ID: 1147951082

View in Genome Browser
Species Human (GRCh38)
Location 17:44108444-44108466
Sequence TAGGGTTCTAAAGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147951077_1147951082 3 Left 1147951077 17:44108418-44108440 CCAGAGAGCAAAGGCTATCCCTA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
1147951074_1147951082 13 Left 1147951074 17:44108408-44108430 CCAAGACAGCCCAGAGAGCAAAG 0: 1
1: 0
2: 7
3: 40
4: 405
Right 1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
1147951076_1147951082 4 Left 1147951076 17:44108417-44108439 CCCAGAGAGCAAAGGCTATCCCT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147951082 Original CRISPR TAGGGTTCTAAAGATGCTGC TGG Intronic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG + Intergenic
907739535 1:57151327-57151349 TAAGGTCCTCCAGATGCTGCAGG + Intronic
910522672 1:88140546-88140568 TTGTGTTCTACAGATGCTTCTGG + Intergenic
913260140 1:116990428-116990450 GAAGGTGCTAAAGTTGCTGCTGG - Intergenic
915181343 1:154063380-154063402 TAGGGATCTAAAGTTGTTGAGGG + Intronic
917542867 1:175932522-175932544 TAGGGTTCTATATATGATGCAGG - Intergenic
918611565 1:186498212-186498234 TAGGGTTCACAAGAGGCTCCTGG - Intergenic
919859640 1:201730941-201730963 TGGGGGTCCAAAGATGCTGAAGG + Intronic
920122761 1:203671119-203671141 TTGGAATATAAAGATGCTGCAGG - Intronic
1066375736 10:34856483-34856505 AGGGGTTCTTATGATGCTGCAGG - Intergenic
1067959704 10:50834344-50834366 TAGGTTTCTCAAGAAGGTGCTGG + Intronic
1072566570 10:96621396-96621418 TGGGGTTCTGAAGATTATGCTGG - Intronic
1074340311 10:112622045-112622067 TCTGGTTCTAATCATGCTGCAGG + Intronic
1078881418 11:15452672-15452694 TAGGATTCCAAAGTTCCTGCAGG + Intergenic
1080189815 11:29531017-29531039 AAGGGATCTAAAAATGCTGTAGG + Intergenic
1081405380 11:42691771-42691793 TAGGGTTCTTGATGTGCTGCTGG - Intergenic
1085755757 11:79200056-79200078 GATGCTTCTAGAGATGCTGCAGG - Intronic
1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG + Intergenic
1089709504 11:120305051-120305073 TGGGGTTCTAAAGAGGATCCTGG - Exonic
1097108485 12:56639979-56640001 TGGGGTGCAAAAGATCCTGCAGG - Exonic
1098821480 12:75236324-75236346 TCTGGTACTAAAGATGCTCCAGG + Intergenic
1102738473 12:115184714-115184736 TTGGGTTCTGGAGATGCAGCAGG - Intergenic
1105445792 13:20455995-20456017 TAGGGTTCAACAAATGGTGCTGG + Intronic
1107626677 13:42293746-42293768 TAGGGTTTTGAAGATGCCGGGGG - Intronic
1108319031 13:49269159-49269181 AAGGTCTCTACAGATGCTGCTGG + Intronic
1112929597 13:104717704-104717726 TAGGGTGAAGAAGATGCTGCTGG - Intergenic
1116244246 14:42388327-42388349 TAGGCTTCTAAATATTATGCAGG + Intergenic
1122273896 14:100581371-100581393 TGAGGCTCTAAGGATGCTGCCGG + Intronic
1122663775 14:103315263-103315285 TATGGTTCGAAGGATGCTGGTGG - Intergenic
1128803276 15:70511110-70511132 TTGGTTTATAAAAATGCTGCTGG - Intergenic
1130826806 15:87557195-87557217 TAGGGCTTTGAAGAAGCTGCAGG + Intergenic
1133318086 16:4896291-4896313 GAGAGTTCTTAAGAAGCTGCGGG - Intronic
1135705525 16:24671410-24671432 TGGGGTGCTGAAGATGCTGGTGG + Intergenic
1137429436 16:48406627-48406649 TAGGGTGGTAATGATACTGCAGG - Intronic
1138150234 16:54650136-54650158 TAGGGCTCTGAAGATGCCACGGG + Intergenic
1140446947 16:75037121-75037143 AAAGCTTCAAAAGATGCTGCTGG - Intronic
1144457079 17:15427716-15427738 TAGGTTTCTAAAGAACCTACAGG + Intergenic
1146626853 17:34441588-34441610 TAGGGCTCAAAGGCTGCTGCAGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149869766 17:60170908-60170930 TAGGGTGGTAAAGAAGCAGCTGG + Intergenic
1151555299 17:74843442-74843464 CAGCGTGCTCAAGATGCTGCAGG - Exonic
1152093401 17:78258914-78258936 TAGGGCGCTATAGATCCTGCAGG - Intergenic
1153584112 18:6603475-6603497 TAAGGTTCCAAAAATTCTGCAGG + Intergenic
1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG + Intergenic
1159768309 18:72517632-72517654 TAGGATTCTAAAACTGCTTCAGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1164490603 19:28709660-28709682 TAGGGGTCTGAAGATGATGTTGG - Intergenic
1166059139 19:40314094-40314116 TCAGGCTCTAGAGATGCTGCAGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932805297 2:74778041-74778063 TATGTGTTTAAAGATGCTGCAGG + Intergenic
