:99608684-99608706 CTGGGATACCCTTTGCTCTTGGG - Intergenic
1058972915 9:110099560-110099582 TAGGAAAAGCCTGTGCTGTCTGG - Intronic
1186452890 X:9687944-9687966 TGGGAATGGCCTCTGCTCTCTGG - Intronic
1189009410 X:37031384-37031406 TAGGGATAGGCTTTGCACGGTGG + Intergenic
1190972241 X:55361495-55361517 TATGGATAGCCTGTTCTTTCAGG - Intergenic
1199725325 X:150574290-150574312 TGGGGATTGCCCTTGCTCCCCGG + Intronic
1202575403 Y:26318953-26318975 TAGGGGTAGCCTCATCTCTCAGG + Intergenic