933272602 2:80249242-80249264 TAGAGTTCTAAAGAACCTGCAGG + Intronic
934497837 2:94824922-94824944 CAGTGTTGCAAAGATGCTGCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940326610 2:152432422-152432444 TATTGTTCTAAAGATGCACCAGG + Intronic
940927369 2:159380098-159380120 TAAGGTTCTAAAGATTTTGGAGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1170149998 20:13219680-13219702 TAGAATTTTAAAGATGCTTCAGG + Intergenic
1172120594 20:32596488-32596510 TAAGGTTATAGAGATGCTGGTGG - Intronic
1172847440 20:37938330-37938352 TTGGGTTCTGAACATGCTGAGGG + Intronic
1179049380 21:37875557-37875579 TATGCTTCTGAAGCTGCTGCAGG + Intronic
1179061699 21:37985058-37985080 TGGGATTCTTGAGATGCTGCAGG - Intronic
1179526528 21:41980651-41980673 TGGGGTTCTAAAGTTTCTGTTGG - Intergenic
1181150817 22:20882021-20882043 CAGAGATCTGAAGATGCTGCTGG + Intronic
953363700 3:42323597-42323619 TATGGTTCTAAAGTTGAAGCAGG - Intergenic
955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG + Intergenic
957708092 3:83816067-83816089 TAGGTTTCTAGAGTTGCTGGTGG + Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
963716528 3:148810413-148810435 TAGGTTCTTACAGATGCTGCTGG + Intronic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
980408599 4:132385109-132385131 TATGGTTCTAATGATGCTAGTGG + Intergenic
981245889 4:142537206-142537228 TAGGCTTCTAGAGATGGTACTGG + Intronic
983803094 4:171960725-171960747 TAAGGTTCTAAAAATCCTGCTGG - Intronic
985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG + Intergenic
988306957 5:29505193-29505215 TAGGTGACTAAAGTTGCTGCTGG - Intergenic
989684438 5:44068756-44068778 TGTGGTTCTAAAGCTGCTGCTGG - Intergenic
990155036 5:52867329-52867351 TAAGGTTATAAATATCCTGCTGG + Intronic
993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG + Exonic
1002935370 6:1667133-1667155 TAGGGTTCTATAGAAGAAGCAGG + Intronic
1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG + Intergenic
1004640717 6:17512839-17512861 TAGGATTCTAAACATGCTGGTGG + Intronic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1009687297 6:66978830-66978852 TAGGGATCTAAAGATTCTCTAGG + Intergenic
1014198392 6:118583513-118583535 TGGGGCTGTAAAGATGCTGCAGG - Intronic
1016030508 6:139332730-139332752 TAGAGTTATGAAGAAGCTGCAGG - Intergenic
1018769733 6:166959901-166959923 TGAGGTTTAAAAGATGCTGCTGG + Intergenic
1025025558 7:55513615-55513637 AAGACCTCTAAAGATGCTGCAGG + Intronic
1029572893 7:101382689-101382711 TAGGTTTATAAAAATGCTGTTGG + Intronic
1030471726 7:109972536-109972558 TAGGGTTGTAAATATGCTAAAGG - Intergenic
1033357332 7:140610841-140610863 CAGGATTCTAAAGGAGCTGCCGG - Intronic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1037615337 8:20514152-20514174 TGGGCTTCAAAAGATGCTGGTGG + Intergenic
1039569641 8:38576504-38576526 TAGAGTTTTAAAGATGCCCCAGG + Intergenic
1039820063 8:41127104-41127126 TAGGGTTGTAAACAACCTGCAGG + Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG + Intergenic
1044791887 8:95856559-95856581 TAGTGATTTAAAGATGCAGCTGG - Intergenic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1049534833 8:143174300-143174322 TAGGGTTCTTATGAAGCTGAAGG + Intergenic
1050526281 9:6549468-6549490 CAGGGTTCTAAAGCTGCCTCAGG + Intronic
1053278181 9:36798936-36798958 GAGGTTTCTGAAGCTGCTGCTGG - Intergenic
1053369823 9:37551410-37551432 TAGATTTCAAAGGATGCTGCAGG - Intronic
1059010144 9:110449030-110449052 TATTGTCCTCAAGATGCTGCTGG - Intronic
1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG + Intronic
1188912111 X:35862358-35862380 TAGTGTTCTCAATATGATGCAGG + Intergenic
1189020163 X:37327779-37327801 TATTGTTGTAAAGTTGCTGCTGG + Intergenic
1193296803 X:79842927-79842949 TAAGCTTCTTAATATGCTGCTGG - Intergenic
1194690193 X:96974902-96974924 TAGGGTTCTCTAGAGGCTTCAGG + Intronic
1195743896 X:108094856-108094878 CAGGGTTCAAAAACTGCTGCTGG + Intronic
1198074746 X:133183620-133183642 TGGGCTTAGAAAGATGCTGCAGG + Intergenic
1198450568 X:136763522-136763544 TAGGGTTATAAAGATGATCACGG + Intronic
1199434813 X:147801706-147801728 TAGGGTTTTAAAAAAGCCGCAGG - Intergenic